Dataset for CDS BCL-2-like of organism Mus musculus

[Download (right click)] [Edit] [Sequences] [Repertoires]

11 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


O35843_BCL2L1-01      atgtct---------------------cagagcaaccgggagctggtggt
Q5HZH3_BCL2L1-02      atgtct---------------------cagagcaaccgggagctggtggt
O55178_BCL2A1-01      atggct--------------------------------------------
Q0P538_BCL2A1-01      atggct--------------------------------------------
O55179_BCL2A1-01      atgtct--------------------------------------------
Q8K164_BCL2A1-01      atggct--------------------------------------------
Q4FK02_BCL2A1-01      atgtct--------------------------------------------
O55177_BCL2A1-02      atggct--------------------------------------------
Q497M6_BCL2A1-01      atggct--------------------------------------------
D3Z5F7_BCL2L2-01      atggcgaccccagcctcaacccca------gacacacgggctctagtggc
Q6NTH7_BCL2-01        atggcg---caagccgggagaacagggtatgataaccgggagatcgtgat
                      *** *                                             

O35843_BCL2L1-01      cgactttctctcctacaagctttcccagaaaggatacagctggagtcagt
Q5HZH3_BCL2L1-02      cgactttctctcctacaagctttcccagaaaggatacagctggagtcagt
O55178_BCL2A1-01      ----------gagtacgagctcatgcata---------------------
Q0P538_BCL2A1-01      ----------gagtacgagctcatgcata---------------------
O55179_BCL2A1-01      ----------gagtacgagttcatgtata---------------------
Q8K164_BCL2A1-01      ----------gagtacgagttcatgtata---------------------
Q4FK02_BCL2A1-01      ----------gagtacgagttcatgtata---------------------
O55177_BCL2A1-02      ----------gagtacgagttcatgtata---------------------
Q497M6_BCL2A1-01      ----------gagtacgagttcatgtata---------------------
D3Z5F7_BCL2L2-01      tgactttgtaggctataagctgaggcagaagggttatgtctgt-------
Q6NTH7_BCL2-01        gaagtacatacattataagctgtcacagaggggctacgagtgg-------
                                   **  ** *     * *                     

O35843_BCL2L1-01      ttagtgatgttgaagagaataggactgaggccccagaagaaactgaagca
Q5HZH3_BCL2L1-02      ttagtgatgtcgaagagaataggactgaggccccagaagaaactgaagca
O55178_BCL2A1-01      ----------------------------------tccactccctggctga
Q0P538_BCL2A1-01      ----------------------------------tccactccctggctga
O55179_BCL2A1-01      ----------------------------------tccactccctggctga
Q8K164_BCL2A1-01      ----------------------------------tccactccctggctga
Q4FK02_BCL2A1-01      ----------------------------------tccactccctggctga
O55177_BCL2A1-02      ----------------------------------tccactccctggctga
Q497M6_BCL2A1-01      ----------------------------------tccactccctggctga
D3Z5F7_BCL2L2-01      --------------ggagctggccctggggaaggcccagccgccgacccg
Q6NTH7_BCL2-01        --------------gatgctgg---------------agatgcggacgcg
                                                           *    * *     

O35843_BCL2L1-01      gagagggagacccccagtgccatc--------aatggcaacccatcctgg
Q5HZH3_BCL2L1-02      gagagggagacccccagtgccatc--------aatggcaacccatcctgg
O55178_BCL2A1-01      gcactaccttcagtatgtgctaca------------ggtacccgcctttg
Q0P538_BCL2A1-01      gcactaccttcagtatgtgctaca------------ggtacccgcctttg
O55179_BCL2A1-01      gcactaccttcagtatgtgctaca------------ggtacccgcctttg
Q8K164_BCL2A1-01      gcactatcttcagtatgtgctaca------------ggtacccgcctttg
Q4FK02_BCL2A1-01      gcactatcttcagtatgtgctaca------------ggtacccgcctttg
O55177_BCL2A1-02      gcactatcttcagtatgtgctaca------------ggtacccgcctttg
Q497M6_BCL2A1-01      gcactatcttcagtatgtgctaca------------ggtacccgcctttg
D3Z5F7_BCL2L2-01      ctgcaccaagccatgcgggctgctggagacgagtttgagacccgtttccg
Q6NTH7_BCL2-01        gcgc------ccctgggggctgcc----------------cccacccctg
                                *     * **                    ***      *

O35843_BCL2L1-01      ---------cacctggcggatagcccggccgtgaatggagcc--actggc
Q5HZH3_BCL2L1-02      ---------cacctggcggatagcccggccgtgaatggagcc--actggc
O55178_BCL2A1-01      agtcggctcca---------------agccaagcat--------tcagag
Q0P538_BCL2A1-01      agtcggctcca---------------agccaagcat--------tcagag
O55179_BCL2A1-01      agtcggctcca---------------agccaagcat--------gcagag
Q8K164_BCL2A1-01      agtcggctcca---------------agccaagcat--------gcagag
Q4FK02_BCL2A1-01      agtcggctcca---------------agcaaagcat--------gcagag
O55177_BCL2A1-02      agtcggctcca---------------agccaagcat--------gcagag
Q497M6_BCL2A1-01      agtcggctcca---------------agcaaagcat--------gcagag
D3Z5F7_BCL2L2-01      ccgcaccttctctgacctggccgctcagctacacgtgaccccaggctcag
Q6NTH7_BCL2-01        --gcatcttctccttccagcctgag-agcaacccaatgccc---gctgtg
                               *                 **                *    

O35843_BCL2L1-01      cacagcagcagttt-----------------------------ggatgcg
Q5HZH3_BCL2L1-02      cacagcagcagttt-----------------------------ggatgcg
O55178_BCL2A1-01      tgctacaa------------------------------------------
Q0P538_BCL2A1-01      tgctacaa------------------------------------------
O55179_BCL2A1-01      tgctacaa------------------------------------------
Q8K164_BCL2A1-01      tgctacaa------------------------------------------
Q4FK02_BCL2A1-01      tgctacaa------------------------------------------
O55177_BCL2A1-02      tgctacaa------------------------------------------
Q497M6_BCL2A1-01      tgctacaa------------------------------------------
D3Z5F7_BCL2L2-01      cccagcaacgcttcacccaggtttccgacgaacttttccaagggggccct
Q6NTH7_BCL2-01        caccgggacatggctgccagg----------acgtctcctctcaggccc-
                        *                                               

O35843_BCL2L1-01      cgggaggtgattcccatggc-------------agcagtgaagcaagcgc
Q5HZH3_BCL2L1-02      cgggaggtgattcccatggc-------------agcagtgaagcaagcgc
O55178_BCL2A1-01      ---------------------------------agagttgctttctccgt
Q0P538_BCL2A1-01      ---------------------------------agagttgctttctccgt
O55179_BCL2A1-01      ---------------------------------agagttgctttctccgt
Q8K164_BCL2A1-01      ---------------------------------agagttgctttctccgt
Q4FK02_BCL2A1-01      ---------------------------------agagttgctttctccgt
O55177_BCL2A1-02      ---------------------------------agagttgctttctccgt
Q497M6_BCL2A1-01      ---------------------------------agagttgctttctccgt
D3Z5F7_BCL2L2-01      aactggggccgtcttgtggcattctttgtctttggggctgccctgtgtgc
Q6NTH7_BCL2-01        ------------ctcgttgc------caccgctgggcctgcgctcagccc
                                                        *   **          

O35843_BCL2L1-01      tgagagaggcaggcgatgagtttgaactgcggt-----------------
Q5HZH3_BCL2L1-02      tgagagaggcaggcgatgagtttgaactgcggt-----------------
O55178_BCL2A1-01      tcagaaggaagttggaaaga------------------------------
Q0P538_BCL2A1-01      tcagaaggaagttggaaaga------------------------------
O55179_BCL2A1-01      tcagaaggaagttgaaaaga------------------------------
Q8K164_BCL2A1-01      tcagaaggaagttgaaaaga------------------------------
Q4FK02_BCL2A1-01      tcagaaggaagttgaaaaga------------------------------
O55177_BCL2A1-02      tcagaaggaagttgaaaaga------------------------------
Q497M6_BCL2A1-01      tcagaaggaagttgaaaaga------------------------------
D3Z5F7_BCL2L2-01      tgagagtgtcaacaaagaaatggagcctttggtgggacaagtgcaggatt
Q6NTH7_BCL2-01        tgtg----------------------------------------------
                      *  *                                              

O35843_BCL2L1-01      ------------accggagagcgt---tcagtgatctaacatcccagc--
Q5HZH3_BCL2L1-02      ------------accggagagcgt---tcagtgatctaacatcccagc--
O55178_BCL2A1-01      ------------acctaaagtcatacttggatgactt-------------
Q0P538_BCL2A1-01      ------------acctaaagtcatacttggatgactt-------------
O55179_BCL2A1-01      ------------atctgaagtcatacttggatgactt-------------
Q8K164_BCL2A1-01      ------------atctgaagtcatacttggatgactt-------------
Q4FK02_BCL2A1-01      ------------atctgaagtcatacttggatgactt-------------
O55177_BCL2A1-02      ------------atctgaagtcatacttggatgactt-------------
Q497M6_BCL2A1-01      ------------atctgaagtcatacttggatgactt-------------
D3Z5F7_BCL2L2-01      ggatggtggcctacctggagacacgtctggctgactggatccacagcagt
Q6NTH7_BCL2-01        ----------ccacctg----------tggtccatctgaccctccgcc--
                                  * *            *     *                

O35843_BCL2L1-01      ----------------------------ttcacata--------------
Q5HZH3_BCL2L1-02      ----------------------------ttcacata--------------
O55178_BCL2A1-01      -----------------------------tcacgtg--------------
Q0P538_BCL2A1-01      -----------------------------tcacgtg--------------
O55179_BCL2A1-01      -----------------------------tcacgtg--------------
Q8K164_BCL2A1-01      -----------------------------tcacgtg--------------
Q4FK02_BCL2A1-01      -----------------------------tcacgtg--------------
O55177_BCL2A1-02      -----------------------------tcacgtg--------------
Q497M6_BCL2A1-01      -----------------------------tcacgtg--------------
D3Z5F7_BCL2L2-01      gggggctgggagctagaagcgatcaaagctcgagtcagggagatggagga
Q6NTH7_BCL2-01        --gggctggg----------gatgacttctctcgtc--------------
                                                   **   *               

O35843_BCL2L1-01      ------------accccagggaccgc------------------------
Q5HZH3_BCL2L1-02      ------------accccagggaccgc------------------------
O55178_BCL2A1-01      ---------gaatccatagataccac-----------------cagaata
Q0P538_BCL2A1-01      ---------gaatccatagataccac-----------------cagaata
O55179_BCL2A1-01      ---------gaatccatagataccgc-----------------cagaata
Q8K164_BCL2A1-01      ---------gaatccatagataccgc-----------------cagaata
Q4FK02_BCL2A1-01      ---------gaatccatagataccgc-----------------cagaata
O55177_BCL2A1-02      ---------gaatccatagataccgc-----------------cagaata
Q497M6_BCL2A1-01      ---------gaatccatagataccgc-----------------cagaata
D3Z5F7_BCL2L2-01      agaggctgagaagctaaaggagctacaaaacgaggtagagaagcagatga
Q6NTH7_BCL2-01        ---------------------gctac----cgtcgtgacttcgcaga--g
                                            *  *                        

O35843_BCL2L1-01      gtat---------------cagagct-------------------ttgag
Q5HZH3_BCL2L1-02      gtat---------------cagagct-------------------ttgag
O55178_BCL2A1-01      atat----------tcaaccaa-----------------------gtgat
Q0P538_BCL2A1-01      atat----------tcaaccaa-----------------------gtgat
O55179_BCL2A1-01      atat----------tcaaccaa-----------------------gtgat
Q8K164_BCL2A1-01      atat----------tcaaccaa-----------------------gtgat
Q4FK02_BCL2A1-01      atat----------tcaaccaa-----------------------gtgat
O55177_BCL2A1-02      atat----------tcaaccaa-----------------------gtgat
Q497M6_BCL2A1-01      atat----------tcaaccaa-----------------------gtgat
D3Z5F7_BCL2L2-01      atatgagtccacccccaggcaatgctggcccagtgatcatgtctcttgag
Q6NTH7_BCL2-01        atgt----------ccagtca--gctgcacctgacgcccttcaccgcgag
                       * *               **                          ** 

O35843_BCL2L1-01      cagg----------------------------------------------
Q5HZH3_BCL2L1-02      cagg----------------------------------------------
O55178_BCL2A1-01      ggaa----------------------------------------------
Q0P538_BCL2A1-01      ggaa----------------------------------------------
O55179_BCL2A1-01      ggaa----------------------------------------------
Q8K164_BCL2A1-01      ggaa----------------------------------------------
Q4FK02_BCL2A1-01      ggaa----------------------------------------------
O55177_BCL2A1-02      ggaa----------------------------------------------
Q497M6_BCL2A1-01      ggaa----------------------------------------------
D3Z5F7_BCL2L2-01      gagaagatggaggctgatgcccgctctatctacgttggcaatgtggacta
Q6NTH7_BCL2-01        ggga-----------------cgctttgcc----------------acgg
                                                                        

O35843_BCL2L1-01      tagtg--------aatgaac----------tctttcgggatggagtaaa-
Q5HZH3_BCL2L1-02      tagtg--------aatgaac----------tctttcgggatggagtaaa-
O55178_BCL2A1-01      -------------aaagagtttgaag---------atggc-atcattaa-
Q0P538_BCL2A1-01      -------------aaagagtttgaaa---------atggc-atcattaa-
O55179_BCL2A1-01      -------------aaagagtttgaag---------atggc-atcattaa-
Q8K164_BCL2A1-01      -------------aaagagtttgaag---------atggc-atcattaa-
Q4FK02_BCL2A1-01      -------------aaagagtttgaag---------atggc-atcattaa-
O55177_BCL2A1-02      -------------aaagagtttgaag---------atggc-atcattaa-
Q497M6_BCL2A1-01      -------------aaagagtttgaag---------atggc-atcattaa-
D3Z5F7_BCL2L2-01      tggtgcaacagcagaagagctggaagcccattttcatggctgtggttcag
Q6NTH7_BCL2-01        tggtg--------gaggaac----------tcttcagggatggggtgaa-
                                    * **                   **      *  * 

O35843_BCL2L1-01      -------------------ctggggtcgcatc-gtggcctttttctcctt
Q5HZH3_BCL2L1-02      -------------------ctggggtcgcatc-gtggcctttttctcctt
O55178_BCL2A1-01      -------------------ttggggaaggatt-gtgactatatttgcctt
Q0P538_BCL2A1-01      -------------------ttggggaaggatt-gtgactatatttgcctt
O55179_BCL2A1-01      -------------------ctggggaaggatt-gtgactatatttgcctt
Q8K164_BCL2A1-01      -------------------ctggggaaggatt-gtgactatatttgcctt
Q4FK02_BCL2A1-01      -------------------ctggggaaggatt-gtgactatatttgcctt
O55177_BCL2A1-02      -------------------ctggggaaggatt-gtgactatatttgcctt
Q497M6_BCL2A1-01      -------------------ctggggaaggatt-gtgactatatttgcctt
D3Z5F7_BCL2L2-01      tcaaccgtgttactatactctgtgacaaatttagtggccatc-------c
Q6NTH7_BCL2-01        -------------------ctgggggaggatt-gtggccttctttgagtt
                                          ** *      *  *** *  *         

O35843_BCL2L1-01      tggcggggcactgtgcgtggaaagcgtagacaagga--------------
Q5HZH3_BCL2L1-02      tggcggggcactgtgcgtggaaagcgtagacaagga--------------
O55178_BCL2A1-01      tgggggtgtt-ctcctcaaaaaaacttccacaaga-------gcagattg
Q0P538_BCL2A1-01      tgggggtgtt-ctcctcaaaaaaacttccacaaga-------gcagattg
O55179_BCL2A1-01      tgggggtgtt-ctcctc-aaaaaacttccacaaga-------gcagattg
Q8K164_BCL2A1-01      tgggggtgtt-ctcctc-aaaaaacttccgcaaga-------gcagattg
Q4FK02_BCL2A1-01      tgggggtgtt-ctcctc-aaaaaacttccgcaaga-------gcagattg
O55177_BCL2A1-02      tgggggtgtt-ctcctc-aaaaaacttccgcaaga-------gcagattg
Q497M6_BCL2A1-01      tgggggtgtt-ctcctc-aaaaaacttccgcaaga-------gcagattg
D3Z5F7_BCL2L2-01      caaagggtttgcatatatagagttctcggacaaagagtcagtgaggacgt
Q6NTH7_BCL2-01        cggtggggtcatgtgtgtggagagcgtcaacaggga------gatgtcac
                          **              *   *     **                  

O35843_BCL2L1-01      -----gatgcaggtattggtgagtcggattgcaagttggatggccaccta
Q5HZH3_BCL2L1-02      -----gatgcaggtattggtgagtcggattgcaagttggatggccaccta
O55178_BCL2A1-01      ccctggatgtacgtgcttacaaacaagtttccagttttggggcaga--at
Q0P538_BCL2A1-01      ccctggatgtacgtgcttacaaacaagtttccagttttggggcaga--at
O55179_BCL2A1-01      ccctggatgtaggtgcttacaaacaagtttccagttttgtggcaga--at
Q8K164_BCL2A1-01      ccctggatgtaggtgcttacaaacaagtttccagttttgtggcaga--at
Q4FK02_BCL2A1-01      ccctggatgtaggtgcttacaaacaagtttccagttttgtggcaga--at
O55177_BCL2A1-02      ccctggatgtaggtgcttacaaacaagtttccagttttgtggcaga--at
Q497M6_BCL2A1-01      ccctggatgtaggtgcttacaaacaagtttccagttttgtggcaga--at
D3Z5F7_BCL2L2-01      ccctggccttag----------atgagtccct-gttcagaggaagacaaa
Q6NTH7_BCL2-01        ccctgg---tgg----------acaa--catc-gccctgtggatgac---
                           *                                *  *   *    

O35843_BCL2L1-01      tctgaatgaccacctaga--------------gccttggatccaggagaa
Q5HZH3_BCL2L1-02      tctgaatgaccacctaga--------------gccttggatccaggagaa
O55178_BCL2A1-01      tcataatgaataa-------------------------------------
Q0P538_BCL2A1-01      tcatcatgaataa-------------------------------------
O55179_BCL2A1-01      tcataatgaataacacagg-------------agaatggatacggcggaa
Q8K164_BCL2A1-01      tcataatcaataacacagg-------------agaatggatacggcggaa
Q4FK02_BCL2A1-01      tcataatcaataacacagg-------------agaatggatacggcggaa
O55177_BCL2A1-02      tcataatcaataacacagg-------------agaatggatacggcggaa
Q497M6_BCL2A1-01      tcataatcaataacacagg-------------agaatggatacggcggaa
D3Z5F7_BCL2L2-01      tcaaggtgattcccaaacgaaccaacagaccaggcatcagcacaacagac
Q6NTH7_BCL2-01        ------tgagtacc---tgaacc---------ggcatctgcaca------
                            * *                                         

O35843_BCL2L1-01      cggcggctggggtgtgagtggaggtacacccct-cagatctgtcttcaga
Q5HZH3_BCL2L1-02      cggcggctggg--------------acacttttgtggatc--tctacggg
O55178_BCL2A1-01      --------------------------------------------------
Q0P538_BCL2A1-01      --------------------------------------------------
O55179_BCL2A1-01      tggaggttg-------------------gg----aagatg--gcttcata
Q8K164_BCL2A1-01      tggaggttg-------------------gg----aagatg--gcttcata
Q4FK02_BCL2A1-01      tggaggttg-------------------gg----aagatg--gcttcata
O55177_BCL2A1-02      tggaggttg-------------------gg----aagatg--gcttcata
Q497M6_BCL2A1-01      tggaggttg-------------------gg----aagatg--gcttcata
D3Z5F7_BCL2L2-01      cggggtttcccgcgctcccgataccgtgcc----cggact--accaacta
Q6NTH7_BCL2-01        ----------------------------cc----tgga------------
                                                                        

O35843_BCL2L1-01      aggcttgt-----tcaagtgccaggagtggc-ggagcacgtttg----tg
Q5HZH3_BCL2L1-02      aacaatgcagcagccgagagccggaaaggccaggagcgcttcaaccgctg
O55178_BCL2A1-01      --------------------------------------------------
Q0P538_BCL2A1-01      --------------------------------------------------
O55179_BCL2A1-01      aagaagtttgaacccaaatctggctggctga--------cttttctgcag
Q8K164_BCL2A1-01      aagaagtttgaacccaaatctggctggctga--------cttttctgcag
Q4FK02_BCL2A1-01      aagaagtttgaacccaaatctggctggctga--------cttttctgcag
O55177_BCL2A1-02      aagaagtttgaacccaaatctggctggctga--------cttttctgcag
Q497M6_BCL2A1-01      aagaagtttgaacccaaatctggctggctga--------cttttctgcag
D3Z5F7_BCL2L2-01      caacagctcccgatctcgattctacagtggt--------tttaacagcag
Q6NTH7_BCL2-01        --------------------------------------------------
                                                                        

O35843_BCL2L1-01      atcccagcctttgggaggtggaaacagaaggatcggaagttcaaggcc--
Q5HZH3_BCL2L1-02      gttcctgac----gggcatgactgtggctggtgtggttctgctgggctca
O55178_BCL2A1-01      --------------------------------------------------
Q0P538_BCL2A1-01      --------------------------------------------------
O55179_BCL2A1-01      atgacaggaca-----------gatctgggaaatgctctttc--------
Q8K164_BCL2A1-01      atgacaggaca-----------gatctgggaaatgctctttc--------
Q4FK02_BCL2A1-01      atgacaggaca-----------gttctgggaaatgctctttc--------
O55177_BCL2A1-02      atgacaggaca-----------gttctgggaaatgctctttc--------
Q497M6_BCL2A1-01      atgacaggaca-----------gttctgggaaatgctctttc--------
D3Z5F7_BCL2L2-01      gccccggggtcgaatctacaggggccgggctagagcgacatcatggtatt
Q6NTH7_BCL2-01        --tccaggata------acggaggctgggtaggtgc-atgtc-tggt---
                                                                        

O35843_BCL2L1-01      ctcctcagctattatag-
Q5HZH3_BCL2L1-02      ctcttcagtcggaagtga
O55178_BCL2A1-01      ------------------
Q0P538_BCL2A1-01      ------------------
O55179_BCL2A1-01      tcctcaagtaa-------
Q8K164_BCL2A1-01      tcctcaagtaa-------
Q4FK02_BCL2A1-01      tcctcaagtag-------
O55177_BCL2A1-02      tcctcaagtaa-------
Q497M6_BCL2A1-01      tcctcaagtaa-------
D3Z5F7_BCL2L2-01      ccccttactaa-------
Q6NTH7_BCL2-01        ----tgaatga-------
                                        

© 1998-2023Legal notice