Dataset for CDS Unclassified of organism Dicentrarchus labrax

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A8P4GM38_uncBCL2-01 Putative B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Dicentrarchus labrax (length=708 residues).
atgtcctccgcctccagcagccgggacatcgtggaggacttcctccgctacaagctgctctccaccggcctgacctggcg
cgacccgccgcgccgccgccgcacgggcggccagcgcagacacaacgcggccgcgtcagcagcgtcagcagcgtcagcgt
tgactgcgtcatcagggagacctgagcgggcggtgacgtcacaccgaggagtcgctgtggaagactctcagcaaggtccc
agctcgtcaccgacccgactgcaggtcgctctgcggtgtgccggcgacgagctggagcagcgttaccgtggtgacctggc
agcccaggtgtcggtgctgctgctgtgcgacggtggcgtggcggagctgctgcgtggcctgacggcggtcagggaggagc
tgttcagggacggggtgaactgggggcggatcgtggccatgatggcgctgggcggagctctgagtgctgaggtggcccac
acggacggggcgtggcgggtggacgacatcgccgcgtggttagaggagagtctggactcgcagccactccggggatggat
agaagacaacggaggatgggatgcctttaccgagttgtatggtgattccagacctcgagccagattctggtccctggcga
cagtttttgggctggctgtactgggagcagctgggatcacactgggagccctgtttatccggagataa
© 1998-2023Legal notice