Dataset for CDS BCL-2-like of organism Mus musculus

[Download (right click)] [Edit] [Sequences] [Repertoires]

16 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


O55178_BCL2A1-01       -------------------------------------------------a
Q0P538_BCL2A1-01       -------------------------------------------------a
Q07440_BCL2A1-01       -------------------------------------------------a
O55179_BCL2A1-01       -------------------------------------------------a
Q8K164_BCL2A1-01       -------------------------------------------------a
Q4FK02_BCL2A1-01       -------------------------------------------------a
O55177_BCL2A1-02       -------------------------------------------------a
Q497M6_BCL2A1-01       -------------------------------------------------a
Q9Z0F3_BCL2L10-01      -------------------------------------------------a
O35843_BCL2L1-01       -------------------------------------------------a
Q64373_BCL2L1-01       -------------------------------------------------a
Q64373_BCL2L1-09       -------------------------------------------------a
P10417_BCL2-01         -------------------------------------------------a
P97287_MCL1-01         atgtttggcctgcggagaaacgcggtcatcggcttgaacctgtactgcgg
P70345_BCL2L2-02       --------------------------------------------------
P70345_BCL2L2-01       ----------------------------------------------atgg
                                                                         

O55178_BCL2A1-01       tgg------ctgagtac------------------------------gag
Q0P538_BCL2A1-01       tgg------ctgagtac------------------------------gag
Q07440_BCL2A1-01       tgg------ctgagtct------------------------------gag
O55179_BCL2A1-01       tgt------ctgagtac------------------------------gag
Q8K164_BCL2A1-01       tgg------ctgagtac------------------------------gag
Q4FK02_BCL2A1-01       tgt------ctgagtac------------------------------gag
O55177_BCL2A1-02       tgg------ctgagtac------------------------------gag
Q497M6_BCL2A1-01       tgg------ctgagtac------------------------------gag
Q9Z0F3_BCL2L10-01      tggccgactcgcaggacccactgcatgaacgcactagacgg---ctgctg
O35843_BCL2L1-01       tgt------ctcagagc------------------aaccgggagctggtg
Q64373_BCL2L1-01       tgt------ctcagagc------------------aaccgggagctggtg
Q64373_BCL2L1-09       tgt------ctcagagc------------------aaccgggagctggtg
P10417_BCL2-01         tgg------cgcaagccgggagaacagggtatgataaccgggagatcgtg
P97287_MCL1-01         cgg------cgccagcctcggcgcgggcggcggttctccggca----ggg
P70345_BCL2L2-02       --------------------------------------------------
P70345_BCL2L2-01       cga------ccccagcctcaaccccagacacacgggctc--ta----gtg
                                                                         

O55178_BCL2A1-01       ctcatgcatatccact----------------------------------
Q0P538_BCL2A1-01       ctcatgcatatccact----------------------------------
Q07440_BCL2A1-01       ctcatgcatatccact----------------------------------
O55179_BCL2A1-01       ttcatgtatatccact----------------------------------
Q8K164_BCL2A1-01       ttcatgtatatccact----------------------------------
Q4FK02_BCL2A1-01       ttcatgtatatccact----------------------------------
O55177_BCL2A1-02       ttcatgtatatccact----------------------------------
Q497M6_BCL2A1-01       ttcatgtatatccact----------------------------------
Q9Z0F3_BCL2L10-01      tctgactacatattct----------------------------------
O35843_BCL2L1-01       gtcgactttctctcctacaagctttcccagaaaggatacagctggagtca
Q64373_BCL2L1-01       gtcgactttctctcctacaagctttcccagaaaggatacagctggagtca
Q64373_BCL2L1-09       gtcgactttctctcctacaagctttcccagaaaggatacagctggagtca
P10417_BCL2-01         atgaagtacatacattataagctgtcacagaggggctacgagtgg-----
P97287_MCL1-01         gcgcgcctggtggccgaggaggccaaggcgcggcgcgagggggga-----
P70345_BCL2L2-02       --------------------------------------------------
P70345_BCL2L2-01       gctgactttgtaggctataagctgaggcagaagggttatgtctgt-----
                                                                         

O55178_BCL2A1-01       --------------------------------ccctggctgag-------
Q0P538_BCL2A1-01       --------------------------------ccctggctgag-------
Q07440_BCL2A1-01       --------------------------------ccctggctgag-------
O55179_BCL2A1-01       --------------------------------ccctggctgag-------
Q8K164_BCL2A1-01       --------------------------------ccctggctgag-------
Q4FK02_BCL2A1-01       --------------------------------ccctggctgag-------
O55177_BCL2A1-02       --------------------------------ccctggctgag-------
Q497M6_BCL2A1-01       --------------------------------ccctggctgag-------
Q9Z0F3_BCL2L10-01      -----------tctgcgcacgggagccggacaccccagag----------
O35843_BCL2L1-01       gtttagtgatgttgaagagaataggactgaggccccagaagaaact----
Q64373_BCL2L1-01       gtttagtgatgtcgaagagaataggactgaggccccagaagaaact----
Q64373_BCL2L1-09       gtttagtgatgtcgaagagaataggactgaggccccagaagaaact----
P10417_BCL2-01         -------gatgctggagatgcggacgcggcgcccctgggggctgccccca
P97287_MCL1-01         -------ggggaggccgccctgctgcccggcgcgcgggtggtcgcccggc
P70345_BCL2L2-02       --------------------------------------------------
P70345_BCL2L2-01       -------ggagctg-----------------gccctggggaaggcccagc
                                                                         

O55178_BCL2A1-01       --------------------------------------------------
Q0P538_BCL2A1-01       --------------------------------------------------
Q07440_BCL2A1-01       --------------------------------------------------
O55179_BCL2A1-01       --------------------------------------------------
Q8K164_BCL2A1-01       --------------------------------------------------
Q4FK02_BCL2A1-01       --------------------------------------------------
O55177_BCL2A1-02       --------------------------------------------------
Q497M6_BCL2A1-01       --------------------------------------------------
Q9Z0F3_BCL2L10-01      --------------------------------------------------
O35843_BCL2L1-01       --------------------------------------------------
Q64373_BCL2L1-01       --------------------------------------------------
Q64373_BCL2L1-09       --------------------------------------------------
P10417_BCL2-01         cccctggcatcttctccttccagcctgagagcaaccca------------
P97287_MCL1-01         cgccgcccgtgggcgccgaggaccccgacgtcaccgcgtcggccgaaagg
P70345_BCL2L2-02       --------------------------------------------------
P70345_BCL2L2-01       cgccgacccgctgcacc---------------------------------
                                                                         

O55178_BCL2A1-01       --------------------------------------------------
Q0P538_BCL2A1-01       --------------------------------------------------
Q07440_BCL2A1-01       --------------------------------------------------
O55179_BCL2A1-01       --------------------------------------------------
Q8K164_BCL2A1-01       --------------------------------------------------
Q4FK02_BCL2A1-01       --------------------------------------------------
O55177_BCL2A1-02       --------------------------------------------------
Q497M6_BCL2A1-01       --------------------------------------------------
Q9Z0F3_BCL2L10-01      --------------------------------------------------
O35843_BCL2L1-01       ---------------------------------gaagcagagagggagac
Q64373_BCL2L1-01       ---------------------------------gaagcagagagggagac
Q64373_BCL2L1-09       ---------------------------------gaagcagagagggagac
P10417_BCL2-01         ---------atgcccgctgtgcaccgggacatggctgccaggacgtctcc
P97287_MCL1-01         cggctgcataagtcgcccggcctcctcgccgtgccgcccgaggagatggc
P70345_BCL2L2-02       --------------------------------------------------
P70345_BCL2L2-01       ---------aagccatgcgggctgct---------------ggagacgag
                                                                         

O55178_BCL2A1-01       ---------cactaccttcagtatgtgctacag-----------------
Q0P538_BCL2A1-01       ---------cactaccttcagtatgtgctacag-----------------
Q07440_BCL2A1-01       ---------cactaccttcagtatgtgctacag-----------------
O55179_BCL2A1-01       ---------cactaccttcagtatgtgctacag-----------------
Q8K164_BCL2A1-01       ---------cactatcttcagtatgtgctacag-----------------
Q4FK02_BCL2A1-01       ---------cactatcttcagtatgtgctacag-----------------
O55177_BCL2A1-02       ---------cactatcttcagtatgtgctacag-----------------
Q497M6_BCL2A1-01       ---------cactatcttcagtatgtgctacag-----------------
Q9Z0F3_BCL2L10-01      -----------ccaccgcccacgtctgtcgagg-----------------
O35843_BCL2L1-01       ccccagtgccatcaatggcaacccatcctggca-----------------
Q64373_BCL2L1-01       ccccagtgccatcaatggcaacccatcctggca-----------------
Q64373_BCL2L1-09       ccccagtgccatcaatggcaacccatcctggca-----------------
P10417_BCL2-01         tctcaggcccctcgttgccaccgc--------------------------
P97287_MCL1-01         cgcgtcggccgccgccgccatcgtgtctccggaggaggaactggacggct
P70345_BCL2L2-02       --------------------------------------------------
P70345_BCL2L2-01       tttgagacccgtttccgccgcaccttctctg--------acctggccgct
                                                                         

O55178_BCL2A1-01       ----------------------gtacccgcctttgagtcggc--------
Q0P538_BCL2A1-01       ----------------------gtacccgcctttgagtcggc--------
Q07440_BCL2A1-01       ----------------------gtacccgcctttgagtcggc--------
O55179_BCL2A1-01       ----------------------gtacccgcctttgagtcggc--------
Q8K164_BCL2A1-01       ----------------------gtacccgcctttgagtcggc--------
Q4FK02_BCL2A1-01       ----------------------gtacccgcctttgagtcggc--------
O55177_BCL2A1-02       ----------------------gtacccgcctttgagtcggc--------
Q497M6_BCL2A1-01       ----------------------gtacccgcctttgagtcggc--------
Q9Z0F3_BCL2L10-01      ---------------------------cggccttgcttcgct--------
O35843_BCL2L1-01       -------------cctggcggatagcccggccgtga--------------
Q64373_BCL2L1-01       -------------cctggcggatagcccggccgtga--------------
Q64373_BCL2L1-09       -------------cctggcggatagcccggccgtga--------------
P10417_BCL2-01         ---------------tgggcctgcgctcagccctgtgccacctgtggtcc
P97287_MCL1-01         gcgagccggaggccatcggcaagcgcccggccgtgctgcccc-----tcc
P70345_BCL2L2-02       --------------------------------------------------
P70345_BCL2L2-01       cagctacacgtgaccccaggctcagcccagcaacgcttcacccaggtttc
                                                                         

O55178_BCL2A1-01       ------------------------------tccaagcca-----------
Q0P538_BCL2A1-01       ------------------------------tccaagcca-----------
Q07440_BCL2A1-01       ------------------------------tccaagcca-----------
O55179_BCL2A1-01       ------------------------------tccaagcca-----------
Q8K164_BCL2A1-01       ------------------------------tccaagcca-----------
Q4FK02_BCL2A1-01       ------------------------------tccaagcaa-----------
O55177_BCL2A1-02       ------------------------------tccaagcca-----------
Q497M6_BCL2A1-01       ------------------------------tccaagcaa-----------
Q9Z0F3_BCL2L10-01      ------------------------------ctgtgacta-----------
O35843_BCL2L1-01       ------------------------------atggagccactggc------
Q64373_BCL2L1-01       ------------------------------atggagccactggc------
Q64373_BCL2L1-09       ------------------------------atggagccactggc------
P10417_BCL2-01         atctgaccctccgccggg------------ctggggatgacttctct---
P97287_MCL1-01         tggagcgcgtgagcgaggcggccaagagctccggggccgacggctctctg
P70345_BCL2L2-02       --------------------------------------------------
P70345_BCL2L2-01       cgacgaacttttccaagggggccctaa---ctggggccgtcttgtggcat
                                                                         

O55178_BCL2A1-01       --------------------------------------------------
Q0P538_BCL2A1-01       --------------------------------------------------
Q07440_BCL2A1-01       --------------------------------------------------
O55179_BCL2A1-01       --------------------------------------------------
Q8K164_BCL2A1-01       --------------------------------------------------
Q4FK02_BCL2A1-01       --------------------------------------------------
O55177_BCL2A1-02       --------------------------------------------------
Q497M6_BCL2A1-01       --------------------------------------------------
Q9Z0F3_BCL2L10-01      -------ggcagatccagc-------------------------------
O35843_BCL2L1-01       -------cacagcagcagtttggatgcgcggg------------------
Q64373_BCL2L1-01       -------cacagcagcagtttggatgcgcggg------------------
Q64373_BCL2L1-09       -------cacagcagcagtttggatgcgcggg------------------
P10417_BCL2-01         -------cgtcgctaccgtc------------------------------
P97287_MCL1-01         ccctccacgccgccgccgcccgaggaggaagaggacgacctataccgcca
P70345_BCL2L2-02       --------------------------------------------------
P70345_BCL2L2-01       tctttgtctttggggctgccctgtgtg-----------------------
                                                                         

O55178_BCL2A1-01       --------------------------------agcattcagagtgctaca
Q0P538_BCL2A1-01       --------------------------------agcattcagagtgctaca
Q07440_BCL2A1-01       --------------------------------agcatgcagagtgctaca
O55179_BCL2A1-01       --------------------------------agcatgcagagtgctaca
Q8K164_BCL2A1-01       --------------------------------agcatgcagagtgctaca
Q4FK02_BCL2A1-01       --------------------------------agcatgcagagtgctaca
O55177_BCL2A1-02       --------------------------------agcatgcagagtgctaca
Q497M6_BCL2A1-01       --------------------------------agcatgcagagtgctaca
Q9Z0F3_BCL2L10-01      ----------------------------------------aggagcacca
O35843_BCL2L1-01       -----------------------------------aggtgattcccatgg
Q64373_BCL2L1-01       -----------------------------------aggtgattcccatgg
Q64373_BCL2L1-09       -----------------------------------aggtgattcccatgg
P10417_BCL2-01         -----------------------------------------gtgacttcg
P97287_MCL1-01         gtcgctggagatcatctcgcgctacttgcgggagcaggcgaccggctcca
P70345_BCL2L2-02       --------------------------------------------------
P70345_BCL2L2-01       -----------------------------------ctgagagtgtcaaca
                                                                         

O55178_BCL2A1-01       aagagttgctttctccgttcagaaggaagttggaaagaacctaaa----g
Q0P538_BCL2A1-01       aagagttgctttctccgttcagaaggaagttggaaagaacctaaa----g
Q07440_BCL2A1-01       aagagttgctttctccgttcagaaggaagttgaaaagaatctgaa----g
O55179_BCL2A1-01       aagagttgctttctccgttcagaaggaagttgaaaagaatctgaa----g
Q8K164_BCL2A1-01       aagagttgctttctccgttcagaaggaagttgaaaagaatctgaa----g
Q4FK02_BCL2A1-01       aagagttgctttctccgttcagaaggaagttgaaaagaatctgaa----g
O55177_BCL2A1-02       aagagttgctttctccgttcagaaggaagttgaaaagaatctgaa----g
Q497M6_BCL2A1-01       aagagttgctttctccgttcagaaggaagttgaaaagaatctgaa----g
Q9Z0F3_BCL2L10-01      agaatttttttcctccttctgcgaaagccggggcaatcgcctggag----
O35843_BCL2L1-01       cagcagtgaagcaagcgctgagagaggcaggcg-atgagtttgaactgcg
Q64373_BCL2L1-01       cagcagtgaagcaagcgctgagagaggcaggcg-atgagtttgaactgcg
Q64373_BCL2L1-09       cagcagtgaagcaagcgctgagagaggcaggcg-atgagtttgaactgcg
P10417_BCL2-01         cagagat-------------gtccagtcagctgca---------------
P97287_MCL1-01         aggactcgaagc---ctctgggcgaggcgggcgcggcgggccggagagcg
P70345_BCL2L2-02       -----atggagc---cttt-ggtgggacaagtgca--ggattggatggtg
P70345_BCL2L2-01       aagaaatggagc---cttt-ggtgggacaagtgca--ggattggatggtg
                                                                         

O55178_BCL2A1-01       tcatacttggatgactttcac-----------------------------
Q0P538_BCL2A1-01       tcatacttggatgactttcac-----------------------------
Q07440_BCL2A1-01       tcatacttggatgactttcac-----------------------------
O55179_BCL2A1-01       tcatacttggatgactttcac-----------------------------
Q8K164_BCL2A1-01       tcatacttggatgactttcac-----------------------------
Q4FK02_BCL2A1-01       tcatacttggatgactttcac-----------------------------
O55177_BCL2A1-02       tcatacttggatgactttcac-----------------------------
Q497M6_BCL2A1-01       tcatacttggatgactttcac-----------------------------
Q9Z0F3_BCL2L10-01      ------ctggtga-------------------------------------
O35843_BCL2L1-01       gta---ccggagagcgttcagtgatctaacatcccagcttcacataa---
Q64373_BCL2L1-01       gta---ccggagagcgttcagtgatctaacatcccagcttcacataa---
Q64373_BCL2L1-09       gta---ccggagagcgttcagtgatctaacatcccagcttcacataa---
P10417_BCL2-01         ------cctgacgcccttcaccgcgagg------ggacgctttgcca---
P97287_MCL1-01         ------ctggagaccctgcggcgcgtgggcgacggcgtgcagcgcaacca
P70345_BCL2L2-02       gcctacctggagac------acgtctggctgactggatccacagcag---
P70345_BCL2L2-01       gcctacctggagac------acgtctggctgactggatccacagcag---
                                *                                        

O55178_BCL2A1-01       ---------------gtggaatccatagataccaccagaataatattcaa
Q0P538_BCL2A1-01       ---------------gtggaatccatagataccaccagaataatattcaa
Q07440_BCL2A1-01       ---------------gtggaatccatagataccgccagaataatattcaa
O55179_BCL2A1-01       ---------------gtggaatccatagataccgccagaataatattcaa
Q8K164_BCL2A1-01       ---------------gtggaatccatagataccgccagaataatattcaa
Q4FK02_BCL2A1-01       ---------------gtggaatccatagataccgccagaataatattcaa
O55177_BCL2A1-02       ---------------gtggaatccatagataccgccagaataatattcaa
Q497M6_BCL2A1-01       ---------------gtggaatccatagataccgccagaataatattcaa
Q9Z0F3_BCL2L10-01      -------------------------------------------------a
O35843_BCL2L1-01       ----------------------ccccagggaccgcgtatcagagctttga
Q64373_BCL2L1-01       ----------------------ccccagggaccgcgtatcagagctttga
Q64373_BCL2L1-09       ----------------------ccccagggaccgcgtatcagagctttga
P10417_BCL2-01         --------------------------------------------------
P97287_MCL1-01         cgagacggccttccagggcatgctccggaaactggacattaaaaacgaag
P70345_BCL2L2-02       -------------------------tgggggctg---------------g
P70345_BCL2L2-01       -------------------------tgggggctg---------------g
                                                                         

O55178_BCL2A1-01       ccaagtgatggaaaaa---gagtttgaagatggcatc-------------
Q0P538_BCL2A1-01       ccaagtgatggaaaaa---gagtttgaaaatggcatc-------------
Q07440_BCL2A1-01       ccaagtgatggaaaaa---gagtttgaagatggcatc-------------
O55179_BCL2A1-01       ccaagtgatggaaaaa---gagtttgaagatggcatc-------------
Q8K164_BCL2A1-01       ccaagtgatggaaaaa---gagtttgaagatggcatc-------------
Q4FK02_BCL2A1-01       ccaagtgatggaaaaa---gagtttgaagatggcatc-------------
O55177_BCL2A1-02       ccaagtgatggaaaaa---gagtttgaagatggcatc-------------
Q497M6_BCL2A1-01       ccaagtgatggaaaaa---gagtttgaagatggcatc-------------
Q9Z0F3_BCL2L10-01      acagatggcagataagttgctctccaaagaccaagac-------------
O35843_BCL2L1-01       gcaggtagtgaatgaa---ctctttcgggatggagta-------------
Q64373_BCL2L1-01       gcaggtagtgaatgaa---ctctttcgggatggagta-------------
Q64373_BCL2L1-09       gcaggtagtgaatgaa---ctctttcgggatggagta-------------
P10417_BCL2-01         -c-ggtggtggaggaa---ctcttcagggatggggtg-------------
P97287_MCL1-01         gc-gatgttaaatctt---tttctcgagtaatggtccatgttttcaaaga
P70345_BCL2L2-02       gc-ggagttcacagct---ctatacggggacggggcc-------------
P70345_BCL2L2-01       gc-ggagttcacagct---ctatacggggacggggcc-------------
                        *                           *                    

O55178_BCL2A1-01       -------attaattggggaaggattgtgactatatttgccttt-------
Q0P538_BCL2A1-01       -------attaattggggaaggattgtgactatatttgccttt-------
Q07440_BCL2A1-01       -------attaactggggaaggattgtgactatatttgccttt-------
O55179_BCL2A1-01       -------attaactggggaaggattgtgactatatttgccttt-------
Q8K164_BCL2A1-01       -------attaactggggaaggattgtgactatatttgccttt-------
Q4FK02_BCL2A1-01       -------attaactggggaaggattgtgactatatttgccttt-------
O55177_BCL2A1-02       -------attaactggggaaggattgtgactatatttgccttt-------
Q497M6_BCL2A1-01       -------attaactggggaaggattgtgactatatttgccttt-------
Q9Z0F3_BCL2L10-01      -------ttcagctggagccaactggtgatgctcctggccttcgcgggga
O35843_BCL2L1-01       ----------aactggggtcgcatcgtggcctttttctccttt-----gg
Q64373_BCL2L1-01       ----------aactggggtcgcatcgtggcctttttctccttt-----gg
Q64373_BCL2L1-09       ----------aactggggtcgcatcgtggcctttttctccttt-----gg
P10417_BCL2-01         ----------aactgggggaggattgtggccttctttgagttc-----gg
P97287_MCL1-01         tggcgtaacaaactggggcaggattgtgactcttatttctttc-----gg
P70345_BCL2L2-02       ------------ctggaggagg------------------cac-----gg
P70345_BCL2L2-01       ------------ctggaggagg------------------cac-----gg
                                    *** *                                

O55178_BCL2A1-01       ------gggggtgttctcctcaaaaaaacttccacaagagcagatt----
Q0P538_BCL2A1-01       ------gggggtgttctcctcaaaaaaacttccacaagagcagatt----
Q07440_BCL2A1-01       ------gggggtgttctcctc-aaaaaacttccacaagagcagatt----
O55179_BCL2A1-01       ------gggggtgttctcctc-aaaaaacttccacaagagcagatt----
Q8K164_BCL2A1-01       ------gggggtgttctcctc-aaaaaacttccgcaagagcagatt----
Q4FK02_BCL2A1-01       ------gggggtgttctcctc-aaaaaacttccgcaagagcagatt----
O55177_BCL2A1-02       ------gggggtgttctcctc-aaaaaacttccgcaagagcagatt----
Q497M6_BCL2A1-01       ------gggggtgttctcctc-aaaaaacttccgcaagagcagatt----
Q9Z0F3_BCL2L10-01      cgcttatgaatcaaggcccttacatggctgtcaagcagaagaggga----
O35843_BCL2L1-01       ------cggggcactgtgcgtggaaagc-gtagacaaggagatgca----
Q64373_BCL2L1-01       ------cggggcactgtgcgtggaaagc-gtagacaaggagatgca----
Q64373_BCL2L1-09       ------cggggcactgtgcgtggaaagc-gtagacaaggagatgca----
P10417_BCL2-01         ------tggggtcatgtgtgtggagagc-gtcaacagggagatgtc----
P97287_MCL1-01         tgcctttgtggccaaacacttaaagagc-gtaaaccaagaaagcttcatc
P70345_BCL2L2-02       cgtctgcg------------------------------------------
P70345_BCL2L2-01       cgtctgcg------------------------------------------
                              *                                          

O55178_BCL2A1-01       ---gccctggatgtacgtgct-----------------------------
Q0P538_BCL2A1-01       ---gccctggatgtacgtgct-----------------------------
Q07440_BCL2A1-01       ---gccctggatgtatgtgct-----------------------------
O55179_BCL2A1-01       ---gccctggatgtaggtgct-----------------------------
Q8K164_BCL2A1-01       ---gccctggatgtaggtgct-----------------------------
Q4FK02_BCL2A1-01       ---gccctggatgtaggtgct-----------------------------
O55177_BCL2A1-02       ---gccctggatgtaggtgct-----------------------------
Q497M6_BCL2A1-01       ---gccctggatgtaggtgct-----------------------------
Q9Z0F3_BCL2L10-01      -----tctggggaatcgtgtcatagtgacccgagactgctgtctcatagt
O35843_BCL2L1-01       --ggtattggtgagtcggatt-----------------------------
Q64373_BCL2L1-01       --ggtattggtgagtcggatt-----------------------------
Q64373_BCL2L1-09       --ggtattggtgagtcggatt-----------------------------
P10417_BCL2-01         --acccctggtggacaacatc-----------------------------
P97287_MCL1-01         gaaccattagcagaaactatc-----------------------------
P70345_BCL2L2-02       --------------------------------------------------
P70345_BCL2L2-01       --------------------------------------------------
                                                                         

O55178_BCL2A1-01       ------tacaaacaagtttccagttttggggcagaattcataatgaataa
Q0P538_BCL2A1-01       ------tacaaacaagtttccagttttggggcagaattcatcatgaataa
Q07440_BCL2A1-01       ------tacaaacaagtttccagttttgtggcagaattcataatgaataa
O55179_BCL2A1-01       ------tacaaacaagtttccagttttgtggcagaattcataatgaataa
Q8K164_BCL2A1-01       ------tacaaacaagtttccagttttgtggcagaattcataatcaataa
Q4FK02_BCL2A1-01       ------tacaaacaagtttccagttttgtggcagaattcataatcaataa
O55177_BCL2A1-02       ------tacaaacaagtttccagttttgtggcagaattcataatcaataa
Q497M6_BCL2A1-01       ------tacaaacaagtttccagttttgtggcagaattcataatcaataa
Q9Z0F3_BCL2L10-01      gaactttctgtataatctgctcatggggcgtcggcacc---gcgccaggc
O35843_BCL2L1-01       --gcaagttggatggccacctatct--gaatgaccacctagagccttgga
Q64373_BCL2L1-01       --gcaagttggatggccacctatct--gaatgaccacctagagccttgga
Q64373_BCL2L1-09       --gcaagttggatggccacctatct--gaatgaccacctagagccttgga
P10417_BCL2-01         --gccctgtggatgactgagtacct--gaaccggcatctgcacacctgga
P97287_MCL1-01         --ac-----agatgttcttgtaaggacgaaacggga---------ctggc
P70345_BCL2L2-02       ---------------------------ggaggggaa---------ctg--
P70345_BCL2L2-01       ---------------------------ggaggggaa---------ctg--
                                                  *       *              

O55178_BCL2A1-01       --------------------------------------------------
Q0P538_BCL2A1-01       --------------------------------------------------
Q07440_BCL2A1-01       cacaggagaatggatacggca------------gaatggaggttgggaag
O55179_BCL2A1-01       cacaggagaatggatacggcg------------gaatggaggttgggaag
Q8K164_BCL2A1-01       cacaggagaatggatacggcg------------gaatggaggttgggaag
Q4FK02_BCL2A1-01       cacaggagaatggatacggcg------------gaatggaggttgggaag
O55177_BCL2A1-02       cacaggagaatggatacggcg------------gaatggaggttgggaag
Q497M6_BCL2A1-01       cacaggagaatggatacggcg------------gaatggaggttgggaag
Q9Z0F3_BCL2L10-01      tggaggctctcggcggctggg--------------atggcttt---tgcc
O35843_BCL2L1-01       tccaggagaacggcggctggggtgtgagtggaggtacacccct-cagatc
Q64373_BCL2L1-01       tccaggagaacggcggctggg--------------acacttttgtggatc
Q64373_BCL2L1-09       tccaggagaacggcggctggg--------------acacttttgtggatc
P10417_BCL2-01         tccaggataacggaggctggg--------------atgcctttgtggaac
P97287_MCL1-01         ttgtcaaacaaagaggctggg--------------atgggtttgtggagt
P70345_BCL2L2-02       ------------------ggc--------------atcagtgaggacagt
P70345_BCL2L2-01       ------------------ggc--------------atcagtgaggacagt
                                                                         

O55178_BCL2A1-01       --------------------------------------------------
Q0P538_BCL2A1-01       --------------------------------------------------
Q07440_BCL2A1-01       atggcttcataaagaagtttgaacccaaatctgg----------------
O55179_BCL2A1-01       atggcttcataaagaagtttgaacccaaatctgg----------------
Q8K164_BCL2A1-01       atggcttcataaagaagtttgaacccaaatctgg----------------
Q4FK02_BCL2A1-01       atggcttcataaagaagtttgaacccaaatctgg----------------
O55177_BCL2A1-02       atggcttcataaagaagtttgaacccaaatctgg----------------
Q497M6_BCL2A1-01       atggcttcataaagaagtttgaacccaaatctgg----------------
Q9Z0F3_BCL2L10-01      gcttcttcaagaatcctttaccgctcggcttctggagaa--------gat
O35843_BCL2L1-01       tgt-cttcagaaggcttgt-----tcaagtgccaggagtggc-ggagcac
Q64373_BCL2L1-01       --t-ctacgggaacaatgcagcagccgagagccggaaaggccaggagcgc
Q64373_BCL2L1-09       --t-ctacgggaacaatgcagcagccgagagccggaaaggccaggagcgc
P10417_BCL2-01         tat--------atggccccagcatgcgacctctgtttgatttctcctggc
P97287_MCL1-01         tcttccacgtacaggacctagaaggcggcatcag-------------aaa
P70345_BCL2L2-02       gct-----------gacgggggccgtggcactgg-------------gg-
P70345_BCL2L2-01       gct-----------gacgggggccgtggcactgg-------------gg-
                                                                         

O55178_BCL2A1-01       --------------------------------------------------
Q0P538_BCL2A1-01       --------------------------------------------------
Q07440_BCL2A1-01       ----ctggctgacttttctg------------cagatgacaggacagatc
O55179_BCL2A1-01       ----ctggctgacttttctg------------cagatgacaggacagatc
Q8K164_BCL2A1-01       ----ctggctgacttttctg------------cagatgacaggacagatc
Q4FK02_BCL2A1-01       ----ctggctgacttttctg------------cagatgacaggacagttc
O55177_BCL2A1-02       ----ctggctgacttttctg------------cagatgacaggacagttc
Q497M6_BCL2A1-01       ----ctggctgacttttctg------------cagatgacaggacagttc
Q9Z0F3_BCL2L10-01      tgctgattcaggcttttctg--tcaggcttctttgcaacagccatctttt
O35843_BCL2L1-01       gtttg----tgatcccagcctttgggaggtggaaacagaaggatcggaag
Q64373_BCL2L1-01       ttcaaccgctggttcctgac----gggcatgactgtggctggtgtggttc
Q64373_BCL2L1-09       ttcaaccgctggttcctgac----gggcatgactgtggctggtgtggttc
P10417_BCL2-01         tgtctctgaagaccctgctc-----agcctggccctggtcggggcctgca
P97287_MCL1-01         tgtg-ctgctggcttttgcg-----ggtgttgctggagtaggggctggtc
P70345_BCL2L2-02       -gcc-ctggtaact-----------------------gtaggggcctttt
P70345_BCL2L2-01       -gcc-ctggtaact-----------------------gtaggggcctttt
                                                                         

O55178_BCL2A1-01       ---------------------------------
Q0P538_BCL2A1-01       ---------------------------------
Q07440_BCL2A1-01       t-----gggaaatgctctttctcctcaagtaa-
O55179_BCL2A1-01       t-----gggaaatgctctttctcctcaagtaa-
Q8K164_BCL2A1-01       t-----gggaaatgctctttctcctcaagtaa-
Q4FK02_BCL2A1-01       t-----gggaaatgctctttctcctcaagtag-
O55177_BCL2A1-02       t-----gggaaatgctctttctcctcaagtaa-
Q497M6_BCL2A1-01       t-----gggaaatgctctttctcctcaagtaa-
Q9Z0F3_BCL2L10-01      t-tatctggaaacgtttataa------------
O35843_BCL2L1-01       t---tcaaggcc--ctcctcagctattatag--
Q64373_BCL2L1-01       t---gctgggctcactcttcagtcggaagtga-
Q64373_BCL2L1-09       t---gctgggctcactcttcagtcggaagtga-
P10417_BCL2-01         tcactctgggtgcatacctgggccacaagtga-
P97287_MCL1-01         t---------ggcatatctaa----taagatag
P70345_BCL2L2-02       t---------tg-----ctag----caagtga-
P70345_BCL2L2-01       t---------tg-----ctag----caagtga-
                                                        

© 1998-2020Legal notice