Dataset for CDS BCL-2-like of organism Junco hyemalis

[Download (right click)] [Alignment] [Repertoires]

7 sequence(s)

>gnl|bcl2dbcds|A0A8C5IH35_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Junco hyemalis GN=BCL-2 (length=1014 residues).
atgctgctcctggccgccgccttcatcgtggccttcgtcctcctcctctacatggtgtcgccgcttatcagccccaagtc
gctgaagctgcccggcgcgcacgtcgtggtaactggaggctccagtggaattggaaaatgcattgctattgaatgctata
agcaaggtgctttcataacactgattgcaagggatgagaacaagctgttgcagacgaagaaggaaatagaaaagtactct
gttaatgacaagcaggttgtactctgtatttctgttgatgtgtctaaagactatgaacaagtggaaaatgttctaaaaca
ggctcaggagaagttggggccagttgatatgctcgtgaactgtgcaggaacatcagttacaggcaaatttgaggatattg
aagtgaattcttttgaaagattaatggcagtgaattacctgggcagtgtttacccaagccgagcagtaatcgctaccatg
aaggagcgcagaatgggaaggattgtcttcgtgtcgtctcaggctggccagctgggcctgtttggatatacagcttattc
tcccaccaagtttgctcttcgagggttggctgaagccctgcaaatggaggtaaaaccttacaatgtctacgtaacggtgg
cctatcctccagatactgatactcctggctttgcagaagaaagtaaaacaaagcccttagagacgaagctgatttctgaa
acctcatctgtttgccaagcagagcaagttgccagagttatagtgaaagatgccatacaagggaacttcaacagctcagt
tggatcagatggttacatgctgtcaatattgacaagtgggatgtcaccagtcacttctattactgaaggtcttcagcagg
atgcctttgtggagttgtatggcaatggaatgaggcctttgttcgatttctcctggatctctctgaagactatcctgagt
ctggttctggtgggagcttgcatcactcttggcgcttatctcggacataaatag
>gnl|bcl2dbcds|A0A8C5IH35_BCL2-02 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Junco hyemalis GN=BCL-2 (length=999 residues).
atgctgctcctggccgccgccttcatcgtggccttcgtcctcctcctctacatggtgtcgccgcttatcagccccaagtc
gctgaagctgcccggcgcgcacgtcgtggtaactggaggctccagtggaattggaaaatgcattgctattgaatgctata
agcaaggtgctttcataacactgattgcaagggatgagaacaagctgttgcagacgaagaaggaaatagaaaagtactct
gttaatgacaagcaggttgtactctgtatttctgttgatgtgtctaaagactatgaacaagtggaaaatgttctaaaaca
ggctcaggagaagttggggccagttgatatgctcgtgaactgtgcaggaacatcagttacaggcaaatttgaggatattg
aagtgaattcttttgaaagattaatggcagtgaattacctgggcagtgtttacccaagccgagcagtaatcgctaccatg
aaggagcgcagaatgggaaggattgtcttcgtgtcgtctcaggctggccagctgggcctgtttggatatacagcttattc
tcccaccaagtttgctcttcgagggttggctgaagccctgcaaatggaggtaaaaccttacaatgtctacgtaacggtgg
cctatcctccagatactgatactcctggctttgcagaagaaagtaaaacaaagcccttagagacgaagctgatttctgaa
acctcatctgtttgccaagcagagcaagttgccagagttatagtgaaagatgccatacaagggaacttcaacagctcagt
tggatcagatggttacatgctgtcaatattgacaagtgggatgtcaccagtcacttctattactgaaggtcttcagcagg
ttgtttgcatgggcatttttcgcatcattggcctattttacctaggaagttttgacagcatagttcgtcgctgcatgatg
caaagggaaaaatctgaaagtgcagataaaactgagtaa
>gnl|bcl2dbcds|A0A8C5IH35_BCL2-03 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Junco hyemalis GN=BCL-2 (length=720 residues).
atggctcatccggggagaagaggctacgataaccgggagatagtgctgaagtacatccactataaactctctcagagggg
atacgactggcctgccagcgaggacagggcatccctgtctccaggtctctctgctcctgctgctgctgctgcggttgctg
ctgctgggacttcctctgatcacactgggccggtgtctccgcaccccgagccccccggctcggctgctgctagccacgcg
cccccggccgaggggctgcgccccgcaccccaggtcgtgcacctcgtcctgcgccaggcgggggacgagttctcccgacg
ctaccagagggacttcgcccagatgtccggccagctgcacctgacgcccctcacggccaggagccgcttcgtggcggtgg
tggaggagctcttccgcgatggggttaactggggcaggattgtggccttcttcgagttcggcggtgtgatgtgcgtggag
agcgtcaaccgggagatgtctcacctcgtggacagcatcgccgcctggatgaccgagtacctgaaccggcagctgcacaa
ctggatccaggacaacggaggctgggatgcctttgtggagttgtatggcaatggaatgaggcctttgttcgatttctcct
ggatctctctgaagactatcctgagtctggttctggtgggagcttgcatcactcttggcgcttatctcggacataaatag
>gnl|bcl2dbcds|A0A8C5IH35_BCL2-04 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Junco hyemalis GN=BCL-2 (length=738 residues).
atggctcatccggggagaagaggctacgataaccgggagatagtgctgaagtacatccactataaactctctcagagggg
atacgactggcctgccagcgaggacagggcatccctgtctccaggtctctctgctcctgctgctgctgctgcggttgctg
ctgctgggacttcctctgatcacactgggccggtgtctccgcaccccgagccccccggctcggctgctgctagccacgcg
cccccggccgaggggctgcgccccgcaccccaggtcgtgcacctcgtcctgcgccaggcgggggacgagttctcccgacg
ctaccagagggacttcgcccagatgtccggccagctgcacctgacgcccctcacggccaggagccgcttcgtggcggtgg
tggaggagctcttccgcgatggggttaactggggcaggattgtggccttcttcgagttcggcggtgtgatgtgcgtggag
agcgtcaaccgggagatgtctcacctcgtggacagcatcgccgcctggatgaccgagtacctgaaccggcagctgcacaa
ctggatccaggacaacggaggctggagctacagaaggactggcttggcagtggcctgtcgcacttggcaactttttttga
cgttgacgtggggaacactgaagggatgcagttggtgtgggagaaacaactgtgtttgtcttgcagtgatgggttccctc
tttgggcacacaacctaa
>gnl|bcl2dbcds|A0A8C5IH35_BCL2-05 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Junco hyemalis GN=BCL-2 (length=726 residues).
atggctcatccggggagaagaggctacgataaccgggagatagtgctgaagtacatccactataaactctctcagagggg
atacgactggcctgccagcgaggacagggcatccctgtctccaggtctctctgctcctgctgctgctgctgcggttgctg
ctgctgggacttcctctgatcacactgggccggtgtctccgcaccccgagccccccggctcggctgctgctagccacgcg
cccccggccgaggggctgcgccccgcaccccaggtcgtgcacctcgtcctgcgccaggcgggggacgagttctcccgacg
ctaccagagggacttcgcccagatgtccggccagctgcacctgacgcccctcacggccaggagccgcttcgtggcggtgg
tggaggagctcttccgcgatggggttaactggggcaggattgtggccttcttcgagttcggcggtgtgatgtgcgtggag
agcgtcaaccgggagatgtctcacctcgtggacagcatcgccgcctggatgaccgagtacctgaaccggcagctgcacaa
ctggatccaggacaacggaggctggatttcaggatctgtcagtgtgaaaggatgctttaattcctgtgcccggtcttcaa
cttgcttcttgcaccataccccatatatgaaccttattaataaatggctcttccagagtggctttgtatgtggtcatgct
tggtag
>gnl|bcl2dbcds|A0A8C5J3C4_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Junco hyemalis GN=BCL2A1 (length=525 residues).
atggaaactgctgagttctactacgtttattacctggctcaggactatctacagtatgtgctccaggaatcacacctggg
accagcccagaccagggttgctcgtgtcctgagaaccatggcatcctctctgcaagaacaaaccgaggaggctctcaggc
cgctcctggacaggattgacatcacctctgtagctgttgccaagagaattttcaatggagtcatggatgaaaagtttgct
gatggaaatactaactggggacgaattatgaccatatttacatttggaggtgtcctcaccaagaagcttcaagagcatgg
ggttcagctgactgcagaggagaaggagcagatctcttatttcatcacagagtacatcataaacaacaaagccgattgga
ttgatgcgaatggtggctgggaaaatggcttcctaacgaagtttgaaagaagatcactactgtccttctccaaaatcaca
gccctgctcatagctgttgtttccttgttcagagagtactactga
>gnl|bcl2dbcds|A0A8C5JFI3_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Junco hyemalis GN=BCL2L1 (length=1011 residues).
atgtacagcagtaaccgggagttagtgattgactttgtttcctacaagctctcacagaaaggatacagctggagtcagct
ggaggaggaggatgagaacaggactgactttgcaggggaggaggacgagatggacggggtcctcaacgggagcccctcct
ggcacgcagccaccagccacatagtgaacggagccaccgtgcaccagagcagcctcgaagtgcacgagatccgtcgagca
gccgacgtgaggcaggcgctgagagaggcaggggatgagttcgagctgaggtaccggcgggcgttcagcgacctcacctc
ccagctccacatcacccccagcacggcgtatcagagctttgagcaggtagtgaacgaactgttccgcgatggagtgaact
ggggccgcatcgtggctttcttctccttcggaggagccctgtgcgtggagagcgttgttaaggagatgagggtattggtg
aaacgcatcgtgtcttggatgaccacgtacttgaccgaccacttagacccctggatccaggagaatggcggatgggagcg
ctttgtggacctctatgggaacgatgctgctgccgagatgaggaaaggccaggagaccttcaacaaatggctcctgacgg
gggcgacagtggctgaggccaatgcagcacttcagccaccagctcccagcgctggggagatccaggcagctggcgggggg
cgcaggctagaaggtgtcccagccctgcagggttctccaaataatttggaagagaataaacagacttatttttgcatgtg
tgagtgcgtgcgtgtgtgtagatgtgtcactaatataaaagttccccagccagagcaagggtcaggctccgtgcccccgt
ctctggcacacacaggcaccagggagaggcaggagcttccctgcagcatccctatcctgtccttgcttctccagtcagag
ctcatccctgaggcagggggaggaagaggaggaggcagaggccagaggtga
© 1998-2022Legal notice