Dataset for CDS BCL2A1 of organism Canis lupus dingo

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A8C0KQ53_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Canis lupus dingo GN=BCL2A1 (length=525 residues).
atgacggactgcgagtttggctacacgctggcgctggcccaggactacgtgaggcacgtcctgcagatcccgcagcccgg
cccggcccccagcagagcgtccagggtgctccaggacgtggccttctccgtccaggggcaggtggaaaagaacctgaagc
cgtgcttggacagttttgacgtggtgtctgtcgacacggccagaaccatattcaatcaggtgatggagaaggaatttgaa
gacggcgtcattaactggggaaggatcgtgaccgtttttgcctttgaaggaattctcaccaagaaactcctcgagcagcg
aatttcctcggatgtggatgccgagaaggtttcctacttcgtggcagagttcatcacgagaaacatgagagactggataa
gacaaaacggaggctgggaaaacggctttgtgaagaagttcgaacccaagtctggatggctgacttttctggaagttctg
ggaacagtgtgtgaaatgtggtcacacctaaagcaatactactga
© 1998-2022Legal notice