Dataset for CDS BCL-2-like of organism Junco hyemalis

[Download (right click)] [Edit] [Sequences] [Repertoires]

7 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C5JFI3_BCL2L1-      atg------------------------tacagcagtaaccgggagttagt
A0A8C5IH35_BCL2-05      atg------gctcatccggggagaagaggctacgataaccgggagatagt
A0A8C5IH35_BCL2-03      atg------gctcatccggggagaagaggctacgataaccgggagatagt
A0A8C5IH35_BCL2-04      atg------gctcatccggggagaagaggctacgataaccgggagatagt
A0A8C5J3C4_BCL2A1-      atggaaactgctgag------------ttctactacgtttattacctggc
A0A8C5IH35_BCL2-01      atg----ctgctcct------------ggccgccgccttcat--cgtggc
A0A8C5IH35_BCL2-02      atg----ctgctcct------------ggccgccgccttcat--cgtggc
                        ***                          *  *             * * 

A0A8C5JFI3_BCL2L1-      gattgactttgtttcctacaagctct-------------cacagaaagga
A0A8C5IH35_BCL2-05      gctgaagtacatccactataaactct-------------ctcagagggga
A0A8C5IH35_BCL2-03      gctgaagtacatccactataaactct-------------ctcagagggga
A0A8C5IH35_BCL2-04      gctgaagtacatccactataaactct-------------ctcagagggga
A0A8C5J3C4_BCL2A1-      tcaggac-----tatctacagtatgt------------------------
A0A8C5IH35_BCL2-01      cttcgtcctcctcctctacatggtgtcgccgcttatcagccccaagtcgc
A0A8C5IH35_BCL2-02      cttcgtcctcctcctctacatggtgtcgccgcttatcagccccaagtcgc
                                       *** *   * *                        

A0A8C5JFI3_BCL2L1-      tacagct-------------------------------------ggagtc
A0A8C5IH35_BCL2-05      tacgactggcctgccagcgaggacagggcatccctgtctcca--ggtctc
A0A8C5IH35_BCL2-03      tacgactggcctgccagcgaggacagggcatccctgtctcca--ggtctc
A0A8C5IH35_BCL2-04      tacgactggcctgccagcgaggacagggcatccctgtctcca--ggtctc
A0A8C5J3C4_BCL2A1-      ------------------------------------gctcca--ggaatc
A0A8C5IH35_BCL2-01      tgaagctgcccggcgcgcacgtcgtggtaactggaggctccagtggaatt
A0A8C5IH35_BCL2-02      tgaagctgcccggcgcgcacgtcgtggtaactggaggctccagtggaatt
                                                                    **  * 

A0A8C5JFI3_BCL2L1-      ag----------------------------------------------ct
A0A8C5IH35_BCL2-05      tctgctcctgctgctgct---------------------------gctgc
A0A8C5IH35_BCL2-03      tctgctcctgctgctgct---------------------------gctgc
A0A8C5IH35_BCL2-04      tctgctcctgctgctgct---------------------------gctgc
A0A8C5J3C4_BCL2A1-      ---------------------------------------------acacc
A0A8C5IH35_BCL2-01      ggaaaatgcattgctattgaatgctataagcaaggtgctttcataacact
A0A8C5IH35_BCL2-02      ggaaaatgcattgctattgaatgctataagcaaggtgctttcataacact
                                                                          

A0A8C5JFI3_BCL2L1-      ggaggaggaggatgagaacaggactgactttgcaggggaggaggacgaga
A0A8C5IH35_BCL2-05      ggttgctgctgctgggacttcctctgatcacactgggccggtgtctccgc
A0A8C5IH35_BCL2-03      ggttgctgctgctgggacttcctctgatcacactgggccggtgtctccgc
A0A8C5IH35_BCL2-04      ggttgctgctgctgggacttcctctgatcacactgggccggtgtctccgc
A0A8C5J3C4_BCL2A1-      ------------tgggaccagcc-----cagaccagg-------------
A0A8C5IH35_BCL2-01      gattgcaagggatgagaacaagctgttgcagacgaagaaggaaatagaaa
A0A8C5IH35_BCL2-02      gattgcaagggatgagaacaagctgttgcagacgaagaaggaaatagaaa
                                    ** **               *   *             

A0A8C5JFI3_BCL2L1-      tggacggggtcctcaacgggagcccctcctggcacgcagccaccagccac
A0A8C5IH35_BCL2-05      accccgagccccccggc----tcggctgctg----ctagccacgcgcccc
A0A8C5IH35_BCL2-03      accccgagccccccggc----tcggctgctg----ctagccacgcgcccc
A0A8C5IH35_BCL2-04      accccgagccccccggc----tcggctgctg----ctagccacgcgcccc
A0A8C5J3C4_BCL2A1-      gtt------------gc----tcgtgtcctg----agaacca--------
A0A8C5IH35_BCL2-01      agt------------ac----tctgttaatg----acaagca--------
A0A8C5IH35_BCL2-02      agt------------ac----tctgttaatg----acaagca--------
                                        *     *   *  **      *  **        

A0A8C5JFI3_BCL2L1-      atagtgaacggagccaccgtgcaccagagcagcctcgaagtgcacgagat
A0A8C5IH35_BCL2-05      cggccgaggggctgcgccccgcaccc------------------------
A0A8C5IH35_BCL2-03      cggccgaggggctgcgccccgcaccc------------------------
A0A8C5IH35_BCL2-04      cggccgaggggctgcgccccgcaccc------------------------
A0A8C5J3C4_BCL2A1-      ---------tggcatcctctctg---------------------------
A0A8C5IH35_BCL2-01      ---------ggttgtactctgtattt------------------------
A0A8C5IH35_BCL2-02      ---------ggttgtactctgtattt------------------------
                                  *     *                                 

A0A8C5JFI3_BCL2L1-      ccgtcgagcagccgacgtgaggcaggcgctgagagaggcaggggatgagt
A0A8C5IH35_BCL2-05      --------caggtcgtgcacct--cgtcctgcgccaggcgggggacgagt
A0A8C5IH35_BCL2-03      --------caggtcgtgcacct--cgtcctgcgccaggcgggggacgagt
A0A8C5IH35_BCL2-04      --------caggtcgtgcacct--cgtcctgcgccaggcgggggacgagt
A0A8C5J3C4_BCL2A1-      ----------------------------caagaacaaaccgaggag--gc
A0A8C5IH35_BCL2-01      --------ctgttgatgtgtctaaagactatgaacaagtggaaaat--gt
A0A8C5IH35_BCL2-02      --------ctgttgatgtgtctaaagactatgaacaagtggaaaat--gt
                                                           *    *   *   * 

A0A8C5JFI3_BCL2L1-      tcgagctgaggtaccggcgggcgttcagcgacctcacctcc---------
A0A8C5IH35_BCL2-05      tctcccgacgctaccagagggacttcgcccagatgtccggc---------
A0A8C5IH35_BCL2-03      tctcccgacgctaccagagggacttcgcccagatgtccggc---------
A0A8C5IH35_BCL2-04      tctcccgacgctaccagagggacttcgcccagatgtccggc---------
A0A8C5J3C4_BCL2A1-      tctcaggccgctcctggacagg---------attgacat-----------
A0A8C5IH35_BCL2-01      tctaaaacaggctcaggagaagttggggccagttgatatgctcgtgaact
A0A8C5IH35_BCL2-02      tctaaaacaggctcaggagaagttggggccagttgatatgctcgtgaact
                        **       *   *  *                *                

A0A8C5JFI3_BCL2L1-      ------------------cagctccacatcacccccagcacggcgtatca
A0A8C5IH35_BCL2-05      ------------------cagctgcacctgacgcccctcacggccaggag
A0A8C5IH35_BCL2-03      ------------------cagctgcacctgacgcccctcacggccaggag
A0A8C5IH35_BCL2-04      ------------------cagctgcacctgacgcccctcacggccaggag
A0A8C5J3C4_BCL2A1-      ----------------------cacctctgtagctgtt----gccaagag
A0A8C5IH35_BCL2-01      gtgcaggaacatcagttacaggcaaatttgaggatatt----g--aagtg
A0A8C5IH35_BCL2-02      gtgcaggaacatcagttacaggcaaatttgaggatatt----g--aagtg
                                                    *             *       

A0A8C5JFI3_BCL2L1-      gag--ctttgagcaggtagtgaacgaactgttccgcgatggagtgaactg
A0A8C5IH35_BCL2-05      ccg--cttcgtggcggtggtggaggagctcttccgcgatggggttaactg
A0A8C5IH35_BCL2-03      ccg--cttcgtggcggtggtggaggagctcttccgcgatggggttaactg
A0A8C5IH35_BCL2-04      ccg--cttcgtggcggtggtggaggagctcttccgcgatggggttaactg
A0A8C5J3C4_BCL2A1-      aat--tttcaatggagtcatggatgaaaa-------------gtttgctg
A0A8C5IH35_BCL2-01      aattcttttgaaagattaatggcagtgaattacctgggcagtgtttaccc
A0A8C5IH35_BCL2-02      aattcttttgaaagattaatggcagtgaattacctgggcagtgtttaccc
                              **        *  **   *                 **   *  

A0A8C5JFI3_BCL2L1-      ---------------------------------------gggccgcatcg
A0A8C5IH35_BCL2-05      ---------------------------------------gggcaggattg
A0A8C5IH35_BCL2-03      ---------------------------------------gggcaggattg
A0A8C5IH35_BCL2-04      ---------------------------------------gggcaggattg
A0A8C5J3C4_BCL2A1-      atg----gaaatactaactg-------------------gggacgaatta
A0A8C5IH35_BCL2-01      aagccgagcagtaatcgctaccatgaaggagcgcagaatgggaaggattg
A0A8C5IH35_BCL2-02      aagccgagcagtaatcgctaccatgaaggagcgcagaatgggaaggattg
                                                               ***  * **  

A0A8C5JFI3_BCL2L1-      -------------------tggctt--------tcttctccttcggag--
A0A8C5IH35_BCL2-05      -------------------tggcct--------tcttcgagttcggcg--
A0A8C5IH35_BCL2-03      -------------------tggcct--------tcttcgagttcggcg--
A0A8C5IH35_BCL2-04      -------------------tggcct--------tcttcgagttcggcg--
A0A8C5J3C4_BCL2A1-      -------------------tgacca--------tatttacatttggag--
A0A8C5IH35_BCL2-01      tcttcgtgtcgtctcaggctggccagctgggcctgtttggatatacagct
A0A8C5IH35_BCL2-02      tcttcgtgtcgtctcaggctggccagctgggcctgtttggatatacagct
                                           ** *          * **    *     *  

A0A8C5JFI3_BCL2L1-      -gagccct----------gtgcgtggagagcgttgttaaggagatgaggg
A0A8C5IH35_BCL2-05      -gtgtgat----------gtgcgtggagagc-------------------
A0A8C5IH35_BCL2-03      -gtgtgat----------gtgcgtggagagc-------------------
A0A8C5IH35_BCL2-04      -gtgtgat----------gtgcgtggagagc-------------------
A0A8C5J3C4_BCL2A1-      -gtgtcctcaccaag---aagcttcaagagc------------------a
A0A8C5IH35_BCL2-01      tattctcccaccaagtttgctcttcgagggt-tggctgaagccctgcaaa
A0A8C5IH35_BCL2-02      tattctcccaccaagtttgctcttcgagggt-tggctgaagccctgcaaa
                                             * *  ** *                    

A0A8C5JFI3_BCL2L1-      tattggtgaaacgcatcgtgtcttggatgaccacgtacttg--accgacc
A0A8C5IH35_BCL2-05      -------------------------------------------gtcaa--
A0A8C5IH35_BCL2-03      -------------------------------------------gtcaa--
A0A8C5IH35_BCL2-04      -------------------------------------------gtcaa--
A0A8C5J3C4_BCL2A1-      tgggg--------------------------------------ttcag--
A0A8C5IH35_BCL2-01      tggaggtaaaaccttacaatgtctacgtaacggtggcctatcctccagat
A0A8C5IH35_BCL2-02      tggaggtaaaaccttacaatgtctacgtaacggtggcctatcctccagat
                                                                     *    

A0A8C5JFI3_BCL2L1-      acttagacccctgga--tccaggagaatg---------------gcggat
A0A8C5IH35_BCL2-05      ----------ccg-------------------------------ggagat
A0A8C5IH35_BCL2-03      ----------ccg-------------------------------ggagat
A0A8C5IH35_BCL2-04      ----------ccg-------------------------------ggagat
A0A8C5J3C4_BCL2A1-      ----------ctgac--tgcaga---------------------ggagaa
A0A8C5IH35_BCL2-01      actgatactcctggctttgcagaagaaagtaaaacaaagcccttagagac
A0A8C5IH35_BCL2-02      actgatactcctggctttgcagaagaaagtaaaacaaagcccttagagac
                                  * *                                  ** 

A0A8C5JFI3_BCL2L1-      gggagcgctttgtggacctctatgggaacgatgctg-ctgccgagatgag
A0A8C5IH35_BCL2-05      g----------tctcacctcgtggacagcatcgccgcctggatgaccgag
A0A8C5IH35_BCL2-03      g----------tctcacctcgtggacagcatcgccgcctggatgaccgag
A0A8C5IH35_BCL2-04      g----------tctcacctcgtggacagcatcgccgcctggatgaccgag
A0A8C5J3C4_BCL2A1-      gga--------gcagatctctt--atttcat--c----------acagag
A0A8C5IH35_BCL2-01      gaa--------gctgatttctgaaacctcat--ctgtttgccaagcagag
A0A8C5IH35_BCL2-02      gaa--------gctgatttctgaaacctcat--ctgtttgccaagcagag
                        *              *  **        *    *             ***

A0A8C5JFI3_BCL2L1-      gaaaggccaggagaccttcaacaaatggctcctgacgggggcgacagtgg
A0A8C5IH35_BCL2-05      tacct--------------------------------gaaccggcagctg
A0A8C5IH35_BCL2-03      tacct--------------------------------gaaccggcagctg
A0A8C5IH35_BCL2-04      tacct--------------------------------gaaccggcagctg
A0A8C5J3C4_BCL2A1-      tacatcataa----------------------acaacaaagc--------
A0A8C5IH35_BCL2-01      caagttgccagagttatagtgaaagatgccatacaagggaacttcaacag
A0A8C5IH35_BCL2-02      caagttgccagagttatagtgaaagatgccatacaagggaacttcaacag
                         *                                       *        

A0A8C5JFI3_BCL2L1-      ctgaggccaatgcagcacttcagccaccagctcccagcgctggggagatc
A0A8C5IH35_BCL2-05      ca------------------------------------------------
A0A8C5IH35_BCL2-03      ca------------------------------------------------
A0A8C5IH35_BCL2-04      ca------------------------------------------------
A0A8C5J3C4_BCL2A1-      --------------------------------------------------
A0A8C5IH35_BCL2-01      ct------------------------------------------------
A0A8C5IH35_BCL2-02      ct------------------------------------------------
                                                                          

A0A8C5JFI3_BCL2L1-      caggcagctggcggggggcgcaggctagaaggtgtcccagccctgcaggg
A0A8C5IH35_BCL2-05      ----caactgg----------------------at---------------
A0A8C5IH35_BCL2-03      ----caactgg----------------------at---------------
A0A8C5IH35_BCL2-04      ----caactgg----------------------at---------------
A0A8C5J3C4_BCL2A1-      ----cgattgg----------------------at------------tga
A0A8C5IH35_BCL2-01      ----cagttgg----------------------atcagatggttacatgc
A0A8C5IH35_BCL2-02      ----cagttgg----------------------atcagatggttacatgc
                            *   ***                       *               

A0A8C5JFI3_BCL2L1-      ttctccaaataatttggaagagaataaacagacttatttttgcatgtgtg
A0A8C5IH35_BCL2-05      ------------ccaggacaa-----------------------------
A0A8C5IH35_BCL2-03      ------------ccaggacaa-----------------------------
A0A8C5IH35_BCL2-04      ------------ccaggacaa-----------------------------
A0A8C5J3C4_BCL2A1-      tgcgaatggtggctgggaaaa-----------------------------
A0A8C5IH35_BCL2-01      tgtcaatattgacaagtggga-----------------------------
A0A8C5IH35_BCL2-02      tgtcaatattgacaagtggga-----------------------------
                                       *    *                             

A0A8C5JFI3_BCL2L1-      agtgcgtgcgtgtgtgtagatgtgtcactaatataaaagttccccagcca
A0A8C5IH35_BCL2-05      ------------cg---------------------gaggct---------
A0A8C5IH35_BCL2-03      ------------cg---------------------gaggct---------
A0A8C5IH35_BCL2-04      ------------cg---------------------gaggct---------
A0A8C5J3C4_BCL2A1-      ------------tg---------gcttc--ctaacgaagtttgaaaga--
A0A8C5IH35_BCL2-01      ------------tgtcaccagtcacttctattactgaaggtcttcagc--
A0A8C5IH35_BCL2-02      ------------tgtcaccagtcacttctattactgaaggtcttcagc--
                                     *                      * * *         

A0A8C5JFI3_BCL2L1-      gagcaagggtcaggctccgtgcccccgtctctggcacacacaggcaccag
A0A8C5IH35_BCL2-05      -------ggatttca-----ggatctgtca------------gt--gtga
A0A8C5IH35_BCL2-03      -------gggatgcctttgtggagttgtat------------ggcaatgg
A0A8C5IH35_BCL2-04      -------ggagctac-agaaggactggctt------------ggcagtgg
A0A8C5J3C4_BCL2A1-      -------agatcactactg-------------------------------
A0A8C5IH35_BCL2-01      -------aggatgcctttgtggagttgtat------------ggcaatgg
A0A8C5IH35_BCL2-02      -------aggttgtttgcatgggcattttt------------cgca----
                                *                                         

A0A8C5JFI3_BCL2L1-      ggagaggc-aggagcttccctgcagcatccctatcctgtccttgcttct-
A0A8C5IH35_BCL2-05      aaggatgc-tttaattcctgtgcccggtcttcaacttg--cttcttgcac
A0A8C5IH35_BCL2-03      aatgaggc---------ctttgttcgat-ttctcctggatctctctgaag
A0A8C5IH35_BCL2-04      cctgtcgcacttggcaactttttttgacgttgacgtggggaacactgaag
A0A8C5J3C4_BCL2A1-      -------t---------ccttctccaaa-atcac---agccctgctcata
A0A8C5IH35_BCL2-01      aatgaggc---------ctttgttcgat-ttctcctggatctctctgaag
A0A8C5IH35_BCL2-02      -------t---------cattggcctat-tttacctaggaagttttgaca
                                         *  *                        *    

A0A8C5JFI3_BCL2L1-      -ccagtcagagctcatccctgaggcagggggaggaaga------------
A0A8C5IH35_BCL2-05      cataccccatata------tgaaccttat-taataaatggct--------
A0A8C5IH35_BCL2-03      actatcctgagtc------tggttctggtgggag----------------
A0A8C5IH35_BCL2-04      --------ggatg------cagttggtgtgggagaaacaactgtgtttgt
A0A8C5J3C4_BCL2A1-      gc-------tgttgtttccttgttcagagagta-----------------
A0A8C5IH35_BCL2-01      actatcctgagtc------tggttctggtgggag----------------
A0A8C5IH35_BCL2-02      gc-atagttcgtcgctgcatgatgcaaagggaaa----------------
                                                                          

A0A8C5JFI3_BCL2L1-      -----------------------ggaggaggcagaggccagaggtga
A0A8C5IH35_BCL2-05      cttcca--gagtggctttgtatgtggtcatgc--------ttggtag
A0A8C5IH35_BCL2-03      cttgca---------tcactcttggcgcttatctcggacataaatag
A0A8C5IH35_BCL2-04      cttgcagtgatgggttccctctttgggcacac----aacctaa----
A0A8C5J3C4_BCL2A1-      ----------------------------------------ctactga
A0A8C5IH35_BCL2-01      cttgca---------tcactcttggcgcttatctcggacataaatag
A0A8C5IH35_BCL2-02      -----------------aatctgaaagtgcagataaaac-tgagtaa
                                                                       

© 1998-2022Legal notice