Dataset for CDS BAX of Organism Electrophorus electricus

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A4W4GLW7_BAX-01      atggcagacgctcatgaaaacgatagaacggacgacggtgaatcgttagg
A0A4W4E583_BAX-01      atggcggcgcc---------------atcgggcgaaggcga---------
A0A4W4E583_BAX-02      cgtttaactac---------------accagac-----------------
                                 *               * * * *                 

A0A4W4GLW7_BAX-01      agccacgggcggcgaagatgttacggatgataggattatagaggaaggcg
A0A4W4E583_BAX-01      ---tgtgggcaac---------accaatgaccaaatactacaagtaggaa
A0A4W4E583_BAX-02      -------ggcaac---------accaatgaccaaatactacaagtaggaa
                              ***  *         **  ****    **  ** * * ***  

A0A4W4GLW7_BAX-01      caatagtactgagagggtatgttatcgagcggtt------taatgcggag
A0A4W4E583_BAX-01      cagcactactaaaagactttatctatgagcggattcatcgtcatggggac
A0A4W4E583_BAX-02      cagcactactaaaagactttatctatgagcggattcatcgtcatggggac
                       **  * **** * **  * * *    ****** *      * *** *** 

A0A4W4GLW7_BAX-01      aacccagccatg-------caggtgagtccggtggccctcgggggaacag
A0A4W4E583_BAX-01      agcagcgccatggttaccagaagtcagctgggtgggact-----------
A0A4W4E583_BAX-02      agcagcgccatggttaccagaagtcagctgggtgggact-----------
                       * *   ******        * ** **   *****  **           

A0A4W4GLW7_BAX-01      ccgacgagggatccgatccccatgtgaaggaggtcgtcgatcagctcctt
A0A4W4E583_BAX-01      -----gagttatgcgaccccagccataagagacttgcacagtgtctgcag
A0A4W4E583_BAX-02      -----gagttatgcgaccccagccataagagacttgcacagtgtctgcag
                            ***  ** *** ***      ***    * *   *    ** *  

A0A4W4GLW7_BAX-01      aggatcgctgatgatctgaaccgcaacgctgagcttcaacacctgatcaa
A0A4W4E583_BAX-01      cagattggtgatgagctggacaacaacgtgcagctgcagagtatgataaa
A0A4W4E583_BAX-02      cagattggtgatgagctggacaacaacgtgcagctgcagagtatgataaa
                         *** * ****** *** **  *****   **** **     **** **

A0A4W4GLW7_BAX-01      caccgtggaggccaactgtgctcaggatgtgttcatgacggtggccagga
A0A4W4E583_BAX-01      cgactctgcgctacagcccacgaaagacgtgttcatgaaagtcgcctttg
A0A4W4E583_BAX-02      cgactctgcgctacagcccacgaaagacgtgttcatgaaagtcgcctttg
                       *  *   * *    *     *  * ** **********  ** ***    

A0A4W4GLW7_BAX-01      atatcttcacagatggca---ttaactggggacgtgtggtggctctcttt
A0A4W4E583_BAX-01      aaatcttctcggatgggaagtttaactggggtagagtggtggcacttttc
A0A4W4E583_BAX-02      aaatcttctcggatgggaagtttaactggggtagagtggtggcacttttc
                       * ****** * ***** *   **********  * ******** ** ** 

A0A4W4GLW7_BAX-01      cacctggcatatcgactcatctacaaggcactgactcagcaacact-ttg
A0A4W4E583_BAX-01      tacttcgcttgtcggcttgtcatcaaggctcttg-taaccaaagttcctg
A0A4W4E583_BAX-02      tacttcgcttgtcggcttgtcatcaaggctcttg-taaccaaagttcctg
                        ** * ** * *** **  **  ****** **   * * ***   *  **

A0A4W4GLW7_BAX-01      aagtcatcaggaccatcattagctgggtattacagtttatcagggagaac
A0A4W4E583_BAX-01      acattatccgaaccatcatcacctgg--actactgactacttgcgtgata
A0A4W4E583_BAX-02      acattatccgaaccatcatcacctgg--actactgactacttgcgtgata
                       *  * *** * ******** * ****  * *** *  **   * * **  

A0A4W4GLW7_BAX-01      atttcctca--tggatcagacagcagggaggatgggagggcgtcatccg-
A0A4W4E583_BAX-01      atgtgattaattggatcagggaacagggaggctgggaagg---aatccgc
A0A4W4E583_BAX-02      atgtgattaattggatcagggaacagggaggctgggaagg---aatccgc
                       ** *  * *  ********  * ******** ***** **    ***** 

A0A4W4GLW7_BAX-01      --------cagcgtgtccaggtggcgcactgtggccctcgttgctgcggt
A0A4W4E583_BAX-01      tcctacttcggtacgcctacctggcagactgttggcgtttttctggctgg
A0A4W4E583_BAX-02      tcctacttcggtacgcctacctggcagactgttggcgtttttctggctgg
                               * *   * * *  ****  ***** * * *  **   ** * 

A0A4W4GLW7_BAX-01      ggccttcgtcgcggccgtcgtgtactggagaaggacccgc------tga
A0A4W4E583_BAX-01      agttctcaccac--------tgtactgg----tcattcgcaagatgtga
A0A4W4E583_BAX-02      agttctcaccac--------tgtactgg----tcattcgcaagatgtga
                        *   **  * *        ********      *  ***      ***

© 1998-2023Legal notice