Dataset for CDS BCL2L10 of organism Labrus bergylta

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A3Q3EZT5_BCL2L10      atgtgcagagcgcagtctgatatcgctgggaggaaaatgtcgtgcgggct
A0A3Q3EZT5_BCL2L10      atgtgcagagcgcagtctgatatcgctgggaggaaaatgtcgtgcgggct

A0A3Q3EZT5_BCL2L10      gtggaaagagaccctggctctggcagaggactacctgtccctgtgctgca
A0A3Q3EZT5_BCL2L10      gtggaaagagaccctggctctggcagaggactacctgtccctgtgctgca

A0A3Q3EZT5_BCL2L10      caagcccacggccagcccctccacctcccagcatgtcagccgctgctata
A0A3Q3EZT5_BCL2L10      caagcccacggccagcccctccacctcccagcatgtcagccgctgctata

A0A3Q3EZT5_BCL2L10      aggcgcctggcccaggacatggagaagcagcaccaggcccgcttccaatc
A0A3Q3EZT5_BCL2L10      aggcgcctggcccaggacatggagaagcagcaccaggcccgcttccaatc

A0A3Q3EZT5_BCL2L10      cctggctcagaccttcctgaggcagtgcgggccggacccctgctccggtc
A0A3Q3EZT5_BCL2L10      cctggctcagaccttcctgaggcagtgcgggccggacccctgctccggtc

A0A3Q3EZT5_BCL2L10      ttaggaaggtgatggaggaactggtgggagatggacacttgaactgggga
A0A3Q3EZT5_BCL2L10      ttaggaaggtgatggaggaactggtgggagatggacacttgaactgggga

A0A3Q3EZT5_BCL2L10      agggttgtatcccttttcacctttactggggtgctggccagacaactgca
A0A3Q3EZT5_BCL2L10      agggttgtatcccttttcacctttactggggtgctggccagacaactgca

A0A3Q3EZT5_BCL2L10      ggagcaggaggatgtgaagctggggctggaccctgtgcaggggcagaaac
A0A3Q3EZT5_BCL2L10      ggagcaggaggatgtgaagctggggctggaccctgtgcaggggcagaaac

A0A3Q3EZT5_BCL2L10      tgggacagggacccgggcactgcaggggactggcagagaccatagctgac
A0A3Q3EZT5_BCL2L10      tgggacagggacccgggcactgcaggggactggcagagaccatagctgac

A0A3Q3EZT5_BCL2L10      tacctgggagaggagaaaaaagagtggcttctggagaatgacggatggga
A0A3Q3EZT5_BCL2L10      tacctgggagaggagaaaaaagagtggcttctggagaatgacggatggga

A0A3Q3EZT5_BCL2L10      gggattctgtgagttctcccgcagcgctagagagacgagccaggactcgt
A0A3Q3EZT5_BCL2L10      gggattctgtgagttctcccgcagcgctagagagacgagccaggactcgt

A0A3Q3EZT5_BCL2L10      ccatgaagacggcactgtttgctgcggctggtgtgggccttgctggactc
A0A3Q3EZT5_BCL2L10      ccatgaagacggcactgtttgctgcggctggtgtgggccttgctggactc

A0A3Q3EZT5_BCL2L10      actttcctcctgatccgagtgcaggcctga
A0A3Q3EZT5_BCL2L10      actttcctcctggtgcg---------ctag
                        ************ * **         **  

© 1998-2020Legal notice