Dataset for CDS BAX-like of Organism Chelonoidis abingdonii

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C0J8V3_BOK-01       --------atggaggtgctacgccgttcctcggtctttgctgcggaggtg
A0A8C0GSV4_BAK1-03      atgaggataaggaggagtttcctcactcctgtgc----actccagaggag
A0A8C0GSV4_BAK1-01      ---agaacaagtgg------------------------------------
A0A8C0GSV4_BAK1-02      atgaggataaggaggagtttcctcactcctgtgc----actccagaggag
                                * *  *                                    

A0A8C0J8V3_BOK-01       atg-------gagatttttgatcggtctcccaccgaca-aggagctggtg
A0A8C0GSV4_BAK1-03      ctgcctgcctgaccctgccaatcattgtctccccctcagaagatcaggtg
A0A8C0GSV4_BAK1-01      ------acataaacaggcca----------------tgaaagatcaggtg
A0A8C0GSV4_BAK1-02      ctgcctgcctgaccctgccaatcattgtctccccctcagaagatcaggtg
                                   *                           * ** * ****

A0A8C0J8V3_BOK-01       tcccaggcta------aggtgctctgcagagactacatacattcccggct
A0A8C0GSV4_BAK1-03      gcccaggagaccgaggaggtgttccggag-----ctatgccttcc--acc
A0A8C0GSV4_BAK1-01      gcccaggagaccgaggaggtgttccggag-----ctatgccttcc--acc
A0A8C0GSV4_BAK1-02      gcccaggagaccgaggaggtgttccggag-----ctatgccttcc--acc
                         ******  *      ***** ** * **       ** * ****   * 

A0A8C0J8V3_BOK-01       gcttcgggctggcattggctggagcaaaccagagcacag-------tgca
A0A8C0GSV4_BAK1-03      gctaccagcagg----agagggaagagggcggaggggaggtgccgatgga
A0A8C0GSV4_BAK1-01      gctaccagcagg----agagggaagagggcggaggggaggtgccgatgga
A0A8C0GSV4_BAK1-02      gctaccagcagg----agagggaagagggcggaggggaggtgccgatgga
                        *** *  ** **     *  ***  *   * ***   **       ** *

A0A8C0J8V3_BOK-01       cccatgcctggcggcagactggctgaggtgtccagcgtgcttctgcgact
A0A8C0GSV4_BAK1-03      ccccgagattgcagagatccagc--aggagccgggca-gcaccagtaacc
A0A8C0GSV4_BAK1-01      ccccgagattgcagagatccagc--aggagccgggca-gcaccagtaacc
A0A8C0GSV4_BAK1-02      ccccgagattgcagagatccagc--aggagccgggca-gcaccagtaacc
                        ***     * ** *    *  **  *** * *  **  **  * *  ** 

A0A8C0J8V3_BOK-01       agg-ggacgag---ctagaatacatccgaccaaatatttac---cggaat
A0A8C0GSV4_BAK1-03      aggtgggcaggcgcctggccatcattggagatgacatcaacatgcggtat
A0A8C0GSV4_BAK1-01      aggtgggcaggcgcctggccatcattggagatgacatcaacatgcggtat
A0A8C0GSV4_BAK1-02      aggtgggcaggcgcctggccatcattggagatgacatcaacatgcggtat
                        *** ** *  *   ** *    ***  **    * **  **   *** **

A0A8C0J8V3_BOK-01       atcgc------ccggca---gctgaacatctcactgcactccga-gaccg
A0A8C0GSV4_BAK1-03      gacgcagagttccagaacatgctgaagaccctgcagcccacgaaggacaa
A0A8C0GSV4_BAK1-01      gacgcagagttccagaacatgctgaagaccctgcagcccacgaaggacaa
A0A8C0GSV4_BAK1-02      gacgcagagttccagaacatgctgaagaccctgcagcccacgaaggacaa
                          ***      ** * *   ****** * *   * ** * *  * ***  

A0A8C0J8V3_BOK-01       tggtaactgatgccttcttggcagtagcggcccagat--cttcacggcag
A0A8C0GSV4_BAK1-03      tgcctacgagtacttcactaaga-tagc-ctccagcttgtttgacagc-g
A0A8C0GSV4_BAK1-01      tgcctacgagtacttcactaaga-tagc-ctccagcttgtttgacagc-g
A0A8C0GSV4_BAK1-02      tgcctacgagtacttcactaaga-tagc-ctccagcttgtttgacagc-g
                        **   **   * * *   *   * ****   **** *   ** ** ** *

A0A8C0J8V3_BOK-01       gcataacatggggcaaggtcgtgtctct-ctatgctgtggctgctggact
A0A8C0GSV4_BAK1-03      gcattaactggggcagggtgattgcgctgctggggttcggttaccgga-t
A0A8C0GSV4_BAK1-01      gcattaactggggcagggtgattgcgctgctggggttcggttaccgga-t
A0A8C0GSV4_BAK1-02      gcattaactggggcagggtgattgcgctgctggggttcggttaccgga-t
                        **** *  ******* ***  *  * ** **  * *  ** * * *** *

A0A8C0J8V3_BOK-01       ggctgtggac-tgcgtcagacaggcccagccagcaatggtgcatgccatt
A0A8C0GSV4_BAK1-03      ggcgattcatgtgtaccagcacggggtgaccggc-ttcctccggagcatt
A0A8C0GSV4_BAK1-01      ggcgattcatgtgtaccagcacggggtgaccggc-ttcctccggagcatt
A0A8C0GSV4_BAK1-02      ggcgattcatgtgtaccagcacggggtgaccggc-ttcctccggagcatt
                        ***  *  *  **   ***   **     ** **  *  * *    ****

A0A8C0J8V3_BOK-01       gtggactgcctgggagagtttg---tccgcaagaccttggtgacgtggct
A0A8C0GSV4_BAK1-03      gctcgctacgtggcagaattcgtgctccgcaaccgcatcgcccagtggat
A0A8C0GSV4_BAK1-01      gctcgctacgtggcagaattcgtgctccgcaaccgcatcgcccagtggat
A0A8C0GSV4_BAK1-02      gctcgctacgtggcagaattcgtgctccgcaaccgcatcgcccagtggat
                        *    ** * *** *** ** *   *******   * * *    **** *

A0A8C0J8V3_BOK-01       gaagaggagaggaggctgggcagacatcacaaaatgtgtggtgaatactg
A0A8C0GSV4_BAK1-03      cgccgaccaaggaggatgggtaa------gtgagcctggctt--------
A0A8C0GSV4_BAK1-01      cgccgaccaaggaggatgggtgg------cagcactggagttggataacg
A0A8C0GSV4_BAK1-02      cgccgaccaaggaggatgggtgg------cagcactggagttggataacg
                                 ****** ****                 *   *        

A0A8C0J8V3_BOK-01       atcccagccttcgctcccattggctcgtggctgccatttgtagctttg--
A0A8C0GSV4_BAK1-03      --------ttttttctctggagg-----g----------------cagct
A0A8C0GSV4_BAK1-01      tttacg--tattgtacatgatgg-----gggtgttggtcgtggtcctgct
A0A8C0GSV4_BAK1-02      tttacg--tattgtacatgatgg-----gggtgttggtcgtggtcctgct
                                  *          **     *                  *  

A0A8C0J8V3_BOK-01       --gtcacttcctgaaggccatcttctttgtgctgttaccagagaga----
A0A8C0GSV4_BAK1-03      gagcc----ggtgctgccaagtttgtccaaaaagcaacccaggtgatgtc
A0A8C0GSV4_BAK1-01      gggtcatttggtggtacgacgcttctt-------cagccca---------
A0A8C0GSV4_BAK1-02      gggtcatttggtggtacgacgcttctt-------cagccca---------
                          * *      **         ** *           **           

A0A8C0J8V3_BOK-01       tga
A0A8C0GSV4_BAK1-03      tga
A0A8C0GSV4_BAK1-01      tga
A0A8C0GSV4_BAK1-02      tga
                        ***

© 1998-2023Legal notice