Dataset for CDS BCL2L2 of organism Vulpes vulpes

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A3Q7T511_BCL2L2-      atggcgaccccagcctcagccccagacacacgggctctagtggcagactt
A0A3Q7T511_BCL2L2-      atggcgaccccagcctcagccccagacacacgggctctagtggcagactt
A0A3Q7T511_BCL2L2-      atggc-----------------------------------tggaagcctt
                        *****                                   *** ** ***

A0A3Q7T511_BCL2L2-      tgtaggctataagctgaggcagaagggttatgtttgtggagctggccctg
A0A3Q7T511_BCL2L2-      tgtaggctataagctgaggcagaagggttatgtttgtggagctggccctg
A0A3Q7T511_BCL2L2-      -----gccgtccgttgcggggcaaggttca----------------cctg
                             **  *  * ** **   **** * *                ****

A0A3Q7T511_BCL2L2-      gagagggcccagcagctgatccactgcaccaagccatgcgggcagctgga
A0A3Q7T511_BCL2L2-      gagagggcccagcagctgatccactgcaccaagccatgcgggcagctgga
A0A3Q7T511_BCL2L2-      --------------------tcac------------------------ga
                                             ***                        **

A0A3Q7T511_BCL2L2-      gatgagtttgagacccgcttccggcgcaccttctctgatttggc-agccc
A0A3Q7T511_BCL2L2-      gatgagtttgagacccgcttccggcgcaccttctctgatttggc-agccc
A0A3Q7T511_BCL2L2-      aacggatgttag-----------------ctcttcgaatctcacgagcca
                         * *  * * **                 **  **  ** *  * **** 

A0A3Q7T511_BCL2L2-      agctgcatgtgaccccaggctcagcccagcaacgcttcacccaggtctct
A0A3Q7T511_BCL2L2-      agctgcatgtgaccccaggctcagcccagcaacgcttcacccaggtctct
A0A3Q7T511_BCL2L2-      atcggcatccga-----------------------------gagggct--
                        * * ****  **                              *** **  

A0A3Q7T511_BCL2L2-      gacgaactcttccaagggggccccaactggggccgtcttgtggccttctt
A0A3Q7T511_BCL2L2-      gacgaactcttccaagggggccccaactggggccgtcttgtggccttctt
A0A3Q7T511_BCL2L2-      -----attgctgcgaggcgatcggaagattggcctttt-------ctcct
                             * *  * * *** *  *  **    **** * *        ** *

A0A3Q7T511_BCL2L2-      tgtctttggagctgcactgtgtgctgagagtgtcaacaaagagatggagc
A0A3Q7T511_BCL2L2-      tgtctttggagctgcactgtgtgctgagagtgtcaacaaagagatggagc
A0A3Q7T511_BCL2L2-      cgccct-----------------------------------------agc
                         * * *                                         ***

A0A3Q7T511_BCL2L2-      cacttgtgggacaagtgcaagagtggatggtggcctacctggagacacgg
A0A3Q7T511_BCL2L2-      cacttgtgggacaagtgcaagagtggatggtggcctacctggagacacgg
A0A3Q7T511_BCL2L2-      cagcggc----------caatcaccgagcgtcatatactcgcggatccgc
                        **   *           ***     **  **    ***  *  **  ** 

A0A3Q7T511_BCL2L2-      ctggccgactggatccacagcagtgggggctgggagctggaagcgatcaa
A0A3Q7T511_BCL2L2-      ctggccgactggatccacagcagtgggggctgggagctggaagcgatcaa
A0A3Q7T511_BCL2L2-      ctgg---------------------------aggagctggaagcgatcaa
                        ****                            ******************

A0A3Q7T511_BCL2L2-      agctcgagtcagggagatggaggaagaagctgagaagttaaaggagctac
A0A3Q7T511_BCL2L2-      agctcgagtcagggagatggaggaagaagctgagaagttaaaggagctac
A0A3Q7T511_BCL2L2-      agctcgagtcagggagatggaggaagaagctgagaagttaaaggagctac

A0A3Q7T511_BCL2L2-      agaacgaggtagagaaacagatgaatatgagtccacctccaggcaatgct
A0A3Q7T511_BCL2L2-      agaacgaggtagagaaacagatgaatatgagtccacctccaggcaatgct
A0A3Q7T511_BCL2L2-      agaacgaggtagagaaacagatgaatatgagtccacctccaggcaatgct

A0A3Q7T511_BCL2L2-      ggcccagtgatcatgtccattgaagagaagatggaggctgatgcccgttc
A0A3Q7T511_BCL2L2-      ggcccagtgatcatgtccattgaagagaagatggaggctgatgcccgttc
A0A3Q7T511_BCL2L2-      ggcccagtgatcatgtccattgaagagaagatggaggctgatgcccgttc

A0A3Q7T511_BCL2L2-      catttatgttggcaatgtggactatggtgcaacagcagaagagttggaag
A0A3Q7T511_BCL2L2-      catttatgttggcaatgtggactatggtgcaacagcagaagagttggaag
A0A3Q7T511_BCL2L2-      catttatgttggcaatgtggactatggtgcaacagcagaagagttggaag

A0A3Q7T511_BCL2L2-      cacactttcatggctgtggttcagtcaaccgtgttaccatactctgtgac
A0A3Q7T511_BCL2L2-      cacactttcatggctgtggttcagtcaaccgtgttaccatactctgtgac
A0A3Q7T511_BCL2L2-      cacactttcatggctgtggttcagtcaaccgtgttaccatactctgtgac

A0A3Q7T511_BCL2L2-      aaatttagtggccatcctaaaggttttgcatatatagagttctcagacaa
A0A3Q7T511_BCL2L2-      aaatttagtggccatcctaaaggttttgcatatatagagttctcagacaa
A0A3Q7T511_BCL2L2-      aaatttagtggccatcctaaaggttttgcatatatagagttctcagacaa

A0A3Q7T511_BCL2L2-      agagtcagtgaggacttccttggccttagatgagtcactatttagaggaa
A0A3Q7T511_BCL2L2-      agagtcagtgaggacttccttggccttagatgagtcactatttagaggaa
A0A3Q7T511_BCL2L2-      agagtcagtgaggacttccttggccttagatgagtcactatttagaggaa

A0A3Q7T511_BCL2L2-      gacaaatcaaggtgatcccaaaacgaaccaacagaccaggcatcagcaca
A0A3Q7T511_BCL2L2-      gacaaatcaaggtgatcccaaaacgaaccaacagaccaggcatcagcaca
A0A3Q7T511_BCL2L2-      gacaaatcaaggtgatcccaaaacgaaccaacagaccaggcatcagcaca

A0A3Q7T511_BCL2L2-      acagaccggggtttcccacgagcccgataccgtgcccggactaccaacta
A0A3Q7T511_BCL2L2-      acagaccggggtttcccacgagcccgataccgtgcccggactaccaacta
A0A3Q7T511_BCL2L2-      acagaccggggtttcccacgagcccgataccgtgcccggactaccaacta

A0A3Q7T511_BCL2L2-      caacagctcccgctctcgattctacagtggttttaacagcaggccccggg
A0A3Q7T511_BCL2L2-      caacagctcccgctctcgattctacagtggttttaacagcaggccccggg
A0A3Q7T511_BCL2L2-      caacagctcccgctctcgattctacagtggttttaacagcaggccccggg

A0A3Q7T511_BCL2L2-      gtcgcgtctacaggggccgggctagagcgacatcatggtattccccttac
A0A3Q7T511_BCL2L2-      gtcgcgtctacaggggccgggctagagcgacatcatggtattccccttac
A0A3Q7T511_BCL2L2-      gtcgcgtctacaggggccgggctagagcgacatcatggtattccccttac

A0A3Q7T511_BCL2L2-      taa
A0A3Q7T511_BCL2L2-      taa
A0A3Q7T511_BCL2L2-      taa

© 1998-2021Legal notice