Dataset for CDS BCL2L2 of organism Monodelphis domestica

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A5F8HG85_BCL2L2-      atggcggcggcggcggcggcggcagcagc---agcgggggctgcgggcgg
A0A5F8HG85_BCL2L2-      atggcgactccagcctcagccccagatactcgagccctggtggcagattt
A0A5F8HG85_BCL2L2-      atggcgactccagcctcagccccagatactcgagccctggtggcagattt
                        ****** *  * **  * **  ***   *   ***   **  ** *    

A0A5F8HG85_BCL2L2-      tcgaggctccgggccggggcggcggcgccat-cttgt-gcccggggccgg
A0A5F8HG85_BCL2L2-      tgtgggttacaagctgaggcagaagggctatgcctgtggaactggcccag
A0A5F8HG85_BCL2L2-      tgtgggttacaagctgaggcagaagggctatgcctgtggaactggcccag
                        *   ** * *  ** * *** *  * ** ** * *** *  * ** ** *

A0A5F8HG85_BCL2L2-      gggggagcccggggagggggcc------ccgggcggcgcgggggactacg
A0A5F8HG85_BCL2L2-      gagagggccctacaacagagcccttgcaccgggccatgcgtgctgct--g
A0A5F8HG85_BCL2L2-      gagagggccctacaacagagcccttgcaccgggccatgcgtgctgct--g
                        * * * ****    *  * ***      ******   *** *   **  *

A0A5F8HG85_BCL2L2-      ggaacgggctggag--------gcggag----------gagctggagcct
A0A5F8HG85_BCL2L2-      gagacgagtttgagtcccgctttcgacgcacattttctgatctggccgct
A0A5F8HG85_BCL2L2-      gagacgagtttgagtcccgctttcgacgcacattttctgatctggccgct
                        *  *** * * ***         **  *          ** ****   **

A0A5F8HG85_BCL2L2-      gag--------gaattgctgctagagccaga--------gcccgagcccg
A0A5F8HG85_BCL2L2-      cagttgcatgtgactcctggctcggctcagcagcgctttacccaggtctc
A0A5F8HG85_BCL2L2-      cagttgcatgtgactcctggctcggctcagcagcgctttacccaggtctc
                         **        ** *    *** *   ***          ***  * *  

A0A5F8HG85_BCL2L2-      ag--------cccgaggaggagccgccccggccccgtgcccccccgggag
A0A5F8HG85_BCL2L2-      agatgagctcttccaaggggggcccaactggggccgt---cttgtggcat
A0A5F8HG85_BCL2L2-      agatgagctcttccaaggggggcccaactggggccgt---cttgtggcat
                        **          * * * ** ***   * **  ****   *    ** * 

A0A5F8HG85_BCL2L2-      cctccggccctgg------gcccggcgcaggagcccccggcagtcaggag
A0A5F8HG85_BCL2L2-      tcttcgtctttggggcagcgctctgtgcagagagtgtcaacaaagagatg
A0A5F8HG85_BCL2L2-      tcttcgtctttggggcagcgctctgtgcagagagtgtcaacaaagagatg
                         ** ** *  ***      ** * * ****       *  **   **  *

A0A5F8HG85_BCL2L2-      gag--------gaggaagagccgggcctggtcgagggcgacccgggggac
A0A5F8HG85_BCL2L2-      gagccactggtgggacaggtgcaggactggatggtgacctacctagagac
A0A5F8HG85_BCL2L2-      gagccactggtgggacaggtgcaggactggatggtgacctacctagagac
                        ***        * *  **   * ** ****  *  * *   **  * ***

A0A5F8HG85_BCL2L2-      ggcgctatc-------------------gaggacccggagctggaggcca
A0A5F8HG85_BCL2L2-      acagctggcagactggatccacagcagtgggggctgggagctggaggcca
A0A5F8HG85_BCL2L2-      acagctggcagactggatccacagcagtgggggctgggagctggaggcca
                           ***  *                   * ** *  **************

A0A5F8HG85_BCL2L2-      tcaaagcccgagtaagggagatggaggaagaggcagagaaattgaaggag
A0A5F8HG85_BCL2L2-      tcaaagcccgagtaagggagatggaggaagaggcagagaaattgaaggag
A0A5F8HG85_BCL2L2-      tcaaagcccgagtaagggagatggaggaagaggcagagaaattgaaggag
                        **************************************************

A0A5F8HG85_BCL2L2-      cttcagaacgaggtggagaaacagatgaacatgagtccacccccaggcaa
A0A5F8HG85_BCL2L2-      cttcagaacgaggtggagaaacagatgaacatgagtccacccccaggcaa
A0A5F8HG85_BCL2L2-      cttcagaacgaggtggagaaacagatgaacatgagtccacccccaggcaa
                        **************************************************

A0A5F8HG85_BCL2L2-      tgctggcccagtgatcatgtccattgaggagaagatggaggctgatgccc
A0A5F8HG85_BCL2L2-      tgctggcccagtgatcatgtccattgaggagaagatggaggctgatgccc
A0A5F8HG85_BCL2L2-      tgctggcccagtgatcatgtccattgaggagaagatggaggctgatgccc
                        **************************************************

A0A5F8HG85_BCL2L2-      gatccatctatgtaggcaatgtggactatggtgcaacagcagaagagctg
A0A5F8HG85_BCL2L2-      gatccatctatgtaggcaatgtggactatggtgcaacagcagaagagctg
A0A5F8HG85_BCL2L2-      gatccatctatgtaggcaatgtggactatggtgcaacagcagaagagctg
                        **************************************************

A0A5F8HG85_BCL2L2-      gaggcacacttccatggttgtggttcagttaatcgagttaccatcctttg
A0A5F8HG85_BCL2L2-      gaggcacacttccatggttgtggttcagttaatcgagttaccatcctttg
A0A5F8HG85_BCL2L2-      gaggcacacttccatggttgtggttcagttaatcgagttaccatcctttg
                        **************************************************

A0A5F8HG85_BCL2L2-      tgacaagttcagtggccatcctaaggggtttgcatatatagaattttcag
A0A5F8HG85_BCL2L2-      tgacaagttcagtggccatcctaaggggtttgcatatatagaattttcag
A0A5F8HG85_BCL2L2-      tgacaagttcagtggccatcctaaggggtttgcatatatagaattttcag
                        **************************************************

A0A5F8HG85_BCL2L2-      ataaagattcagtcaggacgtcgatggccttggatgattctcttttcaga
A0A5F8HG85_BCL2L2-      ataaagattcagtcaggacgtcgatggccttggatgattctcttttcaga
A0A5F8HG85_BCL2L2-      ataaagattcagtcaggacgtcgatggccttggatgattctcttttcaga
                        **************************************************

A0A5F8HG85_BCL2L2-      ggaagacagatcaaagtgataccaaaacggaccaataggccggggatcag
A0A5F8HG85_BCL2L2-      ggaagacagatcaaagtgataccaaaacggaccaataggccggggatcag
A0A5F8HG85_BCL2L2-      ggaagacagatcaaagtgataccaaaacggaccaataggccggggatcag
                        **************************************************

A0A5F8HG85_BCL2L2-      caccacagatcggggttttccacgtgcccgatatcgtgccagggctacta
A0A5F8HG85_BCL2L2-      caccacagatcggggttttccacgtgcccgatatcgtgccagggctacta
A0A5F8HG85_BCL2L2-      caccacagatcggggttttccacgtgcccgatatcgtgccagggctacta
                        **************************************************

A0A5F8HG85_BCL2L2-      actacagtagttcacgctctcgattctatagcggcttcaacagcagaccc
A0A5F8HG85_BCL2L2-      actacagtagttcacgctctcgattctatagcggcttcaacagcagaccc
A0A5F8HG85_BCL2L2-      actacagtagttcacgctctcgattctatagcggcttcaacagcagaccc
                        **************************************************

A0A5F8HG85_BCL2L2-      cggggccgagtctacaggggccgggctagagcgacgtcatggtattcccc
A0A5F8HG85_BCL2L2-      cggggccgagtctacaggggccgggctagagcgacgtcatggt------t
A0A5F8HG85_BCL2L2-      cggggccgagtctacaggggccgggctagagcgacgtcatggtattcccc
                        *******************************************       

A0A5F8HG85_BCL2L2-      ttactaa
A0A5F8HG85_BCL2L2-      tctgtag
A0A5F8HG85_BCL2L2-      ttactaa
                        *   ** 

© 1998-2020Legal notice