Dataset for CDS BAX-like of Organism Bos mutus

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


L8IT09_BAK1-01      ----atggcttccggacaaggcccaggtcc----ccccgggcaggactgcgacgagcctg
L8IT09_BAK1-02      ----atggcttccggacaaggcccaggtcc----ccccgggcaggactgcgacgagcctg
L8IM55_BAX-02       atggacgggtccggggagcaacccagaggcggggggcccaccagctctgagcagatcatg
L8IM55_BAX-01       ----atgagacc------ccattctgattctgtatccccg-caactccg-----------
                        * *    *           * *   *      **   **   * *           

L8IT09_BAK1-01      ac--------ccctcctccacctcag--------aggagcaggtagcccgggacaccgag
L8IT09_BAK1-02      ac--------ccctcctccacctcag--------aggagcaggtagcccgggacaccgag
L8IM55_BAX-02       aagacaggggcccttttgcttcagggtttcatccaggatcgagcagggcgaatgg--ggg
L8IM55_BAX-01       --------------ttcccaccctagtttcatccaggatcgagcagggcgaatgg--ggg
                                      *  *   *        **** *  * **  **       * *

L8IT09_BAK1-01      gaggtcttccgcagctacgaacaggaggccgagggggcggctgcgcctactgacccagag
L8IT09_BAK1-02      gaggtcttccgcagctacgtctttta--------------ccgccccaactcac------
L8IM55_BAX-02       gagagacacccgagctgggctt-----------ggagcaggtgcccca------------
L8IM55_BAX-01       gagagacacccgagctgggctt-----------ggagcaggtgcccca------------
                    ***     **  ****  *                       ** **             

L8IT09_BAK1-01      atggtcaccttgcacccagaacctagcagcaccatggggcag-gtgggccgccagctcgc
L8IT09_BAK1-02      -tggccgcctcccgc------tcctccagcaccatggggcag-gtgggccgccagctcgc
L8IM55_BAX-02       --ggatgcatc------------------caccaagaagctgagcgagtgtctgaagcg-
L8IM55_BAX-01       --ggatgcatc------------------caccaagaagctgagcgagtgtctgaagcg-
                      **   * *                   ***** *  ** * * * *   *     ** 

L8IT09_BAK1-01      cgtcatcggggacgacatcaaccggcgctatgatgcggagttccaggccatgctgcagca
L8IT09_BAK1-02      cgtcatcggggacgacatcaaccggcgctatgatgcggagttccaggccatgctgcagca
L8IM55_BAX-02       ---catcggagatgaattggacag------taacatggagctgcagaggatgat--cgca
L8IM55_BAX-01       ---catcggagatgaattggacag------taacatggagctgcagaggatgat--cgca
                       ****** ** **  *  ** *      * *   **** * ***   *** *   ***

L8IT09_BAK1-01      cctgcagccaacagcagacaacgcctatgagtacttcaccaagatcgcgtccagcctgtt
L8IT09_BAK1-02      cctgcagccaacagcagacaacgcctatgagtacttcaccaagatcgcgtccagcctgtt
L8IM55_BAX-02       gctgtggaca----cagactctccccgagaggtctttttccgagtggcggctgaaatgtt
L8IM55_BAX-01       gctgtggaca----cagactctccccgagaggtctttttccgagtggcggctgaaatgtt
                     ***  * **    *****    **   ***  ***   *    * *** *     ****

L8IT09_BAK1-01      t---gagagcggtatcaactggggccgcgtggtggctctgctgggctttggctaccgcct
L8IT09_BAK1-02      t---gagagcggtatcaactggggccgcgtggtggctctgctgggctttggctaccgcct
L8IM55_BAX-02       ttccgacggcaacttcaactggggccgggttgtcgcccttttctactttgccagcaaact
L8IM55_BAX-01       ttccgacggcaacttcaactggggccgggttgtcgcccttttctactttgccagcaaact
                    *   **  **    ************* ** ** ** **  *   ***** *  *   **

L8IT09_BAK1-01      ggccct-----ccacgtctacca----gcgcggcctgaccgg---cttcctgggccaggt
L8IT09_BAK1-02      ggccct-----ccacgtctacca----gcgcggcctgaccgg---cttcctgggccaggt
L8IM55_BAX-02       ggtgctcaaggccctgtgcaccaaggtgcccgagttgatcaggaccatcatgggctggac
L8IM55_BAX-01       ggtgctcaaggccctgtgcaccaaggtgcccgagttgatcaggaccatcatgggctggac
                    **  **     **  **  ****    ** **   *** * *   * ** *****  *  

L8IT09_BAK1-01      ----gacccgcttcgtggccgacttcatgctgcgtcgctccatcgcccggtggatcgcgc
L8IT09_BAK1-02      ----gacccgcttcgtggccgacttcatgctgcgtcgctccatcgcccggtggatcgcgc
L8IM55_BAX-02       attggacttccttcgagagcggc----tgctgggc---------------tggatccagg
L8IM55_BAX-01       attggacttccttcgagagcggc----tgctgggc---------------tggatccagg
                        ***   ***** *  ** *    ***** *                ******  * 

L8IT09_BAK1-01      agaggggtggctgggtggcagccct------------------------------ggact
L8IT09_BAK1-02      agaggggtggctgggtggcagccct------------------------------ggact
L8IM55_BAX-02       accagggtggttg-----------------------------------------------
L8IM55_BAX-01       accagggtggttgggtgagacctctaaccccaccccattcccccactcctctggggccct
                    *   ****** **                                               

L8IT09_BAK1-01      tggg--------------------------------------------------------
L8IT09_BAK1-02      tggg--------------------------------------------------------
L8IM55_BAX-02       ------------------------------------------------------------
L8IM55_BAX-01       tgggcctttctgtgcccaccataggagtgcccccttccccattttggggtcatatgtctg
                                                                                

L8IT09_BAK1-01      ------------------------------------------------------------
L8IT09_BAK1-02      ------------------------------------------------------------
L8IM55_BAX-02       ------------------------------------------------------------
L8IM55_BAX-01       atcaacccctgattcacagggtgcccaatgacctgtccatgacccttgacctcctcatga
                                                                                

L8IT09_BAK1-01      ------------------------------------------------------------
L8IT09_BAK1-02      ------------------------------------------------------------
L8IM55_BAX-02       ------------------------------------------------------------
L8IM55_BAX-01       cctctgacctcctagtgacccctgacccgatgcctcgctgccctccctggtgcctccctc
                                                                                

L8IT09_BAK1-01      ------------------------------------------------------------
L8IT09_BAK1-02      ------------------------------------------------------------
L8IM55_BAX-02       ------------------------------------------------------------
L8IM55_BAX-01       caattcctctggaatccctcaagttctatgataatcctttaacttccccactcgtaggcc
                                                                                

L8IT09_BAK1-01      ------------------------------------------------------------
L8IT09_BAK1-02      ------------------------------------------------------------
L8IM55_BAX-02       ------------------------------------------------------------
L8IM55_BAX-01       cttgcccctacttgtgccctctgacccctccctgctccctcatgtgctggcccaggggct
                                                                                

L8IT09_BAK1-01      --------------------------------------------gaacggccccatc---
L8IT09_BAK1-02      --------------------------------------------gaacggccccatc---
L8IM55_BAX-02       --------------------------------------------ggacggcctcctctcc
L8IM55_BAX-01       gccccttggctgagtcgatgaagtgcctgctgtccctgtccccaggacggcctcctctcc
                                                                * ****** * **   

L8IT09_BAK1-01      ---------------------aagagcgtagccatcgttctggctgtggttttgttgggc
L8IT09_BAK1-02      ---------------------aagagcgtagccatcgttctggctgtggttttgttgggc
L8IM55_BAX-02       tactttgggacacccacatggcagacagtgaccatctttgtggctggagtgctcaccgcc
L8IM55_BAX-01       tactttgggacacccacatggcagacagtgaccatctttgtggctggagtgctcaccgcc
                                          ***  **  ***** ** ******  **  *    * *

L8IT09_BAK1-01      cagtttgtggt----acgaagattcttcaa------------------------------
L8IT09_BAK1-02      cagtttgtggt----acgaagattcttcaa------------------------------
L8IM55_BAX-02       tcgctcaccatctggaagaagatgggctga------------------------------
L8IM55_BAX-01       tcgctcaccatctggaagaagatgggctgaggccatcaactgccttggactttttctgca
                      * *     *    * ******      *                              

L8IT09_BAK1-01      ------------------------------------------------------------
L8IT09_BAK1-02      ------------------------------------------------------------
L8IM55_BAX-02       ------------------------------------------------------------
L8IM55_BAX-01       taaattatggcatttttcaggggggtggggcggatttgggggccatgggagtttttctta
                                                                                

L8IT09_BAK1-01      ------------------------------------------------------------
L8IT09_BAK1-02      ------------------------------------------------------------
L8IM55_BAX-02       ------------------------------------------------------------
L8IM55_BAX-01       cttttttaattattggggtggggcagggtagggaggcgtggtcttggggggtgggcacaa
                                                                                

L8IT09_BAK1-01      ------------------------------------------------------------
L8IT09_BAK1-02      ------------------------------------------------------------
L8IM55_BAX-02       ------------------------------------------------------------
L8IM55_BAX-01       taaacctctttcggaccacactttggagtctgagtcactgggcccgcttcctggctgtcg
                                                                                

L8IT09_BAK1-01      ------------------------------------------------------------
L8IT09_BAK1-02      ------------------------------------------------------------
L8IM55_BAX-02       ------------------------------------------------------------
L8IM55_BAX-01       caggagaccaggcttcatgcgctgacccatctttttctgagggtaaccagtgccctctgt
                                                                                

L8IT09_BAK1-01      ------------------------------------------------------------
L8IT09_BAK1-02      ------------------------------------------------------------
L8IM55_BAX-02       ------------------------------------------------------------
L8IM55_BAX-01       gggtcagtggcgagttaaattgtggctctgccctcaaggagcccacagtcctgaggggaa
                                                                                

L8IT09_BAK1-01      -------gtcatga
L8IT09_BAK1-02      -------gtcatga
L8IM55_BAX-02       --------------
L8IM55_BAX-01       ctgaggcggcttga
                                  

© 1998-2020Legal notice