Dataset for CDS BCL2L1 of organism Oryzias javanicus

[Download (right click)] [Alignment] [Repertoires]

3 sequence(s)

>gnl|bcl2dbcds|A0A437D660_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Oryzias javanicus GN=BCL2L1 (length=696 residues).
atgtcccgcaacagagaactggttgttttctacgtgaagtataaactgtctcagaggaactaccccctcaaccacatagt
gctcaatgagtctccgaacaggactgctgcggaggaggtgggcgaggagcagagcacagagacgcacgccaacgggacgt
ttaacgggacgagtcccggtaccccgccgctgtccccgttacgacagcagcagttgccgccgtcgacgacaaacatggac
gcagtgaaggaggcgctccgggacacggccaacgagttcgagctgcggtacgccctggccttcaacaacctgcacagcca
gctgcacatcacgcccgccacggcctaccagagcttcgagaacgtgatgaacgagctgttccgcgacaacatcaactggg
gccgcatcgtggggctcttcgcgttcggcggggcgctgtgcgtggagtgcgtggagaaggagatgagccccctggtggac
aggattgtggagtggatgaccgtctacctggacaaccacatccagccgtggatccagagccaaggcggatgggaacgttt
tgctgaaatctttgggcaggaggccgcagcagagagcagaaggtctcaggagagcttcaagaagtggctgctggtgggga
tgacggtggcgaccggcgtcctggtgggatccttcatcgcccaaaaacgcctgtga
>gnl|bcl2dbcds|A0A437D660_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Oryzias javanicus GN=BCL2L1 (length=762 residues).
atgtcccgcaacagagaactggttgttttctacgtgaagtataaactgtctcagaggaactaccccctcaaccacatagt
gctcaatgagtctccgaacaggactgctgcggaggaggtgggcgaggagcagagcacagagacgcacgccaacgggacgt
ttaacgggacgagtcccggtaccccgccgctgtccccgttacgacagcagcagttgccgccgtcgacgacaaacatggac
gcagtgaaggaggcgctccgggacacggccaacgagttcgagctgcggtacgccctggccttcaacaacctgcacagcca
gctgcacatcacgcccgccacggcctaccagagcttcgagaacgtgatgaacgagctgttccgcgacaacatcaactggg
gccgcatcgtggggctcttcgcgttcggcggggcgctgtgcgtggagtgcgtggagaaggagatgagccccctggtggac
aggattgtggagtggatgaccgtctacctggacaaccacatccagccgtggatccagagccaaggcggatggcttctccc
agaacatcagctgctgatgcgtgacatcaaacctgcggccccgcagcgtcacacgcatgaacgttttgctgaaatctttg
ggcaggaggccgcagcagagagcagaaggtctcaggagagcttcaagaagtggctgctggtggggatgacggtggcgacc
ggcgtcctggtgggatccttcatcgcccaaaaacgcctgtga
>gnl|bcl2dbcds|A0A437DD16_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Oryzias javanicus GN=BCL2L1 (length=651 residues).
atgtcccactgtaacagagagctggtgcagttctatttaggctataagatgtcgtccagagactatcctgtgtccctgct
gaagcccacagatgatgggggacaaactgaagaggaccgctccgctgtctgcaatggcacgctggttaacagtgaggacg
accagctgaagaagtcctgcccctgttgtaatagcatggatgccatcaaatccacccttaaagattcggccgacgagttt
gaacgtcgcttctatcaaggttttagtgatctctctgtgcaacttcacatcactcctgacacagcataccaaaacttcaa
aagtgtgttggatgagctgttcaaggatgggataaactgggggcgtgttgtgggtttgtttgtctttggtggtgtgctgt
gtgttgagtgtgtcgagaggaatatgagtgagctggtctcccgcattgctgaatggatgaccatgtacctagatgagcaa
ataagtccatggatccacagtcaaggaggatgggattgctttgcacggctgtatggacaggatggtgctgcagaagcgag
aagatttcaagagacgctgaaaaagtggacgctggttgcagtggcacttctaactggactgctgcttggtttgctcatcg
ccaagaaatga
© 1998-2020Legal notice