Dataset for CDS BAX-like of Organism Hucho hucho

[Download (right click)] [Edit] [Sequences] [Repertoires]

9 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A4W5LI71_BOK-01      --------------------------------------------------
A0A4W5JIY4_BOK-01      --------------------------------------------------
A0A4W5RX79_BOK-01      --------------------------------------------------
A0A4W5RX79_BOK-02      --------------------------------------------------
A0A4W5KF37_BAX-01      --------------------------------------------------
A0A4W5RVD3_BAX-01      --------------------------------------------------
A0A4W5KP29_BAX-01      --------------------------------------------------
A0A4W5MLR0_BAX-01      --------------------------------------------------
A0A4W5NT98_BAX-01      atgctgcaagaaaaacgcagcgttccattcaaaattaatttacttctggt
                                                                         

A0A4W5LI71_BOK-01      --------------------------------------------------
A0A4W5JIY4_BOK-01      --------------------------------------------------
A0A4W5RX79_BOK-01      --------------------------------------------------
A0A4W5RX79_BOK-02      --------------------------------------------------
A0A4W5KF37_BAX-01      --------------------------------------------------
A0A4W5RVD3_BAX-01      --------------------------------------------------
A0A4W5KP29_BAX-01      --------------------------------------------------
A0A4W5MLR0_BAX-01      --------------------------------------------------
A0A4W5NT98_BAX-01      gtatcaaaacggaaaggcacagtcggtgtgtccgaagcgtaagaagaggc
                                                                         

A0A4W5LI71_BOK-01      --------------------------------------------------
A0A4W5JIY4_BOK-01      --------------------------------------------------
A0A4W5RX79_BOK-01      --------------------------------------------------
A0A4W5RX79_BOK-02      --------------------------------------------------
A0A4W5KF37_BAX-01      --------------------------------------------------
A0A4W5RVD3_BAX-01      --------------------------------------------------
A0A4W5KP29_BAX-01      --------------------------------------------------
A0A4W5MLR0_BAX-01      --------------------------------------------------
A0A4W5NT98_BAX-01      acagtttagacacacaagcagcccagggcacttgcacaacccactgtgta
                                                                         

A0A4W5LI71_BOK-01      --------------------------------------------------
A0A4W5JIY4_BOK-01      --------------------------------------------------
A0A4W5RX79_BOK-01      --------------------------------------------------
A0A4W5RX79_BOK-02      --------------------------------------------------
A0A4W5KF37_BAX-01      --------------------------------------------------
A0A4W5RVD3_BAX-01      --------------------------------------------------
A0A4W5KP29_BAX-01      --------------------------------------------------
A0A4W5MLR0_BAX-01      --------------------------------------------------
A0A4W5NT98_BAX-01      tttccgtgttacttccttgttctgtcttgtctttggtttgtggttactga
                                                                         

A0A4W5LI71_BOK-01      --------------------------------------------------
A0A4W5JIY4_BOK-01      --------------------------------------------------
A0A4W5RX79_BOK-01      --------------------------------------------------
A0A4W5RX79_BOK-02      --------------------------------------------------
A0A4W5KF37_BAX-01      -------------------atgtcacatgactgcaggcggaagcagactc
A0A4W5RVD3_BAX-01      --------------------------------------------------
A0A4W5KP29_BAX-01      --------------------------------------------------
A0A4W5MLR0_BAX-01      --------------------------------------------------
A0A4W5NT98_BAX-01      ttgggacagacccgccgaggagatcaggagctgtaggacttcttcgcccc
                                                                         

A0A4W5LI71_BOK-01      ------------------------------atggacatgttgc-------
A0A4W5JIY4_BOK-01      ------------------------------atggaggtgattc-------
A0A4W5RX79_BOK-01      ------------------------------atggaggtgattc-------
A0A4W5RX79_BOK-02      ------------------------------atggaggtgattc-------
A0A4W5KF37_BAX-01      aaagtactcttaaaatggcagcgccgtctggaggaggcgattcaggtaat
A0A4W5RVD3_BAX-01      --------------atggcagcgccgtcgggaggaggcgattcaggtaat
A0A4W5KP29_BAX-01      --------------------------------------------------
A0A4W5MLR0_BAX-01      --------------atggcagactcccgagaaagaaggaaaaccggcgaa
A0A4W5NT98_BAX-01      agtacttcctgtcgatggcagactccagagaaagaaggaaacccggcgaa
                                                                         

A0A4W5LI71_BOK-01      gtcgctcctcagtattcgcggctgaagtgatggaagcatttgaccgatcc
A0A4W5JIY4_BOK-01      gtcgctcctctgtgtttgcagccggggtgatggaggcctttgaccattcc
A0A4W5RX79_BOK-01      gtcgctcttctgtgtttgcagccggggtgatggaggcctttgatcattcc
A0A4W5RX79_BOK-02      gtcgctcttctgtgtttgcagccggggtgatggaggcctttgatcattcc
A0A4W5KF37_BAX-01      ggaactgatcagg-------------------------------------
A0A4W5RVD3_BAX-01      ggaactgatcagg-------------------------------------
A0A4W5KP29_BAX-01      --------------------------------------------------
A0A4W5MLR0_BAX-01      gatgagcctcagggt--gcagtcgggggtgaagatgtcatcgatgacaga
A0A4W5NT98_BAX-01      gatgagcctcagggt--gcagtcgggggtgaagatgtcatcgacgacaga
                                                                         

A0A4W5LI71_BOK-01      cctacaga-caaggagctggtgtcacaggcgaaggcgctatgcagggact
A0A4W5JIY4_BOK-01      ccgtccga-caaagaactggtgtcccagtccaaggcactgtgtagggact
A0A4W5RX79_BOK-01      ccgtcaga-caaagaactggtgtccaagtccaaggcactgtgtagggact
A0A4W5RX79_BOK-02      ccgtcaga-caaagaactggtgtccaagtccaaggcactgtgtagggact
A0A4W5KF37_BAX-01      -tactagaactgggggaaaaattactgacagatttcatctacgagcgggt
A0A4W5RVD3_BAX-01      -tactagaactgggaagaagattactgacagatttcatctacgagcgggt
A0A4W5KP29_BAX-01      ---atggatcaagcagctgtaactctgagaggctacgttatagagagatt
A0A4W5MLR0_BAX-01      attatggagcaaggagctgttgttttaagagggtatgtcatagagaggat
A0A4W5NT98_BAX-01      attatggaacaaggagctattgttttaagagggtatgtcatagagaggat
                             ** *                                 ** *  *

A0A4W5LI71_BOK-01      acatccattcaaggctgaaccgaaccgggatagggtggtc-------caa
A0A4W5JIY4_BOK-01      acatacactctaggctcaacatctatgggctgggctcatc-------caa
A0A4W5RX79_BOK-01      acatacactctaggctcaacctctatgggctaggctcgtc-------caa
A0A4W5RX79_BOK-02      acatacactctaggctcaacctctatgggctaggctcgtc-------caa
A0A4W5KF37_BAX-01      tctt---cgccatgct-gacagc---agtactcagttgtcagtgtcacgg
A0A4W5RVD3_BAX-01      tcgt---cgccatgct-gacagc---agtactcagttgtcagtgttacag
A0A4W5KP29_BAX-01      ---------cagagca-ga------agggatacagctgtc--tcctgaag
A0A4W5MLR0_BAX-01      ---------cagtgca-gaaaactcagagaggcgtttggc--tccagagg
A0A4W5NT98_BAX-01      ---------cagtgcc-gaaaacccagagaggcatttggc--tccagagg
                                *   **   *                    *          

A0A4W5LI71_BOK-01      acccgagcatcagctgtcagcgtctggtgg----gatgcttggagaggta
A0A4W5JIY4_BOK-01      aac-------------------tcaggtggactcaacgctttgtgaggtg
A0A4W5RX79_BOK-01      aac-------------------tcaggtggactcaacgctttgtgatgtg
A0A4W5RX79_BOK-02      aac-------------------tcaggtggactcaacgctttgtgatgtg
A0A4W5KF37_BAX-01      acccagttgggcgg--gagtgagctgtgtgaccccaaccacaagaaactg
A0A4W5RVD3_BAX-01      acccagttgggcgg--gagtgagctgtgtgaccccaaccacaagaaactg
A0A4W5KP29_BAX-01      agctgggtggaacacctaatgaactccagggccatgagttgaaagagata
A0A4W5MLR0_BAX-01      accttggtggcagacccaacgaactagaggaccgccaagtcaaagacgtg
A0A4W5NT98_BAX-01      accttggtggcagacccaacgaacaagaggaccaccaagtcaaagacgtg
                       * *                    *     *               *  * 

A0A4W5LI71_BOK-01      tcctctgtcctcatgtggttaggtgatgagttggagtacctgcggcccaa
A0A4W5JIY4_BOK-01      tctgctgtgcttctctgtctcggtgatgagctggagtgcatgcggccaag
A0A4W5RX79_BOK-01      gctgctgtgcttctctgtctcggtgatgagctggagtgcatgcggcccag
A0A4W5RX79_BOK-02      gctgctgtgcttctctgtctcggtgatgagctggagtgcatgcggcccag
A0A4W5KF37_BAX-01      gccctatgcctgcagcagattggagatgagctgga---------------
A0A4W5RVD3_BAX-01      gcccagtgcctgcagcagattggagatgagctgga---------------
A0A4W5KP29_BAX-01      gtggacgggctactggagactactgaggaactgaa---------------
A0A4W5MLR0_BAX-01      gtacaccagctgctgctgatcgctgatgacctgaa---------------
A0A4W5NT98_BAX-01      gtacaccagctgctgctgattgctgatgacctgaa---------------
                                **             ** **  ** *               

A0A4W5LI71_BOK-01      catctaccgtaacgtagctcggcagctgaacatcaccgtggcgtctgaga
A0A4W5JIY4_BOK-01      tgtctaccggaacgtggcgagacagctcaacatctcagtggccatggaga
A0A4W5RX79_BOK-01      tgtctaccggaacgtggcgagacagctcaacatctcagtagccatggaga
A0A4W5RX79_BOK-02      tgtctaccggaacgtggcgagacagctcaacatctcagtagccatggaga
A0A4W5KF37_BAX-01      ----tggcaatacgcagctccaaagtatgtta----aatgatactgcact
A0A4W5RVD3_BAX-01      ----tggcaatacacaactccaaagtatgata----aatgatactgcact
A0A4W5KP29_BAX-01      ----cacaaatactgagcttcaaggcttaata----agtgaagtctcggt
A0A4W5MLR0_BAX-01      ----cagaaatgctgagctacaacacctaata----agcacagtccaggt
A0A4W5NT98_BAX-01      ----cagaaatgctgagctacaacacctaata----agcacagtccaggt
                                   *    *             *                  

A0A4W5LI71_BOK-01      gcgtggtgtct--gatgccttcctggctgtggctgcagagatcttctcca
A0A4W5JIY4_BOK-01      ccacggtgtcc--gatgcctttgttgctgtggcaacagagatattttctg
A0A4W5RX79_BOK-01      ccatggtttct--gatgccttcgtcgccgtggcaacagagatattcgcag
A0A4W5RX79_BOK-02      ccatggtttct--gatgccttcgtcgccgtggcaacagagatattcgcag
A0A4W5KF37_BAX-01      ccagcccagccaggaggtttttatgagagtggcctgtgagatcttctctg
A0A4W5RVD3_BAX-01      ccagcccagccaggaggtttttatgagagtggcctgtgagatcttctctg
A0A4W5KP29_BAX-01      ctattgtatccaggatgttttctttgcaacaaccaaggagattttcacag
A0A4W5MLR0_BAX-01      aaactgtgcccaggatgtgttcttctcagtggccagggaaatttttgcag
A0A4W5NT98_BAX-01      aaactgtgcccgggatgtgttcttctcagtggccagggaaatctttgcag
                                *   ** *  **  *        *    ** ** **  *  

A0A4W5LI71_BOK-01      c------------------tggtaggtcaattctctgtctgcatctctcc
A0A4W5JIY4_BOK-01      c-------------------------------------------------
A0A4W5RX79_BOK-01      cagctcacattccgtcactagtacacacagtttctgctatggatcatgtc
A0A4W5RX79_BOK-02      c-------------------------------------------------
A0A4W5KF37_BAX-01      a-------------------------------------------------
A0A4W5RVD3_BAX-01      a-------------------------------------------------
A0A4W5KP29_BAX-01      a-------------------------------------------------
A0A4W5MLR0_BAX-01      a-------------------------------------------------
A0A4W5NT98_BAX-01      a-------------------------------------------------
                                                                         

A0A4W5LI71_BOK-01      tc------------aggta---taacgtgggggaaggtggtatccctgta
A0A4W5JIY4_BOK-01      --------------aggca---tcacatggggtaaggtagtatctatgta
A0A4W5RX79_BOK-01      actaaagagcgaaaaggta---tcacatgggggaaggtggtatctatgta
A0A4W5RX79_BOK-02      --------------aggta---tcacatgggggaaggtggtatctatgta
A0A4W5KF37_BAX-01      --------------tgggaagttcaactggggcagggtggtggcactctt
A0A4W5RVD3_BAX-01      --------------tgggaagttcaactggggcagggtggtggcactctt
A0A4W5KP29_BAX-01      --------------tggaa---ttaacttgggcaaagtggcagcccttca
A0A4W5MLR0_BAX-01      --------------tggta---tcaactggggcagagtggtctccctgtt
A0A4W5NT98_BAX-01      --------------tggta---tcaactggggcagagtggtctccctgtt
                                      ** *   * *  * *** *  ** *   *  *   

A0A4W5LI71_BOK-01      tgcggtagctggtgccctggcggtggactgcgtgaggcatggtcacccag
A0A4W5JIY4_BOK-01      tgccgtggccggcgctctggcggtggactgtgtacgtcagaaccagcctg
A0A4W5RX79_BOK-01      tgccgtggctggggctctggcggtggactgcgtgcgacagaaccagccag
A0A4W5RX79_BOK-02      tgccgtggctggggctctggcggtggactgcgtgcgacagaaccagccag
A0A4W5KF37_BAX-01      ctactttgcctgtcggctggtcatcaaggctctgttgaccaaggtccccg
A0A4W5RVD3_BAX-01      ctactttgcctgtcgcctagtcatcaaggctctgttgaccaagatccccg
A0A4W5KP29_BAX-01      tcacctggcctacaagcttattcacagagcacatacacagaaccaacccc
A0A4W5MLR0_BAX-01      tcacctggcctacaagcttatttacaaggcactgacacagaaccacttag
A0A4W5NT98_BAX-01      tcacttggcctacaagcttatttacaaggcactgacacagaaccacttag
                            * **       **                                

A0A4W5LI71_BOK-01      caatggtccacaccattgtagactgcatgggggagtttgtccgcaagagc
A0A4W5JIY4_BOK-01      ctacggtccaaaccatagtggacagtctgggtcagtttgtccgcaagaac
A0A4W5RX79_BOK-01      ctacggtccaaaccatagtggacagcctgggccagtttgtccgcaagaac
A0A4W5RX79_BOK-02      ctacggtccaaaccatagtggacagcctgggccagtttgtccgcaagaac
A0A4W5KF37_BAX-01      acatcatcagaaccattatcagctgggccacagactacctgcgagatcat
A0A4W5RVD3_BAX-01      acatcatcagaaccattatcagctgggccacagactacctgcgagatcat
A0A4W5KP29_BAX-01      aagtcatggttaacataatcaactggactctacagttaatgagggaaaac
A0A4W5MLR0_BAX-01      aaatcatcaagaaggttattagctgggtattacagttcatcagggaaaat
A0A4W5NT98_BAX-01      aaatcatcaagaaggttattagctgggtattacagttcatcagggaaaat
                             *    *   *  *   * *        * *   *  *  *    

A0A4W5LI71_BOK-01      ctggtctcctggttgaagaggagaggaggatgggct---gatatcacgaa
A0A4W5JIY4_BOK-01      ctggccccttggctgaagaaacgtggaggatgggtgagtgactggactaa
A0A4W5RX79_BOK-01      ctggccccttggctgaagaaacgcggaggatggacg---gacattaagaa
A0A4W5RX79_BOK-02      ctggccccttggctgaagaaacgcggaggatggacg---gacattaagaa
A0A4W5KF37_BAX-01      gtgatcaactggattagggagcagggtggctgggagggaatccgttccta
A0A4W5RVD3_BAX-01      gtgatcaactggattagggagcagggtggctgggagggaatccgttccta
A0A4W5KP29_BAX-01      ctttactcttggatcagtcgg---gaagtatggaaagcg----tcccaaa
A0A4W5MLR0_BAX-01      gtctccgcttggatccggcagcaaggaggatgggaggcggt-tgttagca
A0A4W5NT98_BAX-01      gtctcctcttggatccgacagcaaggaggatgggaggcggt-tgttagca
                        *   *   *** *          *  *  ***                *

A0A4W5LI71_BOK-01      gtgcgtggtgaacacagaccccagcttccgctcccattggttgatgtccg
A0A4W5JIY4_BOK-01      atgtgtggtgaagttagatgccgttcctcagacccattggctgtctccag
A0A4W5RX79_BOK-01      gtgtgtggtgaagttagatgccgttcctcagacccattggctgtctcccg
A0A4W5RX79_BOK-02      gtgtgtggtgaagttagatgccgttcctcagacccattggctgtctcccg
A0A4W5KF37_BAX-01      ctttgg----------------------cactcccacctggcagaccgtg
A0A4W5RVD3_BAX-01      ctttgg----------------------cactcccacctggcagaccgtg
A0A4W5KP29_BAX-01      aggtgt----------------------cat-----ggtggtgca-----
A0A4W5MLR0_BAX-01      ccgtgt----------------------cac-----attggcgtactctg
A0A4W5NT98_BAX-01      ctgtgt----------------------cac-----attggcgtacggtg
                           *                       *          *          

A0A4W5LI71_BOK-01      ctgcctgtgcctgtggacattacctgaaggccatggtgttttacctgctt
A0A4W5JIY4_BOK-01      ttgcccaatcctgcaagcactttctgtcaacactgtacatctacattatg
A0A4W5RX79_BOK-01      ttgcccaatcctgcaagcactttctatcaacactgtacatctacattatg
A0A4W5RX79_BOK-02      ttgcccaatcctgcaagcactttctatcaacactgtacatctacattatg
A0A4W5KF37_BAX-01      ggggtgttcctcgctggagttctt--accactgtgctggtcatccgcaag
A0A4W5RVD3_BAX-01      ggggtgttcctcgctggagttctt--accactgtgctggtcatccgcaag
A0A4W5KP29_BAX-01      ------------gcaagtgct--------gcggccatagcatactggagg
A0A4W5MLR0_BAX-01      tcgcttgtggctgcagtggctttc--gtgacggccatggtttactggagg
A0A4W5NT98_BAX-01      tcgcttgtggctgcagtggctttc--gtgacggtcatggtttactggagg
                                   *       *         *            *      

A0A4W5LI71_BOK-01      cgggacaagtaa--------------------------------
A0A4W5JIY4_BOK-01      aaggagccatga--------------------------------
A0A4W5RX79_BOK-01      aaggagccatga--------------------------------
A0A4W5RX79_BOK-02      aaggagccatga--------------------------------
A0A4W5KF37_BAX-01      atg------tga--------------------------------
A0A4W5RVD3_BAX-01      atg------tga--------------------------------
A0A4W5KP29_BAX-01      aaacatcgctgagctcttcacagggagaagtgctgcggccatag
A0A4W5MLR0_BAX-01      aaatcacgctga--------------------------------
A0A4W5NT98_BAX-01      aaaacacgctga--------------------------------
                                * *                                

© 1998-2023Legal notice