Dataset for CDS BCL2L1 of organism Oryzias javanicus

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A437DD16_BCL2L1-      atgtcccactgtaacagagagctggtgcagttctatttaggctataagat
A0A437D660_BCL2L1-      atgtccc---gcaacagagaactggttgttttctacgtgaagtataaact
A0A437D660_BCL2L1-      atgtccc---gcaacagagaactggttgttttctacgtgaagtataaact
                        *******   * ******** *****    *****  *    *****  *

A0A437DD16_BCL2L1-      gtcgtccagagactatcctgtgtccctgctgaagcccacagatgatgggg
A0A437D660_BCL2L1-      gtctcagaggaactacccc---------ctcaaccacatag-tgctcaat
A0A437D660_BCL2L1-      gtctcagaggaactacccc---------ctcaaccacatag-tgctcaat
                        ***    **  **** **          ** ** * ** ** ** *    

A0A437DD16_BCL2L1-      gacaaactgaagaggaccgctccgctgtct----------------gcaa
A0A437D660_BCL2L1-      gagtctccgaacaggactgctgcggaggaggtgggcgaggagcagagcac
A0A437D660_BCL2L1-      gagtctccgaacaggactgctgcggaggaggtgggcgaggagcagagcac
                        **    * *** ***** *** **  *                   *** 

A0A437DD16_BCL2L1-      tggcacgctggttaacagtgaggacgaccagctgaagaagtc--------
A0A437D660_BCL2L1-      agagacgcacgccaac----gggacgtttaacgggacgagtcccggtacc
A0A437D660_BCL2L1-      agagacgcacgccaac----gggacgtttaacgggacgagtcccggtacc
                         *  ****  *  ***     *****   * * * *  ****        

A0A437DD16_BCL2L1-      ------ctgcccctgttgtaatag--------------------------
A0A437D660_BCL2L1-      ccgccgctgtccccgttacgacagcagcagttgccgccgtcgacgacaaa
A0A437D660_BCL2L1-      ccgccgctgtccccgttacgacagcagcagttgccgccgtcgacgacaaa
                              *** *** ***   * **                          

A0A437DD16_BCL2L1-      catggatgccatcaaatccacccttaaagattcggccgacgagtttgaac
A0A437D660_BCL2L1-      catggacgcagtgaaggaggcgctccgggacacggccaacgagttcgagc
A0A437D660_BCL2L1-      catggacgcagtgaaggaggcgctccgggacacggccaacgagttcgagc
                        ****** **  * **     * **    **  ***** ******* ** *

A0A437DD16_BCL2L1-      gtcgcttctatcaaggttttagtgatctctctgtgcaacttcacatcact
A0A437D660_BCL2L1-      tgcggtacgccctggccttcaacaacctgcacagccagctgcacatcacg
A0A437D660_BCL2L1-      tgcggtacgccctggccttcaacaacctgcacagccagctgcacatcacg
                          ** * *   *  *  ** *   * **       ** ** ******** 

A0A437DD16_BCL2L1-      cctgacacagcataccaaaacttcaaaagtgtgttggatgagctgttcaa
A0A437D660_BCL2L1-      cccgccacggcctaccagagcttcgagaacgtgatgaacgagctgttccg
A0A437D660_BCL2L1-      cccgccacggcctaccagagcttcgagaacgtgatgaacgagctgttccg
                        ** * *** ** ***** * **** * *  *** ** * *********  

A0A437DD16_BCL2L1-      ggatgggataaactgggggcgtgttgtgggtttgtttgtctttggtggtg
A0A437D660_BCL2L1-      cgacaacatcaactggggccgcatcgtggggctcttcgcgttcggcgggg
A0A437D660_BCL2L1-      cgacaacatcaactggggccgcatcgtggggctcttcgcgttcggcgggg
                         **    ** ******** **  * *****  * ** *  ** ** ** *

A0A437DD16_BCL2L1-      tgctgtgtgttgagtgtgtcgagaggaatatgagtgagctggtctcccgc
A0A437D660_BCL2L1-      cgctgtgcgtggagtgcgtggagaaggagatgagccccctggtggacagg
A0A437D660_BCL2L1-      cgctgtgcgtggagtgcgtggagaaggagatgagccccctggtggacagg
                         ****** ** ***** ** **** * * *****    *****   * * 

A0A437DD16_BCL2L1-      attgctgaatggatgaccatgtacctagatgagcaaataagtccatggat
A0A437D660_BCL2L1-      attgtggagtggatgaccgtctacctggacaaccacatccagccgtggat
A0A437D660_BCL2L1-      attgtggagtggatgaccgtctacctggacaaccacatccagccgtggat
                        ****  ** ********* * ***** **  * ** **    ** *****

A0A437DD16_BCL2L1-      ccacagtcaaggaggatgg-------------------------------
A0A437D660_BCL2L1-      ccagagccaaggcggatgg-------------------------------
A0A437D660_BCL2L1-      ccagagccaaggcggatggcttctcccagaacatcagctgctgatgcgtg
                        *** ** ***** ******                               

A0A437DD16_BCL2L1-      -----------------------------------gattgctttgcacgg
A0A437D660_BCL2L1-      -----------------------------------gaacgttttgctgaa
A0A437D660_BCL2L1-      acatcaaacctgcggccccgcagcgtcacacgcatgaacgttttgctgaa
                                                           **  * *****    

A0A437DD16_BCL2L1-      ctgtatggacaggatggtgctgcagaagcgagaagatttcaagagacgct
A0A437D660_BCL2L1-      atctttgggcaggaggccgcagcagagagcagaaggtctcaggagagctt
A0A437D660_BCL2L1-      atctttgggcaggaggccgcagcagagagcagaaggtctcaggagagctt
                         * * *** ***** *  ** *****    ***** * *** ****   *

A0A437DD16_BCL2L1-      gaaaaagtggacgctggttgcagtggcacttctaactggactgctgcttg
A0A437D660_BCL2L1-      caagaagtggctgctggtggggatgacggtggcgaccggcgtcctggtgg
A0A437D660_BCL2L1-      caagaagtggctgctggtggggatgacggtggcgaccggcgtcctggtgg
                         ** ******  ****** *   ** *  *    ** **  * *** * *

A0A437DD16_BCL2L1-      gtttgctcatcgccaagaaa------tga
A0A437D660_BCL2L1-      gatccttcatcgcccaaaaacgcctgtga
A0A437D660_BCL2L1-      gatccttcatcgcccaaaaacgcctgtga
                        * *   ******** * ***      ***

© 1998-2020Legal notice