Dataset for CDS BAX-like of Organism Chelonoidis abingdonii

[Download (right click)] [Alignment] [Repertoires]

4 sequence(s)

>gnl|bcl2dbcds|A0A8C0GSV4_BAK1-01 BCL2-antagonist/killer 1 gene OS=[Eukaryota] Chelonoidis abingdonii GN=BAK1 (length=594 residues).
agaacaagtggacataaacaggccatgaaagatcaggtggcccaggagaccgaggaggtgttccggagctatgccttcca
ccgctaccagcaggagagggaagagggcggaggggaggtgccgatggaccccgagattgcagagatccagcaggagccgg
gcagcaccagtaaccaggtgggcaggcgcctggccatcattggagatgacatcaacatgcggtatgacgcagagttccag
aacatgctgaagaccctgcagcccacgaaggacaatgcctacgagtacttcactaagatagcctccagcttgtttgacag
cggcattaactggggcagggtgattgcgctgctggggttcggttaccggatggcgattcatgtgtaccagcacggggtga
ccggcttcctccggagcattgctcgctacgtggcagaattcgtgctccgcaaccgcatcgcccagtggatcgccgaccaa
ggaggatgggtggcagcactggagttggataacgtttacgtattgtacatgatgggggtgttggtcgtggtcctgctggg
tcatttggtggtacgacgcttcttcagcccatga
>gnl|bcl2dbcds|A0A8C0GSV4_BAK1-02 BCL2-antagonist/killer 1 gene OS=[Eukaryota] Chelonoidis abingdonii GN=BAK1 (length=651 residues).
atgaggataaggaggagtttcctcactcctgtgcactccagaggagctgcctgcctgaccctgccaatcattgtctcccc
ctcagaagatcaggtggcccaggagaccgaggaggtgttccggagctatgccttccaccgctaccagcaggagagggaag
agggcggaggggaggtgccgatggaccccgagattgcagagatccagcaggagccgggcagcaccagtaaccaggtgggc
aggcgcctggccatcattggagatgacatcaacatgcggtatgacgcagagttccagaacatgctgaagaccctgcagcc
cacgaaggacaatgcctacgagtacttcactaagatagcctccagcttgtttgacagcggcattaactggggcagggtga
ttgcgctgctggggttcggttaccggatggcgattcatgtgtaccagcacggggtgaccggcttcctccggagcattgct
cgctacgtggcagaattcgtgctccgcaaccgcatcgcccagtggatcgccgaccaaggaggatgggtggcagcactgga
gttggataacgtttacgtattgtacatgatgggggtgttggtcgtggtcctgctgggtcatttggtggtacgacgcttct
tcagcccatga
>gnl|bcl2dbcds|A0A8C0GSV4_BAK1-03 BCL2-antagonist/killer 1 gene OS=[Eukaryota] Chelonoidis abingdonii GN=BAK1 (length=633 residues).
atgaggataaggaggagtttcctcactcctgtgcactccagaggagctgcctgcctgaccctgccaatcattgtctcccc
ctcagaagatcaggtggcccaggagaccgaggaggtgttccggagctatgccttccaccgctaccagcaggagagggaag
agggcggaggggaggtgccgatggaccccgagattgcagagatccagcaggagccgggcagcaccagtaaccaggtgggc
aggcgcctggccatcattggagatgacatcaacatgcggtatgacgcagagttccagaacatgctgaagaccctgcagcc
cacgaaggacaatgcctacgagtacttcactaagatagcctccagcttgtttgacagcggcattaactggggcagggtga
ttgcgctgctggggttcggttaccggatggcgattcatgtgtaccagcacggggtgaccggcttcctccggagcattgct
cgctacgtggcagaattcgtgctccgcaaccgcatcgcccagtggatcgccgaccaaggaggatgggtaagtgagcctgg
cttttttttctctggagggcagctgagccggtgctgccaagtttgtccaaaaagcaacccaggtgatgtctga
>gnl|bcl2dbcds|A0A8C0J8V3_BOK-01 BCL2-related ovarian killer gene OS=[Eukaryota] Chelonoidis abingdonii GN=BOK (length=642 residues).
atggaggtgctacgccgttcctcggtctttgctgcggaggtgatggagatttttgatcggtctcccaccgacaaggagct
ggtgtcccaggctaaggtgctctgcagagactacatacattcccggctgcttcgggctggcattggctggagcaaaccag
agcacagtgcacccatgcctggcggcagactggctgaggtgtccagcgtgcttctgcgactaggggacgagctagaatac
atccgaccaaatatttaccggaatatcgcccggcagctgaacatctcactgcactccgagaccgtggtaactgatgcctt
cttggcagtagcggcccagatcttcacggcaggcataacatggggcaaggtcgtgtctctctatgctgtggctgctggac
tggctgtggactgcgtcagacaggcccagccagcaatggtgcatgccattgtggactgcctgggagagtttgtccgcaag
accttggtgacgtggctgaagaggagaggaggctgggcagacatcacaaaatgtgtggtgaatactgatcccagccttcg
ctcccattggctcgtggctgccatttgtagctttggtcacttcctgaaggccatcttctttgtgctgttaccagagagat
ga
© 1998-2023Legal notice