Dataset for CDS BCL-2-like of organism Nothobranchius furzeri

[Download (right click)] [Alignment] [Repertoires]

7 sequence(s)

>gnl|bcl2dbcds|A0A1A7ZDF6_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Nothobranchius furzeri GN=BCL2L1 (length=702 residues).
atgtctcaaaaccaagaactagttcttttctatattagatataaactgtcacagaggaactatcccctcaaccacatagt
cctcaatgaccccctaaacaggactggtgcgggggatgcggtggtggggggtgaggaggagaggacagagacacacgcca
atgggacctttaacaggacgagtcccgggaccccagcggcgtccccgctacggcagcagccgccggcgtccacgacggac
atggaccgggtgaaagaggccctccgagacacggccaacgagttcgagctgcgatacgcccgcgccttcaacgacctgca
cagccagctgcacatcacgcccgccacggcctaccaaagcttcgagaacgtgatggacgaggtgttccgggacggcgtca
actgggggcgcatcgtgggactcttcgcgttcggcggcgcgctgtgtgtagagtgcgtggagaaggagatgagtcccctg
gtggtcaggatcgtggagtggatgaccgtctacctggacaaccacattcagccctggatccagagtcagggaggatggga
gcgcttcgccgacatctttgggcacgacgcggcggctgaaagcaggaggttccaggagagctttaggatgtggctgctgg
tgggaatgaccgtgctcacggcggtcgtggcaggctcgctgttcgcgcagaaacgcctgtga
>gnl|bcl2dbcds|A0A1A8A2S0_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Nothobranchius furzeri GN=BCL2L1 (length=660 residues).
atgccacacagtaacagagagctggtggagtactacatcagctacaagttgtcccaaaggaactgtcccatgtctctgct
ggggccagaggatgggggtaagaagactcgggaggactgggacaattcagctgctagcaatggccggctggtcagcagca
gggacagcccaccagggaagacttgtgccccccgtggtggcatggaggcagtgaaatcagctctaaaggactcagcagat
gagtttgaacttttatacgcacagagttttagtcacctttccctgcagctcgatatcacgccagacacggcctaccacag
cttcaagagcgtgctggacgagctgttcagagatggggtaaactggggacgggtggtgggcctctttgtctttggggggt
tgctgtgtgtgcagtgtaaggagaggaatttaagcgagctggttccccgcattgcagactggatgaccacctacctggat
gatcagatcgggctgtggatcagcagccaaggaggatgggactgttttgcagagatttatgggcgaggagctgcggcaga
ggcaaggaggttccaggagaccctgaagaagtggctgttagcaggagtgctgctgctgtcaggggtgctgctcggtgtgc
tcattgcaaagaaacggtga
>gnl|bcl2dbcds|A0A1A8A7I9_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Nothobranchius furzeri GN=MCL-1 (length=822 residues).
atgcttcaacggaaaacccccagctctgtctttggctgtcttttctctcaaaatggagtcgtggatggaccattacacta
cggaccgggagattcccctcctcacatcgcaactggcgccacgttagactctgctaatgggaacgtagagtccggtgacg
gccccaaacgcccgagcaacctggaagtgtctccgcacaatggatttgctgctaaacgcttcagccacgaggaggaggac
ggctctctgccgtgcaccccggagtttcacgcaggcagcgagaccgaggtccccagcggtcatgccggagatgaggcgct
ggcgaacgacaccagacaactaatcaaccgcttttttatggagtttactggacagttaaagcctcagtggcgcgatagca
gagagctatcgacaatgaaaagagtggtgaacgacattttggaaaaacacagatacgcttacaaaggtatggctgcgaaa
tgcacttccgatgacctgacgttcatcagcaaagtggcagaaaacatgttttcagacgggatcaccaactggggtcggat
cgtgagcctgctggccttcggggcggtggtggcccagtaccagaaggacaacgggaggcaaaacaacgtagagctagtca
gccatgaggtttcaacctacctgttgtctcaacagagagactttctgctcagaaacaactcatggcaaggctttgtggag
ttctttcgtgtaacagacccagagtcaacagtcaggaacacactgatggccatagctggggtagcaggcatgggggcgac
tctagccctgctgatcaggtga
>gnl|bcl2dbcds|A0A1A8A7I9_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Nothobranchius furzeri GN=MCL-1 (length=873 residues).
atgcttcaacggaaaacccccagctctgtctttggctgtcttttctctcaaaatggagtcgtggatggaccattacacta
cggaccgggagattcccctcctcacatcgcaactggcgccacgttagactctgctaatgggaacgtagagtccggtgacg
gccccaaacgcccgagcaacctggaagtgtctccgcacaatggatttgctgctaaacgcttcagccacgaggaggaggac
ggctctctgccgtgcaccccggagtttcacgcaggcagcgagaccgaggtccccagcggtcatgccggagatgaggcgct
ggcgaacgacaccagacaactaatcaaccgcttttttatggagtttactggacagttaaagcctcagtggcgcgatagca
gagagctatcgacaatgaaaagagtggtgaacgacattttggaaaaacacagatacgcttacaaaggtatggctgcgaaa
tgcacttccgatgacctgacgttcatcagcaaagtggcagaaaacatgttttcagacgggatcaccaactggggtcggat
cgtgagcctgctggccttcggggcggtggtggcccagtaccagaaggacaacgggaggcaaaacaacgtagagctagtca
gccatgaggtttcaacctacctgttgtctcaacagagagactttctgctcagaaacaactcatggcaaggctttgtggag
ttctttcgtgtaacagacccagagtcaacagtcaggaacacactgatggccatagctggggtagcaggcatgggggcgac
tctagccctgctgatcagttgttgcaggcatgacaccagttttcagacagttccctcaataccttcatattga
>gnl|bcl2dbcds|A0A1A8A7I9_MCL1-03 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Nothobranchius furzeri GN=MCL-1 (length=822 residues).
atgcttcaacggaaaacccccagctctgtctttggctgtcttttctctcaaaatggagtcgtggatggaccattacacta
cggaccgggagattcccctcctcacatcgcaactggcgccacgttagactctgctaatgggaacgtagagtccggtgacg
gccccaaacgcccgagcaacctggaagtgtctccgcacaatggatttgctgctaaacgcttcagccacgaggaggaggac
ggctctctgccgtgcaccccggagtttcacgcaggcagcgagaccgaggtccccagcggtcatgccggagatgaggcgct
ggcgaacgacaccagacaactaatcaaccgcttttttatggagtttactggacagttaaagcctcagtggcgcgatagca
gagagctatcgacaatgaaaagagtggtgaacgacattttggaaaaacacagatacgcttacaaaggtatggctgcgaaa
tgcacttccgatgacctgacgttcatcagcaaagtggcagaaaacatgttttcagacgggatcaccaactggggtcggat
cgtgagcctgctggccttcggggcggtggtggcccagtaccagaaggacaacgggaggcaaaacaacgtagagctagtca
gccatgaggtttcaacctacctgttgtctcaacagagagactttctgctcagaaacaactcatggcaaggctttgtggag
ttctttcgtgtaacagacccagagtcaacagtcaggaacacactgatggccatagctggggtagcaggcatgggggcgac
tctagccctgctgatcaggtga
>gnl|bcl2dbcds|A0A1A8VCB0_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Nothobranchius furzeri GN=BCL2L10 (length=768 residues).
atgggcggagggctaaatgcgcagaagggaagcggtgattgccccgaggttctccttccgccgtctggatgtggcgagag
ctgtcacctaccgctgggaggagaacatgggaccagtgatcgggccagcatgtctacgtccggaccatgggtccctacca
ggggcgtggctagcctctcttacagcaaaatgtcctgtgggctgtggaatgatactctggctgtggccgaggattacctg
tccacgtgctgctgcggcccaaatccagcccctccacctcccagcgagacagccgctgccatgaggcgtctggcccagga
tatggagacccagcaccagacccgtttccactctctggctcagaacttcctgaagcgctgcgggccagacatctgctcta
gcctcaggaaggtgatggacgagatggctggagacggacactttaactgggggcgggttgtgtccctctttgcttttact
ggggtgctgatcagacagctgcaggagcagaggacctccagaccggggctggaccctgggcaagagctggaaccgaagct
catcagctgtcggttgctggcggagaccatagctgattacctggtgaagcacaagaaaggctggctgttggagaatgaag
gatgggaaggcttcagccagtactcccacaacaccagaccagtaagtctggactcctccatgaagacagcgctggttgct
gttgctggagttggcctggctgggctaacctttctcctggtgcgctag
>gnl|bcl2dbcds|A0A1A8VCB0_BCL2L10-02 BCL2-like 10 gene OS=[Eukaryota] Nothobranchius furzeri GN=BCL2L10 (length=615 residues).
atgtggcgagagctgtcacctaccgctgggaggaaaatgtcctgtgggctgtggaatgatactctggctgtggccgagga
ttacctgtccacgtgctgctgcggcccaaatccagcccctccacctcccagcgagacagccgctgccatgaggcgtctgg
cccaggatatggagacccagcaccagacccgtttccactctctggctcagaacttcctgaagcgctgcgggccagacatc
tgctctagcctcaggaaggtgatggacgagatggctggagacggacactttaactgggggcgggttgtgtccctctttgc
ttttactggggtgctgatcagacagctgcaggagcagaggacctccagaccggggctggaccctgggcaagagctggaac
cgaagctcatcagctgtcggttgctggcggagaccatagctgattacctggtgaagcacaagaaaggctggctgttggag
aatgaaggatgggaaggcttcagccagtactcccacaacaccagaccagtaagtctggactcctccatgaagacagcgct
ggttgctgttgctggagttggcctggctgggctaacctttctcctggtgcgctag
© 1998-2021Legal notice