Dataset for CDS BAK1 of Organism Felis catus

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A2I2UCZ8_BAK1-02      atggcatccgggcaaggcccaggtcctcccaggcaggagtgtgaagagac
A0A2I2UCZ8_BAK1-01      atggcatccgggcaaggcccaggtcctcccaggcaggagtgtgaagagac
A0A2I2UCZ8_BAK1-03      atggcatccgggcaaggcccaggtcctcccaggcaggagtgtgaagagac
                        **************************************************

A0A2I2UCZ8_BAK1-02      tgccccgtctgctacttctgaggagcaggtagcccgggacaccgaggagg
A0A2I2UCZ8_BAK1-01      tgccccgtctgctacttctgaggagcaggtagcccgggacaccgaggagg
A0A2I2UCZ8_BAK1-03      tgccccgtctgctacttctgaggagcaggtagcccgggacaccgaggagg
                        **************************************************

A0A2I2UCZ8_BAK1-02      ttttccgcagctatgtttttcaccgttatcagcaggagcaggaggctgag
A0A2I2UCZ8_BAK1-01      ttttccgcagctatgtttttcaccgttatcagcaggagcaggaggctgag
A0A2I2UCZ8_BAK1-03      ttttccgcagctatgtttttcaccgttatcagcaggagcaggaggctgag
                        **************************************************

A0A2I2UCZ8_BAK1-02      ggggcagctgcgcctactgacccagaaatagtcaccttgcccctagaacc
A0A2I2UCZ8_BAK1-01      ggggcagctgcgcctactgacccagaaatagtcaccttgcccctagaacc
A0A2I2UCZ8_BAK1-03      ggggcagctgcgcctactgacccagaaatagtcaccttgcccctagaacc
                        **************************************************

A0A2I2UCZ8_BAK1-02      tagcagcaccatggggcaggtgggtcggcagctcgccatcattggggaca
A0A2I2UCZ8_BAK1-01      tagcagcaccatggggcaggtgggtcggcagctcgccatcattggggaca
A0A2I2UCZ8_BAK1-03      tagcagcaccatggggcaggtgggtcggcagctcgccatcattggggaca
                        **************************************************

A0A2I2UCZ8_BAK1-02      acatcaaccagcgctacgattcagagttccaggccatgctgcagcgcctg
A0A2I2UCZ8_BAK1-01      acatcaaccagcgctacgattcagagttccaggccatgctgcagcgcctg
A0A2I2UCZ8_BAK1-03      acatcaaccagcgctacgattcagagttccaggccatgctgcagcgcctg
                        **************************************************

A0A2I2UCZ8_BAK1-02      caacccacagcagagaacgcctatgaacttttcaccaagattgcctcg--
A0A2I2UCZ8_BAK1-01      caacccacagcagagaacgcctatgaacttttcaccaagattgcctcg--
A0A2I2UCZ8_BAK1-03      caacccacagcagagaacgcctatgaacttttcaccaagattgcctcgag
                        ************************************************  

A0A2I2UCZ8_BAK1-02      ------------------agtctatttgagagcggcatcaactggggccg
A0A2I2UCZ8_BAK1-01      ------------------agtctatttgagagcggcatcaactggggccg
A0A2I2UCZ8_BAK1-03      gccagcagcaacacccacagtctatttgagagcggcatcaactggggccg
                                          ********************************

A0A2I2UCZ8_BAK1-02      agtggtggctctcctgggctttggctaccgcctggctctacacatctacc
A0A2I2UCZ8_BAK1-01      agtggtggctctcctgggctttggctaccgcctggctctacacatctacc
A0A2I2UCZ8_BAK1-03      agtggtggctctcctgggctttggctaccgcctggctctacacatctacc
                        **************************************************

A0A2I2UCZ8_BAK1-02      agcacggcctgaccggcttcctgggccaggtgaccaaactggtggtcgac
A0A2I2UCZ8_BAK1-01      agcacggcctgaccggcttcctgggccaggtgaccaaactggtggtcgac
A0A2I2UCZ8_BAK1-03      agcacggcctga--------------------------------------
                        ************                                      

A0A2I2UCZ8_BAK1-02      gtcatgctgcgtcactgcattgcccggtggattgcgcagaggggcggctg
A0A2I2UCZ8_BAK1-01      gtcatgctgcgtcactgcattgcccggtggattgcgcagaggggcggctg
A0A2I2UCZ8_BAK1-03      --------------------------------------------------
                                                                          

A0A2I2UCZ8_BAK1-02      --------------------------------------------------
A0A2I2UCZ8_BAK1-01      ggtaagtgcccaagcgtcggcagcctcctccccgctgctggggctgcctc
A0A2I2UCZ8_BAK1-03      --------------------------------------------------
                                                                          

A0A2I2UCZ8_BAK1-02      --------------------------------------------------
A0A2I2UCZ8_BAK1-01      tctcccagccccaccccggccctggagtgcctgtatgtgccgtcagcccc
A0A2I2UCZ8_BAK1-03      --------------------------------------------------
                                                                          

A0A2I2UCZ8_BAK1-02      --------------------ggtggcagccctgaacttgggaaatggccc
A0A2I2UCZ8_BAK1-01      tctatctctgtctcttggcaggtggcagccctgaacttgggaaatggccc
A0A2I2UCZ8_BAK1-03      --------------------------------------------------
                                                                          

A0A2I2UCZ8_BAK1-02      catcgtgaacgtgctgatagttctgtctgtggttctgttgggccagtttg
A0A2I2UCZ8_BAK1-01      catcgtgaacgtgctgatagttctgtctgtggttctgttgggccagtttg
A0A2I2UCZ8_BAK1-03      --------------------------------------------------
                                                                          

A0A2I2UCZ8_BAK1-02      tggtacgaagattcttcaaatcatga
A0A2I2UCZ8_BAK1-01      tggtacgaagattcttcaaatcatga
A0A2I2UCZ8_BAK1-03      --------------------------
                                                  

© 1998-2023Legal notice