Dataset for CDS Unclassified of Organism Apteryx owenii

[Download (right click)]

2 sequence(s)

>gnl|bcl2dbcds|A0A8B9PR58_uncBAK1-01 Putative BCL2-antagonist/killer 1 gene OS=[Eukaryota] Apteryx owenii (length=465 residues).
atgaggagctggaataagatgtctcaaacaaggagaattcccaggcactttgttctctccagctactcaagcggagcacc
aggagaggaaagttacagcagcctcctaacaattccagacaccacacagcaaatggagtttaatatcagctctgctatcc
aggttggccatcagctggcagtaattggggatgaatttaacagaacatacagcaggaagtttgaagatacactgcttcac
ctggcacgtggggttgctatcagtgttttccagacatggaatattattaaaagtgttataagaagctttgggaatctttt
gaacaataactggactaagaggatcattggttatggaagctggatttgtaggcttcctttcaggtgtgtgtgtcagaagc
tggtgcctgcagccttgcttgttgttgcgttttggtggaccataaattatggactgcagaattaa
>gnl|bcl2dbcds|A0A8B9PR58_uncBAK1-02 Putative BCL2-antagonist/killer 1 gene OS=[Eukaryota] Apteryx owenii (length=510 residues).
atgaaaacagttcatactacaagaaataatgggattgtctttgatatcttttttcagaataagatgtctcaaacaaggag
aattcccaggcactttgttctctccagctactcaagcggagcaccaggagaggaaagttacagcagcctcctaacaattc
cagacaccacacagcaaatggagtttaatatcagctctgctatccaggttggccatcagctggcagtaattggggatgaa
tttaacagaacatacagcaggaagtttgaagatacactgcttcacctggcacgtggggttgctatcagtgttttccagac
atggaatattattaaaagtgttataagaagctttgggaatcttttgaacaataactggactaagaggatcattggttatg
gaagctggatttgtaggcttcctttcaggtgtgtgtgtcagaagctggtgcctgcagccttgcttgttgttgcgttttgg
tggaccataaattatggactgcagaattaa
© 1998-2023Legal notice