Dataset for CDS BAX of Organism Electrophorus electricus

[Download (right click)] [Alignment] [Repertoires]

3 sequence(s)

>gnl|bcl2dbcds|A0A4W4E583_BAX-01 BCL2-associated X gene OS=[Eukaryota] Electrophorus electricus GN=BAX (length=579 residues).
atggcggcgccatcgggcgaaggcgatgtgggcaacaccaatgaccaaatactacaagtaggaacagcactactaaaaga
ctttatctatgagcggattcatcgtcatggggacagcagcgccatggttaccagaagtcagctgggtgggactgagttat
gcgaccccagccataagagacttgcacagtgtctgcagcagattggtgatgagctggacaacaacgtgcagctgcagagt
atgataaacgactctgcgctacagcccacgaaagacgtgttcatgaaagtcgcctttgaaatcttctcggatgggaagtt
taactggggtagagtggtggcacttttctacttcgcttgtcggcttgtcatcaaggctcttgtaaccaaagttcctgaca
ttatccgaaccatcatcacctggactactgactacttgcgtgataatgtgattaattggatcagggaacagggaggctgg
gaaggaatccgctcctacttcggtacgcctacctggcagactgttggcgtttttctggctggagttctcaccactgtact
ggtcattcgcaagatgtga
>gnl|bcl2dbcds|A0A4W4E583_BAX-02 BCL2-associated X gene OS=[Eukaryota] Electrophorus electricus GN=BAX (length=567 residues).
cgtttaactacaccagacggcaacaccaatgaccaaatactacaagtaggaacagcactactaaaagactttatctatga
gcggattcatcgtcatggggacagcagcgccatggttaccagaagtcagctgggtgggactgagttatgcgaccccagcc
ataagagacttgcacagtgtctgcagcagattggtgatgagctggacaacaacgtgcagctgcagagtatgataaacgac
tctgcgctacagcccacgaaagacgtgttcatgaaagtcgcctttgaaatcttctcggatgggaagtttaactggggtag
agtggtggcacttttctacttcgcttgtcggcttgtcatcaaggctcttgtaaccaaagttcctgacattatccgaacca
tcatcacctggactactgactacttgcgtgataatgtgattaattggatcagggaacagggaggctgggaaggaatccgc
tcctacttcggtacgcctacctggcagactgttggcgtttttctggctggagttctcaccactgtactggtcattcgcaa
gatgtga
>gnl|bcl2dbcds|A0A4W4GLW7_BAX-01 BCL2-associated X gene OS=[Eukaryota] Electrophorus electricus GN=BAX (length=615 residues).
atggcagacgctcatgaaaacgatagaacggacgacggtgaatcgttaggagccacgggcggcgaagatgttacggatga
taggattatagaggaaggcgcaatagtactgagagggtatgttatcgagcggtttaatgcggagaacccagccatgcagg
tgagtccggtggccctcgggggaacagccgacgagggatccgatccccatgtgaaggaggtcgtcgatcagctccttagg
atcgctgatgatctgaaccgcaacgctgagcttcaacacctgatcaacaccgtggaggccaactgtgctcaggatgtgtt
catgacggtggccaggaatatcttcacagatggcattaactggggacgtgtggtggctctctttcacctggcatatcgac
tcatctacaaggcactgactcagcaacactttgaagtcatcaggaccatcattagctgggtattacagtttatcagggag
aacatttcctcatggatcagacagcagggaggatgggagggcgtcatccgcagcgtgtccaggtggcgcactgtggccct
cgttgctgcggtggccttcgtcgcggccgtcgtgtactggagaaggacccgctga
© 1998-2023Legal notice