Dataset for CDS BCL2L2 of organism Monodelphis domestica

[Download (right click)] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.8) multiple sequence alignment


A0A5F8HG85_BCL2L2-01      atggcgactccagcctcagccccagatactcgagccctggtggcagattt
A0A5F8HG85_BCL2L2-02      atggcgactccagcctcagccccagatactcgagccctggtggcagattt
A0A5F8HG85_BCL2L2-03      atggcggcggcggcggcggcggcagcagc---agcgggggctgcgggcgg
                          ****** *  * **  * **  ***   *   ***   **  ** *    

A0A5F8HG85_BCL2L2-01      tgtgggttacaagctgaggcagaagggctatgcctgtggaactggcccag
A0A5F8HG85_BCL2L2-02      tgtgggttacaagctgaggcagaagggctatgcctgtggaactggcccag
A0A5F8HG85_BCL2L2-03      tcgaggctccgggccggggcggcggcgccat-cttgtgcc-cggggccgg
                          *   ** * *  ** * *** *  * ** ** * ****   * ** ** *

A0A5F8HG85_BCL2L2-01      gagagggccctacaacagagcccttgcaccgggccatgcgtgctgctgga
A0A5F8HG85_BCL2L2-02      gagagggccctacaacagagcccttgcaccgggccatgcgtgctgctgga
A0A5F8HG85_BCL2L2-03      gggggagcccggggag-------------ggggccccgggcggcgcgggg
                          * * * ****    *               *****  * * *  ** ** 

A0A5F8HG85_BCL2L2-01      gacgagtttgagtcccgctttcgacgcacattttctgatctggccgctca
A0A5F8HG85_BCL2L2-02      gacgagtttgagtcccgctttcgacgcacattttctgatctggccgctca
A0A5F8HG85_BCL2L2-03      gactacgggaa------------------------cgggctggaggcgga
                          *** *     *                         *  ****  **  *

A0A5F8HG85_BCL2L2-01      gttgcatgtgactcctggctcggctca------gcagcgctttacccagg
A0A5F8HG85_BCL2L2-02      gttgcatgtgactcctggctcggctca------gcagcgctttacccagg
A0A5F8HG85_BCL2L2-03      ggagctggagcctgaggaattgctgctagagccagagcccgagcccgagc
                          *  **  * * **   *  * *   *         *** *    ** ** 

A0A5F8HG85_BCL2L2-01      tctcagatgagctcttccaaggggggcccaactggggccgt---cttgtg
A0A5F8HG85_BCL2L2-02      tctcagatgagctcttccaaggggggcccaactggggccgt---cttgtg
A0A5F8HG85_BCL2L2-03      ccgaggaggagccgcccc---------------ggccccgtgcccccccg
                           *   ** ****    **               **  ****   *    *

A0A5F8HG85_BCL2L2-01      gcattcttcgtctttggggcagcgctctgtgcagagagtgtcaacaaaga
A0A5F8HG85_BCL2L2-02      gcattcttcgtctttggggcagcgctctgtgcagagagtgtcaacaaaga
A0A5F8HG85_BCL2L2-03      ggagcctccggccctgggcccggcgc---aggagcccccggcagtcagga
                          * *  ** ** *  **** * *        * **     * **   * **

A0A5F8HG85_BCL2L2-01      gatggagccactggtgggacaggtgcaggactggatggtgacctacctag
A0A5F8HG85_BCL2L2-02      gatggagccactggtgggacaggtgcaggactggatggtgacctacctag
A0A5F8HG85_BCL2L2-03      ggaggaggaagagccgggcctggtcgagggcgacccgggg----------
                          *  ****  *  *  *** * ***  *** *     ** *          

A0A5F8HG85_BCL2L2-01      agacacagctggcagactggatccacagcagtgggggctgggagctggag
A0A5F8HG85_BCL2L2-02      agacacagctggcagactggatccacagcagtgggggctgggagctggag
A0A5F8HG85_BCL2L2-03      --------------------gacggcgctatcgaggacccggagctggag
                                                *  *   *  * ** *  **********

A0A5F8HG85_BCL2L2-01      gccatcaaagcccgagtaagggagatggaggaagaggcagagaaattgaa
A0A5F8HG85_BCL2L2-02      gccatcaaagcccgagtaagggagatggaggaagaggcagagaaattgaa
A0A5F8HG85_BCL2L2-03      gccatcaaagcccgagtaagggagatggaggaagaggcagagaaattgaa
                          **************************************************

A0A5F8HG85_BCL2L2-01      ggagcttcagaacgaggtggagaaacagatgaacatgagtccacccccag
A0A5F8HG85_BCL2L2-02      ggagcttcagaacgaggtggagaaacagatgaacatgagtccacccccag
A0A5F8HG85_BCL2L2-03      ggagcttcagaacgaggtggagaaacagatgaacatgagtccacccccag
                          **************************************************

A0A5F8HG85_BCL2L2-01      gcaatgctggcccagtgatcatgtccattgaggagaagatggaggctgat
A0A5F8HG85_BCL2L2-02      gcaatgctggcccagtgatcatgtccattgaggagaagatggaggctgat
A0A5F8HG85_BCL2L2-03      gcaatgctggcccagtgatcatgtccattgaggagaagatggaggctgat
                          **************************************************

A0A5F8HG85_BCL2L2-01      gcccgatccatctatgtaggcaatgtggactatggtgcaacagcagaaga
A0A5F8HG85_BCL2L2-02      gcccgatccatctatgtaggcaatgtggactatggtgcaacagcagaaga
A0A5F8HG85_BCL2L2-03      gcccgatccatctatgtaggcaatgtggactatggtgcaacagcagaaga
                          **************************************************

A0A5F8HG85_BCL2L2-01      gctggaggcacacttccatggttgtggttcagttaatcgagttaccatcc
A0A5F8HG85_BCL2L2-02      gctggaggcacacttccatggttgtggttcagttaatcgagttaccatcc
A0A5F8HG85_BCL2L2-03      gctggaggcacacttccatggttgtggttcagttaatcgagttaccatcc
                          **************************************************

A0A5F8HG85_BCL2L2-01      tttgtgacaagttcagtggccatcctaaggggtttgcatatatagaattt
A0A5F8HG85_BCL2L2-02      tttgtgacaagttcagtggccatcctaaggggtttgcatatatagaattt
A0A5F8HG85_BCL2L2-03      tttgtgacaagttcagtggccatcctaaggggtttgcatatatagaattt
                          **************************************************

A0A5F8HG85_BCL2L2-01      tcagataaagattcagtcaggacgtcgatggccttggatgattctctttt
A0A5F8HG85_BCL2L2-02      tcagataaagattcagtcaggacgtcgatggccttggatgattctctttt
A0A5F8HG85_BCL2L2-03      tcagataaagattcagtcaggacgtcgatggccttggatgattctctttt
                          **************************************************

A0A5F8HG85_BCL2L2-01      cagaggaagacagatcaaagtgataccaaaacggaccaataggccgggga
A0A5F8HG85_BCL2L2-02      cagaggaagacagatcaaagtgataccaaaacggaccaataggccgggga
A0A5F8HG85_BCL2L2-03      cagaggaagacagatcaaagtgataccaaaacggaccaataggccgggga
                          **************************************************

A0A5F8HG85_BCL2L2-01      tcagcaccacagatcggggttttccacgtgcccgatatcgtgccagggct
A0A5F8HG85_BCL2L2-02      tcagcaccacagatcggggttttccacgtgcccgatatcgtgccagggct
A0A5F8HG85_BCL2L2-03      tcagcaccacagatcggggttttccacgtgcccgatatcgtgccagggct
                          **************************************************

A0A5F8HG85_BCL2L2-01      actaactacagtagttcacgctctcgattctatagcggcttcaacagcag
A0A5F8HG85_BCL2L2-02      actaactacagtagttcacgctctcgattctatagcggcttcaacagcag
A0A5F8HG85_BCL2L2-03      actaactacagtagttcacgctctcgattctatagcggcttcaacagcag
                          **************************************************

A0A5F8HG85_BCL2L2-01      accccggggccgagtctacaggggccgggctagagcgacgtcatggtttc
A0A5F8HG85_BCL2L2-02      accccggggccgagtctacaggggccgggctagagcgacgtcatggtatt
A0A5F8HG85_BCL2L2-03      accccggggccgagtctacaggggccgggctagagcgacgtcatggtatt
                          *********************************************** * 

A0A5F8HG85_BCL2L2-01      ------tgtag
A0A5F8HG85_BCL2L2-02      ccccttactaa
A0A5F8HG85_BCL2L2-03      ccccttactaa
                                  ** 

© 1998-2023Centre National de la Recherche Scientifique logoInstitut national de la sante et de la recherche médicale logoUniversité de Lyon logoLegal notice