Dataset for CDS BCL-2-like of organism Mus musculus

[Download (right click)] [Edit] [Sequences] [Repertoires]

29 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


Q9Z0F3_BCL2L10-01      atg----------gccgactcgcag-------------------------
O55178_BCL2A1-01       atg----------------gctgag-------------------------
Q0P538_BCL2A1-01       atg----------------gctgag-------------------------
Q07440_BCL2A1-01       atg----------------gctgag-------------------------
O55179_BCL2A1-01       atg----------------tctgag-------------------------
Q8K164_BCL2A1-01       atg----------------gctgag-------------------------
Q4FK02_BCL2A1-01       atg----------------tctgag-------------------------
O55177_BCL2A1-02       atg----------------gctgag-------------------------
Q497M6_BCL2A1-01       atg----------------gctgag-------------------------
P10417_BCL2-01         atg----------gcgcaagccgggagaacagggtat-------------
P10417_BCL2-02         atg----------gcgcaagccgggagaacagggtat-------------
Q6NTH7_BCL2-01         atg----------gcgcaagccgggagaacagggtat-------------
P97287_MCL1-01         atgtttggcctgcggagaaacgcggtcatcggcttgaacctgtactgcgg
P97287_MCL1-02         atgtttggcctgcggagaaacgcggtcatcggcttgaacctgtactgcgg
O35843_BCL2L1-01       atg----------------tctcag-------------------------
Q64373_BCL2L1-03       atg----------------tctcag-------------------------
Q64373_BCL2L1-04       atg----------------tctcag-------------------------
Q5HZH3_BCL2L1-02       atg----------------tctcag-------------------------
Q64373_BCL2L1-01       atg----------------tctcag-------------------------
Q64373_BCL2L1-05       atg----------------tctcag-------------------------
Q64373_BCL2L1-06       atg----------------tctcag-------------------------
Q64373_BCL2L1-07       atg----------------tctcag-------------------------
Q64373_BCL2L1-08       atg----------------tctcag-------------------------
Q64373_BCL2L1-09       atg----------------tctcag-------------------------
P70345_BCL2L2-01       atggcgaccccagcctcaaccccag-------------------------
P70345_BCL2L2-03       --------------------------------------------------
P70345_BCL2L2-04       atggcgaccccagcctcaaccccag-------------------------
D3Z5F7_BCL2L2-01       atggcgaccccagcctcaaccccag-------------------------
P70345_BCL2L2-05       atggcgaccccagcctcaaccccag-------------------------
                                                                         

Q9Z0F3_BCL2L10-01      --------------------------------------------------
O55178_BCL2A1-01       --------------------------------------------------
Q0P538_BCL2A1-01       --------------------------------------------------
Q07440_BCL2A1-01       --------------------------------------------------
O55179_BCL2A1-01       --------------------------------------------------
Q8K164_BCL2A1-01       --------------------------------------------------
Q4FK02_BCL2A1-01       --------------------------------------------------
O55177_BCL2A1-02       --------------------------------------------------
Q497M6_BCL2A1-01       --------------------------------------------------
P10417_BCL2-01         --------------------------------------------------
P10417_BCL2-02         --------------------------------------------------
Q6NTH7_BCL2-01         --------------------------------------------------
P97287_MCL1-01         cggcgccagcctcggcgcgggcggcggttctccggcaggggcgcgcctgg
P97287_MCL1-02         c-------------------------------------------------
O35843_BCL2L1-01       --------------------------------------------------
Q64373_BCL2L1-03       --------------------------------------------------
Q64373_BCL2L1-04       --------------------------------------------------
Q5HZH3_BCL2L1-02       --------------------------------------------------
Q64373_BCL2L1-01       --------------------------------------------------
Q64373_BCL2L1-05       --------------------------------------------------
Q64373_BCL2L1-06       --------------------------------------------------
Q64373_BCL2L1-07       --------------------------------------------------
Q64373_BCL2L1-08       --------------------------------------------------
Q64373_BCL2L1-09       --------------------------------------------------
P70345_BCL2L2-01       --------------------------------------------------
P70345_BCL2L2-03       --------------------------------------------------
P70345_BCL2L2-04       --------------------------------------------------
D3Z5F7_BCL2L2-01       --------------------------------------------------
P70345_BCL2L2-05       --------------------------------------------------
                                                                         

Q9Z0F3_BCL2L10-01      --------------------------------------------------
O55178_BCL2A1-01       --------------------------------------------------
Q0P538_BCL2A1-01       --------------------------------------------------
Q07440_BCL2A1-01       --------------------------------------------------
O55179_BCL2A1-01       --------------------------------------------------
Q8K164_BCL2A1-01       --------------------------------------------------
Q4FK02_BCL2A1-01       --------------------------------------------------
O55177_BCL2A1-02       --------------------------------------------------
Q497M6_BCL2A1-01       --------------------------------------------------
P10417_BCL2-01         --------------------------------------------------
P10417_BCL2-02         --------------------------------------------------
Q6NTH7_BCL2-01         --------------------------------------------------
P97287_MCL1-01         tggccgaggaggccaaggcgcggcgcgaggggggaggggaggccgccctg
P97287_MCL1-02         --------------------------------------------------
O35843_BCL2L1-01       --------------------------------------------------
Q64373_BCL2L1-03       --------------------------------------------------
Q64373_BCL2L1-04       --------------------------------------------------
Q5HZH3_BCL2L1-02       --------------------------------------------------
Q64373_BCL2L1-01       --------------------------------------------------
Q64373_BCL2L1-05       --------------------------------------------------
Q64373_BCL2L1-06       --------------------------------------------------
Q64373_BCL2L1-07       --------------------------------------------------
Q64373_BCL2L1-08       --------------------------------------------------
Q64373_BCL2L1-09       --------------------------------------------------
P70345_BCL2L2-01       --------------------------------------------------
P70345_BCL2L2-03       --------------------------------------------------
P70345_BCL2L2-04       --------------------------------------------------
D3Z5F7_BCL2L2-01       --------------------------------------------------
P70345_BCL2L2-05       --------------------------------------------------
                                                                         

Q9Z0F3_BCL2L10-01      --------------------------------------------------
O55178_BCL2A1-01       --------------------------------------------------
Q0P538_BCL2A1-01       --------------------------------------------------
Q07440_BCL2A1-01       --------------------------------------------------
O55179_BCL2A1-01       --------------------------------------------------
Q8K164_BCL2A1-01       --------------------------------------------------
Q4FK02_BCL2A1-01       --------------------------------------------------
O55177_BCL2A1-02       --------------------------------------------------
Q497M6_BCL2A1-01       --------------------------------------------------
P10417_BCL2-01         ---------------------------------------gataaccggga
P10417_BCL2-02         ---------------------------------------gataaccggga
Q6NTH7_BCL2-01         ---------------------------------------gataaccggga
P97287_MCL1-01         ctgcccggcgcgcgggtggtcgcccggccgccgcccgtgggcgccgagga
P97287_MCL1-02         ---------------------------------------ggcgccgagga
O35843_BCL2L1-01       ---------------------------------------agcaaccggga
Q64373_BCL2L1-03       ---------------------------------------agcaaccggga
Q64373_BCL2L1-04       ---------------------------------------agcaaccggga
Q5HZH3_BCL2L1-02       ---------------------------------------agcaaccggga
Q64373_BCL2L1-01       ---------------------------------------agcaaccggga
Q64373_BCL2L1-05       ---------------------------------------agcaaccggga
Q64373_BCL2L1-06       ---------------------------------------agcaaccggga
Q64373_BCL2L1-07       ---------------------------------------agcaaccggga
Q64373_BCL2L1-08       ---------------------------------------agcaaccggga
Q64373_BCL2L1-09       ---------------------------------------agcaaccggga
P70345_BCL2L2-01       ---------------------------------------a-cacacgggc
P70345_BCL2L2-03       --------------------------------------------------
P70345_BCL2L2-04       ---------------------------------------a-cacacgggc
D3Z5F7_BCL2L2-01       ---------------------------------------a-cacacgggc
P70345_BCL2L2-05       ---------------------------------------a-cacacgggc
                                                                         

Q9Z0F3_BCL2L10-01      -------------------------gacccactgcatgaacgc-------
O55178_BCL2A1-01       ----------------------tacgagctcatgcatatccactc-----
Q0P538_BCL2A1-01       ----------------------tacgagctcatgcatatccactc-----
Q07440_BCL2A1-01       ----------------------tctgagctcatgcatatccactc-----
O55179_BCL2A1-01       ----------------------tacgagttcatgtatatccactc-----
Q8K164_BCL2A1-01       ----------------------tacgagttcatgtatatccactc-----
Q4FK02_BCL2A1-01       ----------------------tacgagttcatgtatatccactc-----
O55177_BCL2A1-02       ----------------------tacgagttcatgtatatccactc-----
Q497M6_BCL2A1-01       ----------------------tacgagttcatgtatatccactc-----
P10417_BCL2-01         gatcgtgatgaagtacatacattataagctgtcacagaggggctacgagt
P10417_BCL2-02         gatcgtgatgaagtacatacattataagctgtcacagaggggctacgagt
Q6NTH7_BCL2-01         gatcgtgatgaagtacatacattataagctgtcacagaggggctacgagt
P97287_MCL1-01         ccccgacgtcaccgcgtcggccgaaaggcggctgcataagt----cg---
P97287_MCL1-02         ccccgacgtcaccgcgtcggccgaaaggcggctgcataagt----cg---
O35843_BCL2L1-01       gctggtggtcgactttctctcctacaagctttcccagaaaggataca---
Q64373_BCL2L1-03       gctggtggtcgactttctctcctacaagctttcccagaaaggataca---
Q64373_BCL2L1-04       gctggtggtcgactttctctcctacaagctttcccagaaaggataca---
Q5HZH3_BCL2L1-02       gctggtggtcgactttctctcctacaagctttcccagaaaggataca---
Q64373_BCL2L1-01       gctggtggtcgactttctctcctacaagctttcccagaaaggataca---
Q64373_BCL2L1-05       gctggtggtcgactttctctcctacaagctttcccagaaaggataca---
Q64373_BCL2L1-06       gctggtggtcgactttctctcctacaagctttcccagaaaggataca---
Q64373_BCL2L1-07       gctggtggtcgactttctctcctacaagctttcccagaaaggataca---
Q64373_BCL2L1-08       gctggtggtcgactttctctcctacaagctttcccagaaaggataca---
Q64373_BCL2L1-09       gctggtggtcgactttctctcctacaagctttcccagaaaggataca---
P70345_BCL2L2-01       tctagtggctgactttgtaggctataagctgaggcagaagggttatg---
P70345_BCL2L2-03       --------------------------------------------------
P70345_BCL2L2-04       tctagtggctgactttgtaggctataagctgaggcagaagggttatg---
D3Z5F7_BCL2L2-01       tctagtggctgactttgtaggctataagctgaggcagaagggttatg---
P70345_BCL2L2-05       tctagtggctgactttgtaggctataagctgaggcagaagggttatg---
                                                                         

Q9Z0F3_BCL2L10-01      --------------------------------------------------
O55178_BCL2A1-01       -----cctg-----------------------------------------
Q0P538_BCL2A1-01       -----cctg-----------------------------------------
Q07440_BCL2A1-01       -----cctg-----------------------------------------
O55179_BCL2A1-01       -----cctg-----------------------------------------
Q8K164_BCL2A1-01       -----cctg-----------------------------------------
Q4FK02_BCL2A1-01       -----cctg-----------------------------------------
O55177_BCL2A1-02       -----cctg-----------------------------------------
Q497M6_BCL2A1-01       -----cctg-----------------------------------------
P10417_BCL2-01         gggatgctggagatgcggacgcggcgcccctgggggctgcccc------c
P10417_BCL2-02         gggatgctggagatgcggacgcggcgcccctgggggctgcccc------c
Q6NTH7_BCL2-01         gggatgctggagatgcggacgcggcgcccctgggggctgcccc------c
P97287_MCL1-01         -----cccggcctcctcgccgtgccgcccgaggagatggccgcgtcggcc
P97287_MCL1-02         -----cccggcctcctcgccgtgccgcccgaggagatggccgcgtcggcc
O35843_BCL2L1-01       -----gctggagtcagtttagtgatgttgaagagaataggactgagg---
Q64373_BCL2L1-03       -----gctggagtcagtttagtgatgtcgaagagaataggactgagg---
Q64373_BCL2L1-04       -----gctggagtcagtttagtgatgtcgaagagaataggactgagg---
Q5HZH3_BCL2L1-02       -----gctggagtcagtttagtgatgtcgaagagaataggactgagg---
Q64373_BCL2L1-01       -----gctggagtcagtttagtgatgtcgaagagaataggactgagg---
Q64373_BCL2L1-05       -----gctggagtcagtttagtgatgtcgaagagaataggactgagg---
Q64373_BCL2L1-06       -----gctggagtcagtttagtgatgtcgaagagaataggactgagg---
Q64373_BCL2L1-07       -----gctggagtcagtttagtgatgtcgaagagaataggactgagg---
Q64373_BCL2L1-08       -----gctggagtcagtttagtgatgtcgaagagaataggactgagg---
Q64373_BCL2L1-09       -----gctggagtcagtttagtgatgtcgaagagaataggactgagg---
P70345_BCL2L2-01       -----tctg-----------------------------------------
P70345_BCL2L2-03       --------------------------------------------------
P70345_BCL2L2-04       -----tctg-----------------------------------------
D3Z5F7_BCL2L2-01       -----tctg-----------------------------------------
P70345_BCL2L2-05       -----tctg-----------------------------------------
                                                                         

Q9Z0F3_BCL2L10-01      -----------------------------actagacggctgctgtctg--
O55178_BCL2A1-01       -------------------------------------gctgagcacta--
Q0P538_BCL2A1-01       -------------------------------------gctgagcacta--
Q07440_BCL2A1-01       -------------------------------------gctgagcacta--
O55179_BCL2A1-01       -------------------------------------gctgagcacta--
Q8K164_BCL2A1-01       -------------------------------------gctgagcacta--
Q4FK02_BCL2A1-01       -------------------------------------gctgagcacta--
O55177_BCL2A1-02       -------------------------------------gctgagcacta--
Q497M6_BCL2A1-01       -------------------------------------gctgagcacta--
P10417_BCL2-01         acccctggcatcttctccttccag-------------cctgagagcaa--
P10417_BCL2-02         acccctggcatcttctccttccag-------------cctgagagcaa--
Q6NTH7_BCL2-01         acccctggcatcttctccttccag-------------cctgagagcaa--
P97287_MCL1-01         gccgccgccatcgtgtctccggaggaggaactggacggctgcgagccgga
P97287_MCL1-02         gccgccgccatcgtgtctccggaggaggaactggacggctgcgagccgga
O35843_BCL2L1-01       ------------------ccccagaagaaactgaa--gcagagagggaga
Q64373_BCL2L1-03       ------------------ccccagaagaaactgaa--gcagagagggaga
Q64373_BCL2L1-04       ------------------ccccagaagaaactgaa--gcagagagggaga
Q5HZH3_BCL2L1-02       ------------------ccccagaagaaactgaa--gcagagagggaga
Q64373_BCL2L1-01       ------------------ccccagaagaaactgaa--gcagagagggaga
Q64373_BCL2L1-05       ------------------ccccagaagaaactgaa--gcagagagggaga
Q64373_BCL2L1-06       ------------------ccccagaagaaactgaa--gcagagagggaga
Q64373_BCL2L1-07       ------------------ccccagaagaaactgaa--gcagagagggaga
Q64373_BCL2L1-08       ------------------ccccagaagaaactgaa--gcagagagggaga
Q64373_BCL2L1-09       ------------------ccccagaagaaactgaa--gcagagagggaga
P70345_BCL2L2-01       -------------------------------tgga--gctg---------
P70345_BCL2L2-03       --------------------------------------------------
P70345_BCL2L2-04       -------------------------------tgga--gctg---------
D3Z5F7_BCL2L2-01       -------------------------------tgga--gctg---------
P70345_BCL2L2-05       -------------------------------tgga--gctg---------
                                                                         

Q9Z0F3_BCL2L10-01      -----------actacatatt-----------cttctgcgcacgggagcc
O55178_BCL2A1-01       ------ccttcagtatgtgc------------tacaggtacccgcctttg
Q0P538_BCL2A1-01       ------ccttcagtatgtgc------------tacaggtacccgcctttg
Q07440_BCL2A1-01       ------ccttcagtatgtgc------------tacaggtacccgcctttg
O55179_BCL2A1-01       ------ccttcagtatgtgc------------tacaggtacccgcctttg
Q8K164_BCL2A1-01       ------tcttcagtatgtgc------------tacaggtacccgcctttg
Q4FK02_BCL2A1-01       ------tcttcagtatgtgc------------tacaggtacccgcctttg
O55177_BCL2A1-02       ------tcttcagtatgtgc------------tacaggtacccgcctttg
Q497M6_BCL2A1-01       ------tcttcagtatgtgc------------tacaggtacccgcctttg
P10417_BCL2-01         --------cccaatgcccgctgtg--------caccgggacatggctgcc
P10417_BCL2-02         --------cccaatgcccgctgtg--------caccgggacatggctgcc
Q6NTH7_BCL2-01         --------cccaatgcccgctgtg--------caccgggacatggctgcc
P97287_MCL1-01         ggccatcggcaagcgcccggccgtgctgcccctcctggagcgcgtgagcg
P97287_MCL1-02         ggccatcggcaagcgcccggccgtgctgcccctcctggagcgcgtgagcg
O35843_BCL2L1-01       ------cccccagtgccatcaatggcaacccatcctggcacctggcggat
Q64373_BCL2L1-03       ------cccccagtgccatcaatggcaacccatcctggcacctggcggat
Q64373_BCL2L1-04       ------cccccagtgccatcaatggcaacccatcctggcacctggcggat
Q5HZH3_BCL2L1-02       ------cccccagtgccatcaatggcaacccatcctggcacctggcggat
Q64373_BCL2L1-01       ------cccccagtgccatcaatggcaacccatcctggcacctggcggat
Q64373_BCL2L1-05       ------cccccagtgccatcaatggcaacccatcctggcacctggcggat
Q64373_BCL2L1-06       ------cccccagtgccatcaatggcaacccatcctggcacctggcggat
Q64373_BCL2L1-07       ------cccccagtgccatcaatggcaacccatcctggcacctggcggat
Q64373_BCL2L1-08       ------cccccagtgccatcaatggcaacccatcctggcacctggcggat
Q64373_BCL2L1-09       ------cccccagtgccatcaatggcaacccatcctggcacctggcggat
P70345_BCL2L2-01       ---------------------------------------gccctggggaa
P70345_BCL2L2-03       --------------------------------------------------
P70345_BCL2L2-04       ---------------------------------------gccctggggaa
D3Z5F7_BCL2L2-01       ---------------------------------------gccctggggaa
P70345_BCL2L2-05       ---------------------------------------gccctggggaa
                                                                         

Q9Z0F3_BCL2L10-01      gg------------------------acaccccag------------agc
O55178_BCL2A1-01       ag----------------------tcggctccaag--ccaagcattcag-
Q0P538_BCL2A1-01       ag----------------------tcggctccaag--ccaagcattcag-
Q07440_BCL2A1-01       ag----------------------tcggctccaag--ccaagcatgcag-
O55179_BCL2A1-01       ag----------------------tcggctccaag--ccaagcatgcag-
Q8K164_BCL2A1-01       ag----------------------tcggctccaag--ccaagcatgcag-
Q4FK02_BCL2A1-01       ag----------------------tcggctccaag--caaagcatgcag-
O55177_BCL2A1-02       ag----------------------tcggctccaag--ccaagcatgcag-
Q497M6_BCL2A1-01       ag----------------------tcggctccaag--caaagcatgcag-
P10417_BCL2-01         ag------------------gacgtctcctctcaggcccctcgttgccac
P10417_BCL2-02         ag------------------gacgtctcctctcaggcccctcgttgccac
Q6NTH7_BCL2-01         ag------------------gacgtctcctctcaggcccctcgttgccac
P97287_MCL1-01         aggcggccaagagctccggggccgacggctctctg--ccctccacgccgc
P97287_MCL1-02         aggcggccaagagctccggggccgacggctctctg--ccctccacgccgc
O35843_BCL2L1-01       ag----------------------------cccgg--ccgtgaatggagc
Q64373_BCL2L1-03       ag----------------------------cccgg--ccgtgaatggagc
Q64373_BCL2L1-04       ag----------------------------cccgg--ccgtgaatggagc
Q5HZH3_BCL2L1-02       ag----------------------------cccgg--ccgtgaatggagc
Q64373_BCL2L1-01       ag----------------------------cccgg--ccgtgaatggagc
Q64373_BCL2L1-05       ag----------------------------cccgg--ccgtgaatggagc
Q64373_BCL2L1-06       ag----------------------------cccgg--ccgtgaatggagc
Q64373_BCL2L1-07       ag----------------------------cccgg--ccgtgaatggagc
Q64373_BCL2L1-08       ag----------------------------cccgg--ccgtgaatggagc
Q64373_BCL2L1-09       ag----------------------------cccgg--ccgtgaatggagc
P70345_BCL2L2-01       gg----------------------------cccag--ccg----------
P70345_BCL2L2-03       --------------------------------------------------
P70345_BCL2L2-04       gg----------------------------cccag--ccg----------
D3Z5F7_BCL2L2-01       gg----------------------------cccag--ccg----------
P70345_BCL2L2-05       gg----------------------------cccag--ccg----------
                                                                         

Q9Z0F3_BCL2L10-01      caccgcccacg-----------------------------tctgtcgagg
O55178_BCL2A1-01       -------------------------------------agtgctacaaaga
Q0P538_BCL2A1-01       -------------------------------------agtgctacaaaga
Q07440_BCL2A1-01       -------------------------------------agtgctacaaaga
O55179_BCL2A1-01       -------------------------------------agtgctacaaaga
Q8K164_BCL2A1-01       -------------------------------------agtgctacaaaga
Q4FK02_BCL2A1-01       -------------------------------------agtgctacaaaga
O55177_BCL2A1-02       -------------------------------------agtgctacaaaga
Q497M6_BCL2A1-01       -------------------------------------agtgctacaaaga
P10417_BCL2-01         cgctgg----------------------------------gcctgcgctc
P10417_BCL2-02         cgctgg----------------------------------gcctgcgctc
Q6NTH7_BCL2-01         cgctgg----------------------------------gcctgcgctc
P97287_MCL1-01         cgccgcccgaggaggaagaggacgacctataccgccagtcgctggagatc
P97287_MCL1-02         cgccgcccgaggaggaagaggacgacctataccgccagtcgctggagatc
O35843_BCL2L1-01       cactggccacagcagcag-------------tttggatgcgcgggaggtg
Q64373_BCL2L1-03       cactggccacagcagcag-------------tttggatgcgcgggaggtg
Q64373_BCL2L1-04       cactggccacagcagcag-------------tttggatgcgcgggaggtg
Q5HZH3_BCL2L1-02       cactggccacagcagcag-------------tttggatgcgcgggaggtg
Q64373_BCL2L1-01       cactggccacagcagcag-------------tttggatgcgcgggaggtg
Q64373_BCL2L1-05       cactggccacagcagcag-------------tttggatgcgcgggaggtg
Q64373_BCL2L1-06       cactggccacagcagcag-------------tttggatgcgcgggaggtg
Q64373_BCL2L1-07       cactggccacagcagcag-------------tttggatgcgcgggaggtg
Q64373_BCL2L1-08       cactggccacagcagcag-------------tttggatgcgcgg------
Q64373_BCL2L1-09       cactggccacagcagcag-------------tttggatgcgcgggaggtg
P70345_BCL2L2-01       --ccgacc------------------------------------------
P70345_BCL2L2-03       --------------------------------------------------
P70345_BCL2L2-04       --ccgacc------------------------------------------
D3Z5F7_BCL2L2-01       --ccgacc------------------------------------------
P70345_BCL2L2-05       --ccgacc------------------------------------------
                                                                         

Q9Z0F3_BCL2L10-01      cggccttgcttcgctctgtga-----------------------------
O55178_BCL2A1-01       gttgctttctccgttcagaaggaagtt-----------------------
Q0P538_BCL2A1-01       gttgctttctccgttcagaaggaagtt-----------------------
Q07440_BCL2A1-01       gttgctttctccgttcagaaggaagtt-----------------------
O55179_BCL2A1-01       gttgctttctccgttcagaaggaagtt-----------------------
Q8K164_BCL2A1-01       gttgctttctccgttcagaaggaagtt-----------------------
Q4FK02_BCL2A1-01       gttgctttctccgttcagaaggaagtt-----------------------
O55177_BCL2A1-02       gttgctttctccgttcagaaggaagtt-----------------------
Q497M6_BCL2A1-01       gttgctttctccgttcagaaggaagtt-----------------------
P10417_BCL2-01         agccctgtgccacctgtggtccatctgacc--------------------
P10417_BCL2-02         agccctgtgccacctgtggtccatctgacc--------------------
Q6NTH7_BCL2-01         agccctgtgccacctgtggtccatctgacc--------------------
P97287_MCL1-01         atctcgcgctacttgcgggagcaggcgaccggctccaaggactcgaagcc
P97287_MCL1-02         atctcgcgctacttgcgggagcaggcgaccggctccaaggactcgaagcc
O35843_BCL2L1-01       attcccatggcagcagtgaagcaagcg-----------------------
Q64373_BCL2L1-03       attcccatggcagcagtgaagcaagcg-----------------------
Q64373_BCL2L1-04       attcccatggcagcagtgaagcaagcg-----------------------
Q5HZH3_BCL2L1-02       attcccatggcagcagtgaagcaagcg-----------------------
Q64373_BCL2L1-01       attcccatggcagcagtgaagcaagcg-----------------------
Q64373_BCL2L1-05       attcccatggcagcagtgaagcaagcg-----------------------
Q64373_BCL2L1-06       attcccatggcagcagtgaagcaagcg-----------------------
Q64373_BCL2L1-07       attcccatggcagcagtgaagcaagcg-----------------------
Q64373_BCL2L1-08       --------------------------------------------------
Q64373_BCL2L1-09       attcccatggcagcagtgaagcaagcg-----------------------
P70345_BCL2L2-01       -------------cgctgcaccaagcc-----------------------
P70345_BCL2L2-03       --------------------------------------------------
P70345_BCL2L2-04       -------------cgctgcaccaagcc-----------------------
D3Z5F7_BCL2L2-01       -------------cgctgcaccaagcc-----------------------
P70345_BCL2L2-05       -------------cgctgcaccaagcc-----------------------
                                                                         

Q9Z0F3_BCL2L10-01      -ctaggcagatccagcaggagcaccaagaatttttttcct------cctt
O55178_BCL2A1-01       ----------------ggaaagaacctaaagtc--atacttggatgactt
Q0P538_BCL2A1-01       ----------------ggaaagaacctaaagtc--atacttggatgactt
Q07440_BCL2A1-01       ----------------gaaaagaatctgaagtc--atacttggatgactt
O55179_BCL2A1-01       ----------------gaaaagaatctgaagtc--atacttggatgactt
Q8K164_BCL2A1-01       ----------------gaaaagaatctgaagtc--atacttggatgactt
Q4FK02_BCL2A1-01       ----------------gaaaagaatctgaagtc--atacttggatgactt
O55177_BCL2A1-02       ----------------gaaaagaatctgaagtc--atacttggatgactt
Q497M6_BCL2A1-01       ----------------gaaaagaatctgaagtc--atacttggatgactt
P10417_BCL2-01         -ctccgccgggctg--gggatgacttctctcgtcgctaccgtcgtgactt
P10417_BCL2-02         -ctccgccgggctg--gggatgacttctctcgtcgctaccgtcgtgactt
Q6NTH7_BCL2-01         -ctccgccgggctg--gggatgacttctctcgtcgctaccgtcgtgactt
P97287_MCL1-01         tctgggcgaggcgggcgcggcgggccggaga----gcgctggagaccctg
P97287_MCL1-02         tctgggcgaggcgggcgcggcgggccggaga----gcgctggagaccctg
O35843_BCL2L1-01       -ctgagagaggcag--gcgatgagtttgaactgcggtaccggagagcgtt
Q64373_BCL2L1-03       -ctgagagaggcag--gcgatgagtttgaactgcggtaccggagagcgtt
Q64373_BCL2L1-04       -ctgagagaggcag--gcgatgagtttgaactgcggtaccggagagcgtt
Q5HZH3_BCL2L1-02       -ctgagagaggcag--gcgatgagtttgaactgcggtaccggagagcgtt
Q64373_BCL2L1-01       -ctgagagaggcag--gcgatgagtttgaactgcggtaccggagagcgtt
Q64373_BCL2L1-05       -ctgagagaggcag--gcgatgagtttgaactgcggtaccggagagcgtt
Q64373_BCL2L1-06       -ctgagagaggcag--gcgatgagtttgaactgcggtaccggagagcgtt
Q64373_BCL2L1-07       -ctgagagaggcag--gcgatgagtt------------------------
Q64373_BCL2L1-08       --------------------------------------------------
Q64373_BCL2L1-09       -ctgagagaggcag--gcgatgagtttgaactgcggtaccggagagcgtt
P70345_BCL2L2-01       -atgcgggctgctg--gagacgagtttgagacccgtttccgccgcacctt
P70345_BCL2L2-03       --------------------------------------------------
P70345_BCL2L2-04       -atgcgggctgctg--gagacgagtttgagacccgtttccgccgcacctt
D3Z5F7_BCL2L2-01       -atgcgggctgctg--gagacgagtttgagacccgtttccgccgcacctt
P70345_BCL2L2-05       -atgcgggctgctg--gagacgagtttgagacccgtttccgccgcacctt
                                                                         

Q9Z0F3_BCL2L10-01      c-----------------------tgcgaaagccggggcaatcgcctgga
O55178_BCL2A1-01       t---------------------cacgtggaatccatagataccaccagaa
Q0P538_BCL2A1-01       t---------------------cacgtggaatccatagataccaccagaa
Q07440_BCL2A1-01       t---------------------cacgtggaatccatagataccgccagaa
O55179_BCL2A1-01       t---------------------cacgtggaatccatagataccgccagaa
Q8K164_BCL2A1-01       t---------------------cacgtggaatccatagataccgccagaa
Q4FK02_BCL2A1-01       t---------------------cacgtggaatccatagataccgccagaa
O55177_BCL2A1-02       t---------------------cacgtggaatccatagataccgccagaa
Q497M6_BCL2A1-01       t---------------------cacgtggaatccatagataccgccagaa
P10417_BCL2-01         cgcagagatgtccagtcagctgcacctga---cgcccttcaccgcgaggg
P10417_BCL2-02         cgcagagatgtccagtcagctgcacctga---cgcccttcaccgcgaggg
Q6NTH7_BCL2-01         cgcagagatgtccagtcagctgcacctga---cgcccttcaccgcgaggg
P97287_MCL1-01         cggcgcgtgggcgacggcgtgcagcgcaa---ccac-gagacggccttcc
P97287_MCL1-02         cggcgcgtgggcgacggcgtgcagcgcaa---ccac-gagacggccttcc
O35843_BCL2L1-01       cagtgatctaacatcccagcttcacataa---ccccagggaccgcgtatc
Q64373_BCL2L1-03       cagtgatctaacatcccagcttcacataa---ccccagggaccgcgtatc
Q64373_BCL2L1-04       cagtgatctaacatcccagcttcacataa---ccccagggaccgcgtatc
Q5HZH3_BCL2L1-02       cagtgatctaacatcccagcttcacataa---ccccagggaccgcgtatc
Q64373_BCL2L1-01       cagtgatctaacatcccagcttcacataa---ccccagggaccgcgtatc
Q64373_BCL2L1-05       cagtgatctaacatcccagcttcacataa---ccccagggaccgcgtatc
Q64373_BCL2L1-06       cagtgatctaacatcccagcttcacataa---ccccagggaccgcgtatc
Q64373_BCL2L1-07       --------------------------------------------------
Q64373_BCL2L1-08       --------------------------------------------------
Q64373_BCL2L1-09       cagtgatctaacatcccagcttcacataa---ccccagggaccgcgtatc
P70345_BCL2L2-01       ctctgacctggccgctcagctacacgtga---ccccaggctcagcccagc
P70345_BCL2L2-03       --------------------------------------------------
P70345_BCL2L2-04       ctctgacctggccgctcagctacacgtga---ccccaggctcagcccagc
D3Z5F7_BCL2L2-01       ctctgacctggccgctcagctacacgtga---ccccaggctcagcccagc
P70345_BCL2L2-05       ctctgacctggccgctcagctacacgtga---ccccaggctcagcccagc
                                                                         

Q9Z0F3_BCL2L10-01      gctgg---------------------------------------------
O55178_BCL2A1-01       taata---------------------------------------------
Q0P538_BCL2A1-01       taata---------------------------------------------
Q07440_BCL2A1-01       taata---------------------------------------------
O55179_BCL2A1-01       taata---------------------------------------------
Q8K164_BCL2A1-01       taata---------------------------------------------
Q4FK02_BCL2A1-01       taata---------------------------------------------
O55177_BCL2A1-02       taata---------------------------------------------
Q497M6_BCL2A1-01       taata---------------------------------------------
P10417_BCL2-01         gacgc---------------------------------------------
P10417_BCL2-02         gacgc---------------------------------------------
Q6NTH7_BCL2-01         gacgc---------------------------------------------
P97287_MCL1-01         agggcatgctccggaaactggacattaaaaacgaaggcgatgttaaatct
P97287_MCL1-02         agggcatgctccggaaactggacattaaaaacgaaggcgatgttaaatct
O35843_BCL2L1-01       agagc---------------------------------------------
Q64373_BCL2L1-03       agagc---------------------------------------------
Q64373_BCL2L1-04       agagc---------------------------------------------
Q5HZH3_BCL2L1-02       agagc---------------------------------------------
Q64373_BCL2L1-01       agagc---------------------------------------------
Q64373_BCL2L1-05       agagc---------------------------------------------
Q64373_BCL2L1-06       agagc---------------------------------------------
Q64373_BCL2L1-07       --------------------------------------------------
Q64373_BCL2L1-08       --------------------------------------------------
Q64373_BCL2L1-09       agagc---------------------------------------------
P70345_BCL2L2-01       aacgc---------------------------------------------
P70345_BCL2L2-03       --------------------------------------------------
P70345_BCL2L2-04       aacgc---------------------------------------------
D3Z5F7_BCL2L2-01       aacgc---------------------------------------------
P70345_BCL2L2-05       aacgc---------------------------------------------
                                                                         

Q9Z0F3_BCL2L10-01      -tgaaacagatggcagataagttgctctccaaagaccaagacttcagctg
O55178_BCL2A1-01       ttcaaccaagtgatggaaaa---agagtttgaagatggcatcattaattg
Q0P538_BCL2A1-01       ttcaaccaagtgatggaaaa---agagtttgaaaatggcatcattaattg
Q07440_BCL2A1-01       ttcaaccaagtgatggaaaa---agagtttgaagatggcatcattaactg
O55179_BCL2A1-01       ttcaaccaagtgatggaaaa---agagtttgaagatggcatcattaactg
Q8K164_BCL2A1-01       ttcaaccaagtgatggaaaa---agagtttgaagatggcatcattaactg
Q4FK02_BCL2A1-01       ttcaaccaagtgatggaaaa---agagtttgaagatggcatcattaactg
O55177_BCL2A1-02       ttcaaccaagtgatggaaaa---agagtttgaagatggcatcattaactg
Q497M6_BCL2A1-01       ttcaaccaagtgatggaaaa---agagtttgaagatggcatcattaactg
P10417_BCL2-01         tttgccacggtggtggagga---actcttcagggatgggg---tgaactg
P10417_BCL2-02         tttgccacggtggtggagga---actcttcagggatgggg---tgaactg
Q6NTH7_BCL2-01         tttgccacggtggtggagga---actcttcagggatgggg---tgaactg
P97287_MCL1-01         ttttctcgagtaatggtcca---tgttttcaaagatggcgtaacaaactg
P97287_MCL1-02         ttttctcgagtaatggtcca---tgttttcaaagatggcgtaacaaactg
O35843_BCL2L1-01       tttgagcaggtagtgaatga---actctttcgggatggag---taaactg
Q64373_BCL2L1-03       tttgagcaggtagtgaatga---actctttcgggatggag---taaactg
Q64373_BCL2L1-04       tttgagcaggtagtgaatga---actctttcgggatggag---taaactg
Q5HZH3_BCL2L1-02       tttgagcaggtagtgaatga---actctttcgggatggag---taaactg
Q64373_BCL2L1-01       tttgagcaggtagtgaatga---actctttcgggatggag---taaactg
Q64373_BCL2L1-05       tttgagcaggtagtgaatga---actctttcgggatggag---taaactg
Q64373_BCL2L1-06       tttgagcaggtagtgaatga---actctttcgggatggag---taaactg
Q64373_BCL2L1-07       --------------------------------------------------
Q64373_BCL2L1-08       --------------------------------------------------
Q64373_BCL2L1-09       tttgagcaggtagtgaatga---actctttcgggatggag---taaactg
P70345_BCL2L2-01       ttcacccaggtttccgacga---acttttccaagggggcc---ctaactg
P70345_BCL2L2-03       --------------------------------------------------
P70345_BCL2L2-04       ttcacccaggtttccgacga---acttttccaagggggcc---ctaactg
D3Z5F7_BCL2L2-01       ttcacccaggtttccgacga---acttttccaagggggcc---ctaactg
P70345_BCL2L2-05       ttcacccaggtttccgacga---acttttccaagggggcc---ctaactg
                                                                         

Q9Z0F3_BCL2L10-01      gagccaactggtgatgctcctggccttcgcggg------gacgcttatga
O55178_BCL2A1-01       gggaaggattgtgactatatttgcctttggggg------tgt-tctcctc
Q0P538_BCL2A1-01       gggaaggattgtgactatatttgcctttggggg------tgt-tctcctc
Q07440_BCL2A1-01       gggaaggattgtgactatatttgcctttggggg------tgt-tctcctc
O55179_BCL2A1-01       gggaaggattgtgactatatttgcctttggggg------tgt-tctcctc
Q8K164_BCL2A1-01       gggaaggattgtgactatatttgcctttggggg------tgt-tctcctc
Q4FK02_BCL2A1-01       gggaaggattgtgactatatttgcctttggggg------tgt-tctcctc
O55177_BCL2A1-02       gggaaggattgtgactatatttgcctttggggg------tgt-tctcctc
Q497M6_BCL2A1-01       gggaaggattgtgactatatttgcctttggggg------tgt-tctcctc
P10417_BCL2-01         ggggaggattgtggccttctttgagttcggtgg------ggt-catgtgt
P10417_BCL2-02         ggggaggattgtggccttctttgagttcggtgg------ggt-catgtgt
Q6NTH7_BCL2-01         ggggaggattgtggccttctttgagttcggtgg------ggt-catgtgt
P97287_MCL1-01         gggcaggattgtgactcttatttctttcggtgcctttgtggc-caaacac
P97287_MCL1-02         gggcaggattgtgactcttatttctttcggtgcctttgtggc-caaacac
O35843_BCL2L1-01       gggtcgcatcgtggcctttttctcctttggcgg------ggc-actgtgc
Q64373_BCL2L1-03       gggtcgcatcgtggcctttttctcctttggcgg------ggc-actgtgc
Q64373_BCL2L1-04       gggtcgcatcgtggcctttttctcctttggcgg------ggc-actgtgc
Q5HZH3_BCL2L1-02       gggtcgcatcgtggcctttttctcctttggcgg------ggc-actgtgc
Q64373_BCL2L1-01       gggtcgcatcgtggcctttttctcctttggcgg------ggc-actgtgc
Q64373_BCL2L1-05       gggtcgcatcgtggcctttttctcctttggcgg------ggc-actgtgc
Q64373_BCL2L1-06       gggtcgcatcgtggcctttttctcctttggcgg------ggc-actgtgc
Q64373_BCL2L1-07       --------------------------------------------------
Q64373_BCL2L1-08       --------------------------------------------------
Q64373_BCL2L1-09       gggtcgcatcgtggcctttttctcctttggcgg------ggc-actgtgc
P70345_BCL2L2-01       gggccgtcttgtggcattctttgtctttggggc------tgc-cctgtgt
P70345_BCL2L2-03       --------------------------------------------------
P70345_BCL2L2-04       gggccgtcttgtggcattctttgtctttggggc------tgc-cctgtgt
D3Z5F7_BCL2L2-01       gggccgtcttgtggcattctttgtctttggggc------tgc-cctgtgt
P70345_BCL2L2-05       gggccgtcttgtggcattctttgtctttggggc------tgc-cctgtgt
                                                                         

Q9Z0F3_BCL2L10-01      atcaaggcccttacatggctgtcaagcag------aagagggatctgggg
O55178_BCL2A1-01       aaaaaaacttccacaagag---cagattgccctggatgtacgtgcttaca
Q0P538_BCL2A1-01       aaaaaaacttccacaagag---cagattgccctggatgtacgtgcttaca
Q07440_BCL2A1-01       -aaaaaacttccacaagag---cagattgccctggatgtatgtgcttaca
O55179_BCL2A1-01       -aaaaaacttccacaagag---cagattgccctggatgtaggtgcttaca
Q8K164_BCL2A1-01       -aaaaaacttccgcaagag---cagattgccctggatgtaggtgcttaca
Q4FK02_BCL2A1-01       -aaaaaacttccgcaagag---cagattgccctggatgtaggtgcttaca
O55177_BCL2A1-02       -aaaaaacttccgcaagag---cagattgccctggatgtaggtgcttaca
Q497M6_BCL2A1-01       -aaaaaacttccgcaagag---cagattgccctggatgtaggtgcttaca
P10417_BCL2-01         gtggaga-----gcgtcaa---cagggag------atgtcacccctggtg
P10417_BCL2-02         gtggaga-----gcgtcaa---cagggag------atgtcacccctggtg
Q6NTH7_BCL2-01         gtggaga-----gcgtcaa---cagggag------atgtcacccctggtg
P97287_MCL1-01         ttaaaga-----gcgtaaa---ccaagaaagcttcatcgaaccattagca
P97287_MCL1-02         ttaaaga-----gcgtaaa---ccaagaaagcttcatcgaaccattagca
O35843_BCL2L1-01       gtggaaa-----gcgtaga---caaggag------atgcaggtattggtg
Q64373_BCL2L1-03       gtggaaa-----gcgtaga---caaggag------atgcaggtattggtg
Q64373_BCL2L1-04       gtggaaa-----gcgtaga---caaggag------atgcaggtattggtg
Q5HZH3_BCL2L1-02       gtggaaa-----gcgtaga---caaggag------atgcaggtattggtg
Q64373_BCL2L1-01       gtggaaa-----gcgtaga---caaggag------atgcaggtattggtg
Q64373_BCL2L1-05       gtggaaa-----gcgtaga---caaggag------atgcaggtattggtg
Q64373_BCL2L1-06       gtggaaa-----gc------------------------------------
Q64373_BCL2L1-07       --------------------------------------------------
Q64373_BCL2L1-08       --------------------------------------------------
Q64373_BCL2L1-09       gtggaaa-----gcgtaga---caaggag------atgcaggtattggtg
P70345_BCL2L2-01       gctgaga-----gtgtcaa---caaagaa------atggagcctttggtg
P70345_BCL2L2-03       -----------------------------------atggagcctttggtg
P70345_BCL2L2-04       gctgaga-----gtgtcaa---caaagaa------atggagcctttggtg
D3Z5F7_BCL2L2-01       gctgaga-----gtgtcaa---caaagaa------atggagcctttggtg
P70345_BCL2L2-05       gctgaga-----gtgtcaa---caaagaa------atggagcct------
                                                                         

Q9Z0F3_BCL2L10-01      aatcgtgtcatagtgacccgagactgctgtctcatagtgaactttctgta
O55178_BCL2A1-01       aacaagtttccagt---------------tttg-gggcagaattcataat
Q0P538_BCL2A1-01       aacaagtttccagt---------------tttg-gggcagaattcatcat
Q07440_BCL2A1-01       aacaagtttccagt---------------tttg-tggcagaattcataat
O55179_BCL2A1-01       aacaagtttccagt---------------tttg-tggcagaattcataat
Q8K164_BCL2A1-01       aacaagtttccagt---------------tttg-tggcagaattcataat
Q4FK02_BCL2A1-01       aacaagtttccagt---------------tttg-tggcagaattcataat
O55177_BCL2A1-02       aacaagtttccagt---------------tttg-tggcagaattcataat
Q497M6_BCL2A1-01       aacaagtttccagt---------------tttg-tggcagaattcataat
P10417_BCL2-01         gacaacatcgccct---------------gtggatgactgagtacctgaa
P10417_BCL2-02         gacaacatcgccct---------------gtggatgactgagtacctgaa
Q6NTH7_BCL2-01         gacaacatcgccct---------------gtggatgactgagtacctgaa
P97287_MCL1-01         gaaactatcacaga---------------t---------gttcttgtaag
P97287_MCL1-02         gaaactatcacaga---------------t---------gttcttgtaag
O35843_BCL2L1-01       agtcggattgcaag---------------ttggatggccacctatctgaa
Q64373_BCL2L1-03       agtcggattgcaag---------------ttggatggccacctatctgaa
Q64373_BCL2L1-04       agtcggattgcaag---------------ttggatggccacctatctgaa
Q5HZH3_BCL2L1-02       agtcggattgcaag---------------ttggatggccacctatctgaa
Q64373_BCL2L1-01       agtcggattgcaag---------------ttggatggccacctatctgaa
Q64373_BCL2L1-05       agtcggattgcaag---------------ttggatggccacctatctgaa
Q64373_BCL2L1-06       --------------------------------------------------
Q64373_BCL2L1-07       --------------------------------------------------
Q64373_BCL2L1-08       --------------------------------------------------
Q64373_BCL2L1-09       agtcggattgcaag---------------ttggatggccacctatctgaa
P70345_BCL2L2-01       ggacaagtgcagga---------------ttggatggtggcctacctgga
P70345_BCL2L2-03       ggacaagtgcagga---------------ttggatggtggcctacctgga
P70345_BCL2L2-04       ggacaagtgcagga---------------ttggatggtggcctacctgga
D3Z5F7_BCL2L2-01       ggacaagtgcagga---------------ttggatggtggcctacctgga
P70345_BCL2L2-05       --------------------------------------------------
                                                                         

Q9Z0F3_BCL2L10-01      taatctgctcatggggcgtcggcaccgcgccaggctggaggctctcggcg
O55178_BCL2A1-01       gaataa--------------------------------------------
Q0P538_BCL2A1-01       gaataa--------------------------------------------
Q07440_BCL2A1-01       gaataacacag---------------gagaatggatacggcagaatggag
O55179_BCL2A1-01       gaataacacag---------------gagaatggatacggcggaatggag
Q8K164_BCL2A1-01       caataacacag---------------gagaatggatacggcggaatggag
Q4FK02_BCL2A1-01       caataacacag---------------gagaatggatacggcggaatggag
O55177_BCL2A1-02       caataacacag---------------gagaatggatacggcggaatggag
Q497M6_BCL2A1-01       caataacacag---------------gagaatggatacggcggaatggag
P10417_BCL2-01         ccggcatctgc---------------acacctggatccaggataacggag
P10417_BCL2-02         ccggcatctgc---------------acacctggatccaggataacggag
Q6NTH7_BCL2-01         ccggcatctgc---------------acacctggatccaggataacggag
P97287_MCL1-01         gacgaaacggg------------------actggcttgtcaaacaaagag
P97287_MCL1-02         gacgaaacggg------------------actggcttgtcaaacaaagag
O35843_BCL2L1-01       tgaccacctag---------------agccttggatccaggagaacggcg
Q64373_BCL2L1-03       tgaccacctag---------------agccttggatccaggagaacggcg
Q64373_BCL2L1-04       tgaccacctag---------------agccttggatccaggagaacggcg
Q5HZH3_BCL2L1-02       tgaccacctag---------------agccttggatccaggagaacggcg
Q64373_BCL2L1-01       tgaccacctag---------------agccttggatccaggagaacggcg
Q64373_BCL2L1-05       tgaccacctag---------------agccttggatccaggagaacggcg
Q64373_BCL2L1-06       --------------------------------------------------
Q64373_BCL2L1-07       --------------------------------------------------
Q64373_BCL2L1-08       --------------------------------------------------
Q64373_BCL2L1-09       tgaccacctag---------------agccttggatccaggagaacggcg
P70345_BCL2L2-01       gacacgtctgg---------------ctgactggatccacagcagtgggg
P70345_BCL2L2-03       gacacgtctgg---------------ctgactggatccacagcagtgggg
P70345_BCL2L2-04       gacacgtctgg---------------ctgactggatccacagcagtgggg
D3Z5F7_BCL2L2-01       gacacgtctgg---------------ctgactggatccacagcagtgggg
P70345_BCL2L2-05       --------------------------------------------------
                                                                         

Q9Z0F3_BCL2L10-01      gctggg--------------------------------------------
O55178_BCL2A1-01       --------------------------------------------------
Q0P538_BCL2A1-01       --------------------------------------------------
Q07440_BCL2A1-01       gttggg--------------------------------------------
O55179_BCL2A1-01       gttggg--------------------------------------------
Q8K164_BCL2A1-01       gttggg--------------------------------------------
Q4FK02_BCL2A1-01       gttggg--------------------------------------------
O55177_BCL2A1-02       gttggg--------------------------------------------
Q497M6_BCL2A1-01       gttggg--------------------------------------------
P10417_BCL2-01         gctggg--------------------------------------------
P10417_BCL2-02         gctggg--------------------------------------------
Q6NTH7_BCL2-01         gctggg--------------------------------------------
P97287_MCL1-01         gctggg--------------------------------------------
P97287_MCL1-02         gctggg--------------------------------------------
O35843_BCL2L1-01       gctggg--------------------------------------------
Q64373_BCL2L1-03       gctggg--------------------------------------------
Q64373_BCL2L1-04       gctggg--------------------------------------------
Q5HZH3_BCL2L1-02       gctggg--------------------------------------------
Q64373_BCL2L1-01       gctggg--------------------------------------------
Q64373_BCL2L1-05       gctgg---------------------------------------------
Q64373_BCL2L1-06       --------------------------------------------------
Q64373_BCL2L1-07       --------------------------------------------------
Q64373_BCL2L1-08       --------------------------------------------------
Q64373_BCL2L1-09       gctggg--------------------------------------------
P70345_BCL2L2-01       gctggg--------------------------------------------
P70345_BCL2L2-03       gctggg--------------------------------------------
P70345_BCL2L2-04       gctggg--------------------------------------------
D3Z5F7_BCL2L2-01       gctgggagctagaagcgatcaaagctcgagtcagggagatggaggaagag
P70345_BCL2L2-05       --------------------------------------------------
                                                                         

Q9Z0F3_BCL2L10-01      --------------------------------------------------
O55178_BCL2A1-01       --------------------------------------------------
Q0P538_BCL2A1-01       --------------------------------------------------
Q07440_BCL2A1-01       --------------------------------------------------
O55179_BCL2A1-01       --------------------------------------------------
Q8K164_BCL2A1-01       --------------------------------------------------
Q4FK02_BCL2A1-01       --------------------------------------------------
O55177_BCL2A1-02       --------------------------------------------------
Q497M6_BCL2A1-01       --------------------------------------------------
P10417_BCL2-01         --------------------------------------------------
P10417_BCL2-02         --------------------------------------------------
Q6NTH7_BCL2-01         --------------------------------------------------
P97287_MCL1-01         --------------------------------------------------
P97287_MCL1-02         --------------------------------------------------
O35843_BCL2L1-01       --------------------------------------------------
Q64373_BCL2L1-03       --------------------------------------------------
Q64373_BCL2L1-04       --------------------------------------------------
Q5HZH3_BCL2L1-02       --------------------------------------------------
Q64373_BCL2L1-01       --------------------------------------------------
Q64373_BCL2L1-05       --------------------------------------------------
Q64373_BCL2L1-06       --------------------------------------------------
Q64373_BCL2L1-07       --------------------------------------------------
Q64373_BCL2L1-08       --------------------------------------------------
Q64373_BCL2L1-09       --------------------------------------------------
P70345_BCL2L2-01       --------------------------------------------------
P70345_BCL2L2-03       --------------------------------------------------
P70345_BCL2L2-04       --------------------------------------------------
D3Z5F7_BCL2L2-01       gctgagaagctaaaggagctacaaaacgaggtagagaagcagatgaatat
P70345_BCL2L2-05       --------------------------------------------------
                                                                         

Q9Z0F3_BCL2L10-01      --------------------------------------------------
O55178_BCL2A1-01       --------------------------------------------------
Q0P538_BCL2A1-01       --------------------------------------------------
Q07440_BCL2A1-01       --------------------------------------------------
O55179_BCL2A1-01       --------------------------------------------------
Q8K164_BCL2A1-01       --------------------------------------------------
Q4FK02_BCL2A1-01       --------------------------------------------------
O55177_BCL2A1-02       --------------------------------------------------
Q497M6_BCL2A1-01       --------------------------------------------------
P10417_BCL2-01         --------------------------------------------------
P10417_BCL2-02         --------------------------------------------------
Q6NTH7_BCL2-01         --------------------------------------------------
P97287_MCL1-01         --------------------------------------------------
P97287_MCL1-02         --------------------------------------------------
O35843_BCL2L1-01       --------------------------------------------------
Q64373_BCL2L1-03       --------------------------------------------------
Q64373_BCL2L1-04       --------------------------------------------------
Q5HZH3_BCL2L1-02       --------------------------------------------------
Q64373_BCL2L1-01       --------------------------------------------------
Q64373_BCL2L1-05       --------------------------------------------------
Q64373_BCL2L1-06       --------------------------------------------------
Q64373_BCL2L1-07       --------------------------------------------------
Q64373_BCL2L1-08       --------------------------------------------------
Q64373_BCL2L1-09       --------------------------------------------------
P70345_BCL2L2-01       -----------------------------------------------cgg
P70345_BCL2L2-03       -----------------------------------------------cgg
P70345_BCL2L2-04       ---------------------------------------------taaga
D3Z5F7_BCL2L2-01       gagtccacccccaggcaatgctggcccagtgatcatgtctcttgaggaga
P70345_BCL2L2-05       --------------------------------------------------
                                                                         

Q9Z0F3_BCL2L10-01      --------------------------------------------------
O55178_BCL2A1-01       --------------------------------------------------
Q0P538_BCL2A1-01       --------------------------------------------------
Q07440_BCL2A1-01       --------------------------------------------------
O55179_BCL2A1-01       --------------------------------------------------
Q8K164_BCL2A1-01       --------------------------------------------------
Q4FK02_BCL2A1-01       --------------------------------------------------
O55177_BCL2A1-02       --------------------------------------------------
Q497M6_BCL2A1-01       --------------------------------------------------
P10417_BCL2-01         --------------------------------------------------
P10417_BCL2-02         --------------------------------------------------
Q6NTH7_BCL2-01         --------------------------------------------------
P97287_MCL1-01         --------------------------------------------------
P97287_MCL1-02         --------------------------------------------------
O35843_BCL2L1-01       --------------------------------------------------
Q64373_BCL2L1-03       --------------------------------------------------
Q64373_BCL2L1-04       --------------------------------------------------
Q5HZH3_BCL2L1-02       --------------------------------------------------
Q64373_BCL2L1-01       --------------------------------------------------
Q64373_BCL2L1-05       --------------------------------------------------
Q64373_BCL2L1-06       --------------------------------------------------
Q64373_BCL2L1-07       --------------------------------------------------
Q64373_BCL2L1-08       --------------------------------------------------
Q64373_BCL2L1-09       --------------------------------------------------
P70345_BCL2L2-01       agttcacagctc--------------------------------------
P70345_BCL2L2-03       agttcacagctc--------------------------------------
P70345_BCL2L2-04       agttctcaattgctgctctccgcatccc----------------------
D3Z5F7_BCL2L2-01       agatggaggctgatgcccgctctatctacgttggcaatgtggactatggt
P70345_BCL2L2-05       --------------------------------------------------
                                                                         

Q9Z0F3_BCL2L10-01      --------------------------------------------------
O55178_BCL2A1-01       --------------------------------------------------
Q0P538_BCL2A1-01       --------------------------------------------------
Q07440_BCL2A1-01       --------------------------------------------------
O55179_BCL2A1-01       --------------------------------------------------
Q8K164_BCL2A1-01       --------------------------------------------------
Q4FK02_BCL2A1-01       --------------------------------------------------
O55177_BCL2A1-02       --------------------------------------------------
Q497M6_BCL2A1-01       --------------------------------------------------
P10417_BCL2-01         --------------------------------------------------
P10417_BCL2-02         --------------------------------------------------
Q6NTH7_BCL2-01         --------------------------------------------------
P97287_MCL1-01         --------------------------------------------------
P97287_MCL1-02         --------------------------------------------------
O35843_BCL2L1-01       --------------------------------------------------
Q64373_BCL2L1-03       --------------------------------------------------
Q64373_BCL2L1-04       --------------------------------------------------
Q5HZH3_BCL2L1-02       --------------------------------------------------
Q64373_BCL2L1-01       --------------------------------------------------
Q64373_BCL2L1-05       --------------------------------------------------
Q64373_BCL2L1-06       --------------------------------------------------
Q64373_BCL2L1-07       --------------------------------------------------
Q64373_BCL2L1-08       --------------------------------------------------
Q64373_BCL2L1-09       --------------------------------------------------
P70345_BCL2L2-01       --------------------------------------------------
P70345_BCL2L2-03       --------------------------------------------------
P70345_BCL2L2-04       --------------------------------------------------
D3Z5F7_BCL2L2-01       gcaacagcagaagagctggaagcccattttcatggctgtggttcagtcaa
P70345_BCL2L2-05       --------------------------------------------------
                                                                         

Q9Z0F3_BCL2L10-01      -----------------------------------------------atg
O55178_BCL2A1-01       --------------------------------------------------
Q0P538_BCL2A1-01       --------------------------------------------------
Q07440_BCL2A1-01       --------------------------------------------aagatg
O55179_BCL2A1-01       --------------------------------------------aagatg
Q8K164_BCL2A1-01       --------------------------------------------aagatg
Q4FK02_BCL2A1-01       --------------------------------------------aagatg
O55177_BCL2A1-02       --------------------------------------------aagatg
Q497M6_BCL2A1-01       --------------------------------------------aagatg
P10417_BCL2-01         -----------------------------------------------atg
P10417_BCL2-02         --------------------------------------------------
Q6NTH7_BCL2-01         --------------------------------------------------
P97287_MCL1-01         -----------------------------------------------atg
P97287_MCL1-02         -----------------------------------------------atg
O35843_BCL2L1-01       -------------------------------------------------g
Q64373_BCL2L1-03       --------------------------------------------------
Q64373_BCL2L1-04       --------------------------------------------------
Q5HZH3_BCL2L1-02       -----------------------------------------------aca
Q64373_BCL2L1-01       -----------------------------------------------aca
Q64373_BCL2L1-05       --------------------------------------------------
Q64373_BCL2L1-06       --------------------------------------------------
Q64373_BCL2L1-07       --------------------------------------------------
Q64373_BCL2L1-08       --------------------------------------------------
Q64373_BCL2L1-09       -----------------------------------------------aca
P70345_BCL2L2-01       ----------------------------------------------tata
P70345_BCL2L2-03       ----------------------------------------------tata
P70345_BCL2L2-04       ----------------------------------------------tcta
D3Z5F7_BCL2L2-01       ccgtgttactatactctgtgacaaatttagtggccatcccaaagggtttg
P70345_BCL2L2-05       --------------------------------------------------
                                                                         

Q9Z0F3_BCL2L10-01      gcttttgccgcttcttcaa-------------------------------
O55178_BCL2A1-01       --------------------------------------------------
Q0P538_BCL2A1-01       --------------------------------------------------
Q07440_BCL2A1-01       gcttcataaag---------------------------------------
O55179_BCL2A1-01       gcttcataaag---------------------------------------
Q8K164_BCL2A1-01       gcttcataaag---------------------------------------
Q4FK02_BCL2A1-01       gcttcataaag---------------------------------------
O55177_BCL2A1-02       gcttcataaag---------------------------------------
Q497M6_BCL2A1-01       gcttcataaag---------------------------------------
P10417_BCL2-01         cctttgtggaactatatggccccagcatgcgacctctgtttgatttctcc
P10417_BCL2-02         --------------------------------------------------
Q6NTH7_BCL2-01         --------------------------------------------------
P97287_MCL1-01         ggtttgtggagttcttccacgt----------------------------
P97287_MCL1-02         ggtttgtggagttcttccacgt----------------------------
O35843_BCL2L1-01       tgtgagtggaggtacacccctcagatctgtcttcagaaggcttg------
Q64373_BCL2L1-03       --------------------------------------------------
Q64373_BCL2L1-04       --------------------------------------------------
Q5HZH3_BCL2L1-02       cttttgtggatctctacgggaacaatgcagcagccgagagccggaaaggc
Q64373_BCL2L1-01       cttttgtggatctctacgggaacaatgcagcagccgagagccggaaaggc
Q64373_BCL2L1-05       --------------------------------------------------
Q64373_BCL2L1-06       --------------------------------------------------
Q64373_BCL2L1-07       --------------------------------------------------
Q64373_BCL2L1-08       --------------------------------------------------
Q64373_BCL2L1-09       cttttgtggatctctacgggaacaatgcagcagccgagagccggaaaggc
P70345_BCL2L2-01       cggggacggggccctggaggaggca-------------------------
P70345_BCL2L2-03       cggggacggggccctggaggaggca-------------------------
P70345_BCL2L2-04       caaagttggtcttcatgggaaaata-------------------------
D3Z5F7_BCL2L2-01       catatatagagttctcggacaaagagtcagtgaggacgtccctggcctta
P70345_BCL2L2-05       --------------------------------------------------
                                                                         

Q9Z0F3_BCL2L10-01      --------------------------------------------------
O55178_BCL2A1-01       --------------------------------------------------
Q0P538_BCL2A1-01       --------------------------------------------------
Q07440_BCL2A1-01       --------------------------------------------------
O55179_BCL2A1-01       --------------------------------------------------
Q8K164_BCL2A1-01       --------------------------------------------------
Q4FK02_BCL2A1-01       --------------------------------------------------
O55177_BCL2A1-02       --------------------------------------------------
Q497M6_BCL2A1-01       --------------------------------------------------
P10417_BCL2-01         tggctgtctctga-------------------------------------
P10417_BCL2-02         --------------------------------------------------
Q6NTH7_BCL2-01         --------------------------------------------------
P97287_MCL1-01         --------------------------------------------------
P97287_MCL1-02         --------------------------------------------------
O35843_BCL2L1-01       ---------ttcaagt----------------------------------
Q64373_BCL2L1-03       ----------taagaa----------------------------------
Q64373_BCL2L1-04       ----------taagaa----------------------------------
Q5HZH3_BCL2L1-02       caggagcgcttcaacc----------------------------------
Q64373_BCL2L1-01       caggagcgcttcaacc----------------------------------
Q64373_BCL2L1-05       --------------------------------------------------
Q64373_BCL2L1-06       --------------------------------------------------
Q64373_BCL2L1-07       --------------------------------------------------
Q64373_BCL2L1-08       --------------------------------------------------
Q64373_BCL2L1-09       caggagcgcttcaacc----------------------------------
P70345_BCL2L2-01       ---cggcgtctgcgggagggga----------------------------
P70345_BCL2L2-03       ---cggcgtctgcgggagggga----------------------------
P70345_BCL2L2-04       ---gggcctctgatgggagg------------------------------
D3Z5F7_BCL2L2-01       gatgagtccctgttcagaggaagacaaatcaaggtgattcccaaacgaac
P70345_BCL2L2-05       --------------------------------------------------
                                                                         

Q9Z0F3_BCL2L10-01      --------------------------------------------------
O55178_BCL2A1-01       --------------------------------------------------
Q0P538_BCL2A1-01       --------------------------------------------------
Q07440_BCL2A1-01       --------------------------------------------------
O55179_BCL2A1-01       --------------------------------------------------
Q8K164_BCL2A1-01       --------------------------------------------------
Q4FK02_BCL2A1-01       --------------------------------------------------
O55177_BCL2A1-02       --------------------------------------------------
Q497M6_BCL2A1-01       --------------------------------------------------
P10417_BCL2-01         --------------------------------------------------
P10417_BCL2-02         --------------------------------------------------
Q6NTH7_BCL2-01         --------------------------------------------------
P97287_MCL1-01         --------------------------------------------------
P97287_MCL1-02         --------------------------------------------------
O35843_BCL2L1-01       --------------------------------------------------
Q64373_BCL2L1-03       --------------------------------------------------
Q64373_BCL2L1-04       --------------------------------------------------
Q5HZH3_BCL2L1-02       --------------------------------------------------
Q64373_BCL2L1-01       --------------------------------------------------
Q64373_BCL2L1-05       --------------------------------------------------
Q64373_BCL2L1-06       --------------------------------------------------
Q64373_BCL2L1-07       --------------------------------------------------
Q64373_BCL2L1-08       --------------------------------------------------
Q64373_BCL2L1-09       --------------------------------------------------
P70345_BCL2L2-01       --------------------------------------------------
P70345_BCL2L2-03       --------------------------------------------------
P70345_BCL2L2-04       --------------------------------------------------
D3Z5F7_BCL2L2-01       caacagaccaggcatcagcacaacagaccggggtttcccgcgctcccgat
P70345_BCL2L2-05       --------------------------------------------------
                                                                         

Q9Z0F3_BCL2L10-01      ----------------------------------------gaatccttta
O55178_BCL2A1-01       --------------------------------------------------
Q0P538_BCL2A1-01       --------------------------------------------------
Q07440_BCL2A1-01       --------------------------------------------------
O55179_BCL2A1-01       --------------------------------------------------
Q8K164_BCL2A1-01       --------------------------------------------------
Q4FK02_BCL2A1-01       --------------------------------------------------
O55177_BCL2A1-02       --------------------------------------------------
Q497M6_BCL2A1-01       --------------------------------------------------
P10417_BCL2-01         ----------------------------------------agaccctgct
P10417_BCL2-02         --------------------------------------------------
Q6NTH7_BCL2-01         --------------------------------------------------
P97287_MCL1-01         ----------------------------------------acaggaccta
P97287_MCL1-02         ----------------------------------------acaggaccta
O35843_BCL2L1-01       ----------------------------------------gccaggagtg
Q64373_BCL2L1-03       ----------------------------------------ccacgcccct
Q64373_BCL2L1-04       ----------------------------------------ccacgcccct
Q5HZH3_BCL2L1-02       ----------------------------------------gctggttcct
Q64373_BCL2L1-01       ----------------------------------------gctggttcct
Q64373_BCL2L1-05       --------------------------------------------------
Q64373_BCL2L1-06       --------------------------------------------------
Q64373_BCL2L1-07       --------------------------------------------------
Q64373_BCL2L1-08       --------------------------------------------------
Q64373_BCL2L1-09       ----------------------------------------gctggttcct
P70345_BCL2L2-01       ----------------------------------------actgggcatc
P70345_BCL2L2-03       ----------------------------------------actgggcatc
P70345_BCL2L2-04       --------------------------------------------------
D3Z5F7_BCL2L2-01       accgtgcccggactaccaactacaacagctcccgatctcgattctacagt
P70345_BCL2L2-05       --------------------------------------------------
                                                                         

Q9Z0F3_BCL2L10-01      ccgctcggcttctggagaagattgctgattcaggcttttctgtcaggctt
O55178_BCL2A1-01       --------------------------------------------------
Q0P538_BCL2A1-01       --------------------------------------------------
Q07440_BCL2A1-01       aagtttgaacccaaatctggctggctgacttttctgcagatgacaggaca
O55179_BCL2A1-01       aagtttgaacccaaatctggctggctgacttttctgcagatgacaggaca
Q8K164_BCL2A1-01       aagtttgaacccaaatctggctggctgacttttctgcagatgacaggaca
Q4FK02_BCL2A1-01       aagtttgaacccaaatctggctggctgacttttctgcagatgacaggaca
O55177_BCL2A1-02       aagtttgaacccaaatctggctggctgacttttctgcagatgacaggaca
Q497M6_BCL2A1-01       aagtttgaacccaaatctggctggctgacttttctgcagatgacaggaca
P10417_BCL2-01         cagcctggccctggtcggggcctgcatcactctgggtgcatacctgggcc
P10417_BCL2-02         --------------------------------taggtgcatgtctggt--
Q6NTH7_BCL2-01         --------------------------------taggtgcatgtctggt--
P97287_MCL1-01         gaaggcggcatcagaaatgtgctgctggcttttgcgggtgttgctggagt
P97287_MCL1-02         gaaggcggcatcagaaatgtgctgctggcttttgcgggtgttgctggagt
O35843_BCL2L1-01       gcggagcacgtttgtgatcccagcctttgggaggtggaaacagaaggatc
Q64373_BCL2L1-03       tgtgtgtccgccccttgcttgtgtctctcttctctgtgaacatccctaa-
Q64373_BCL2L1-04       tgtgtgtccgccccttgcttgtgtctctcttctctgtgaacatccctaa-
Q5HZH3_BCL2L1-02       gacgggcatgactgtggctggtgtggttctgctgggctcactcttcagtc
Q64373_BCL2L1-01       gacgggcatgactgtggctggtgtggttctgctgggctcactcttcagtc
Q64373_BCL2L1-05       --------------------------------------------------
Q64373_BCL2L1-06       --------------------------------------------------
Q64373_BCL2L1-07       --------------------------------------------------
Q64373_BCL2L1-08       --------------------------------------------------
Q64373_BCL2L1-09       gacgggcatgactgtggctggtgtggttctgctgggctcactcttcagtc
P70345_BCL2L2-01       agtgaggacagtgctgacgggggccgtggcactgggggccctggtaactg
P70345_BCL2L2-03       agtgaggacagtgctgacgggggccgtggcactgggggccctggtaactg
P70345_BCL2L2-04       -----------------ctggggttgtgctgggaaggg-ctga-------
D3Z5F7_BCL2L2-01       ggttttaacagcaggccccggggtcgaatctacagggg-ccgggctagag
P70345_BCL2L2-05       --------------------------------------------------
                                                                         

Q9Z0F3_BCL2L10-01      ctttgcaacagccatcttttttatctggaaacgtttataa
O55178_BCL2A1-01       ----------------------------------------
Q0P538_BCL2A1-01       ----------------------------------------
Q07440_BCL2A1-01       gatctgggaaatgctctttctcctcaagtaa---------
O55179_BCL2A1-01       gatctgggaaatgctctttctcctcaagtaa---------
Q8K164_BCL2A1-01       gatctgggaaatgctctttctcctcaagtaa---------
Q4FK02_BCL2A1-01       gttctgggaaatgctctttctcctcaagtag---------
O55177_BCL2A1-02       gttctgggaaatgctctttctcctcaagtaa---------
Q497M6_BCL2A1-01       gttctgggaaatgctctttctcctcaagtaa---------
P10417_BCL2-01         acaagtga--------------------------------
P10417_BCL2-02         -tgaatga--------------------------------
Q6NTH7_BCL2-01         -tgaatga--------------------------------
P97287_MCL1-01         aggggctggtctggcatatctaataagatag---------
P97287_MCL1-02         aggggctggtctggcatatctaataagatag---------
O35843_BCL2L1-01       ggaagttcaaggccctcctcagctattatag---------
Q64373_BCL2L1-03       ----------------------------------------
Q64373_BCL2L1-04       ----------------------------------------
Q5HZH3_BCL2L1-02       ggaagtga--------------------------------
Q64373_BCL2L1-01       ggaagtga--------------------------------
Q64373_BCL2L1-05       ----------------------------------------
Q64373_BCL2L1-06       ----------------------------------------
Q64373_BCL2L1-07       ----------------------------------------
Q64373_BCL2L1-08       ----------------------------------------
Q64373_BCL2L1-09       ggaagtga--------------------------------
P70345_BCL2L2-01       taggggccttttttgctagcaagtga--------------
P70345_BCL2L2-03       taggggccttttttgctagcaagtga--------------
P70345_BCL2L2-04       ----------------------------------------
D3Z5F7_BCL2L2-01       cgacatcatggtattccccttactaa--------------
P70345_BCL2L2-05       ----------------------------------------
                                                               

© 1998-2022Legal notice