Dataset for CDS BCL-2-like of organism Mus musculus

[Download (right click)] [Edit] [Sequences] [Repertoires]

25 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


O55178_BCL2A1-01       atggc------------------------------tgagtacgagctcat
Q07440_BCL2A1-01       atggc------------------------------tgagtctgagctcat
Q4FK02_BCL2A1-01       atgtc------------------------------tgagtacgagttcat
O55177_BCL2A1-02       atggc------------------------------tgagtacgagttcat
Q8K164_BCL2A1-01       atggc------------------------------tgagtacgagttcat
Q9Z0F3_BCL2L10-01      atggc---------------------cgactcgcaggacccactgcatga
O35843_BCL2L1-01       atgtctcaga------------------gcaaccgggagctggtggtcga
Q64373_BCL2L1-03       atgtctcaga------------------gcaaccgggagctggtggtcga
Q64373_BCL2L1-04       atgtctcaga------------------gcaaccgggagctggtggtcga
Q5HZH3_BCL2L1-02       atgtctcaga------------------gcaaccgggagctggtggtcga
Q64373_BCL2L1-01       atgtctcaga------------------gcaaccgggagctggtggtcga
Q64373_BCL2L1-05       atgtctcaga------------------gcaaccgggagctggtggtcga
Q64373_BCL2L1-06       atgtctcaga------------------gcaaccgggagctggtggtcga
Q64373_BCL2L1-07       atgtctcaga------------------gcaaccgggagctggtggtcga
Q64373_BCL2L1-08       atgtctcaga------------------gcaaccgggagctggtggtcga
Q64373_BCL2L1-09       atgtctcaga------------------gcaaccgggagctggtggtcga
P10417_BCL2-01         atggcgcaagccgggagaacagggtatgataaccgggagatcgtgatgaa
P10417_BCL2-02         atggcgcaagccgggagaacagggtatgataaccgggagatcgtgatgaa
Q6NTH7_BCL2-01         atggcgcaagccgggagaacagggtatgataaccgggagatcgtgatgaa
P97287_MCL1-01         atgtt-tggcctgcggagaaacgcggtcatcggcttgaacctgtactgcg
P97287_MCL1-02         atgtt-tggcctgcggagaaacgcggtcatcggcttgaacctgtactgcg
P70345_BCL2L2-01       atggc---------------------------------------------
P70345_BCL2L2-02       --------------------------------------------------
P70345_BCL2L2-03       atggc---------------------------------------------
P70345_BCL2L2-04       atggc---------------------------------------------
                                                                         

O55178_BCL2A1-01       gcatatccactccctg----------------------------------
Q07440_BCL2A1-01       gcatatccactccctg----------------------------------
Q4FK02_BCL2A1-01       gtatatccactccctg----------------------------------
O55177_BCL2A1-02       gtatatccactccctg----------------------------------
Q8K164_BCL2A1-01       gtatatccactccctg----------------------------------
Q9Z0F3_BCL2L10-01      acgcac--------------------------------------------
O35843_BCL2L1-01       ctttctctcctacaag----------------------------------
Q64373_BCL2L1-03       ctttctctcctacaag----------------------------------
Q64373_BCL2L1-04       ctttctctcctacaag----------------------------------
Q5HZH3_BCL2L1-02       ctttctctcctacaag----------------------------------
Q64373_BCL2L1-01       ctttctctcctacaag----------------------------------
Q64373_BCL2L1-05       ctttctctcctacaag----------------------------------
Q64373_BCL2L1-06       ctttctctcctacaag----------------------------------
Q64373_BCL2L1-07       ctttctctcctacaag----------------------------------
Q64373_BCL2L1-08       ctttctctcctacaag----------------------------------
Q64373_BCL2L1-09       ctttctctcctacaag----------------------------------
P10417_BCL2-01         gtacatacattataag----------------------------------
P10417_BCL2-02         gtacatacattataag----------------------------------
Q6NTH7_BCL2-01         gtacatacattataag----------------------------------
P97287_MCL1-01         gcggcgccagcctcggcgcgggcggcggttctccggcaggggcgcgcctg
P97287_MCL1-02         gc------------------------------------------------
P70345_BCL2L2-01       --------------------------------------------------
P70345_BCL2L2-02       --------------------------------------------------
P70345_BCL2L2-03       --------------------------------------------------
P70345_BCL2L2-04       --------------------------------------------------
                                                                         

O55178_BCL2A1-01       --------------------------------------------------
Q07440_BCL2A1-01       --------------------------------------------------
Q4FK02_BCL2A1-01       --------------------------------------------------
O55177_BCL2A1-02       --------------------------------------------------
Q8K164_BCL2A1-01       --------------------------------------------------
Q9Z0F3_BCL2L10-01      --------------------------------------------------
O35843_BCL2L1-01       --------------------------------------------------
Q64373_BCL2L1-03       --------------------------------------------------
Q64373_BCL2L1-04       --------------------------------------------------
Q5HZH3_BCL2L1-02       --------------------------------------------------
Q64373_BCL2L1-01       --------------------------------------------------
Q64373_BCL2L1-05       --------------------------------------------------
Q64373_BCL2L1-06       --------------------------------------------------
Q64373_BCL2L1-07       --------------------------------------------------
Q64373_BCL2L1-08       --------------------------------------------------
Q64373_BCL2L1-09       --------------------------------------------------
P10417_BCL2-01         --------------------------------------------------
P10417_BCL2-02         --------------------------------------------------
Q6NTH7_BCL2-01         --------------------------------------------------
P97287_MCL1-01         gtggccgaggaggccaaggcgcggcgcgaggggggaggggaggccgccct
P97287_MCL1-02         --------------------------------------------------
P70345_BCL2L2-01       --------------------------------------------------
P70345_BCL2L2-02       --------------------------------------------------
P70345_BCL2L2-03       --------------------------------------------------
P70345_BCL2L2-04       --------------------------------------------------
                                                                         

O55178_BCL2A1-01       --------------------------------------------------
Q07440_BCL2A1-01       --------------------------------------------------
Q4FK02_BCL2A1-01       --------------------------------------------------
O55177_BCL2A1-02       --------------------------------------------------
Q8K164_BCL2A1-01       --------------------------------------------------
Q9Z0F3_BCL2L10-01      --------------------------------------------------
O35843_BCL2L1-01       --------------------------------------------------
Q64373_BCL2L1-03       --------------------------------------------------
Q64373_BCL2L1-04       --------------------------------------------------
Q5HZH3_BCL2L1-02       --------------------------------------------------
Q64373_BCL2L1-01       --------------------------------------------------
Q64373_BCL2L1-05       --------------------------------------------------
Q64373_BCL2L1-06       --------------------------------------------------
Q64373_BCL2L1-07       --------------------------------------------------
Q64373_BCL2L1-08       --------------------------------------------------
Q64373_BCL2L1-09       --------------------------------------------------
P10417_BCL2-01         --------------------------------------------------
P10417_BCL2-02         --------------------------------------------------
Q6NTH7_BCL2-01         --------------------------------------------------
P97287_MCL1-01         gctgcccggcgcgcgggtggtcgcccggccgccgcccgtgggcgccgagg
P97287_MCL1-02         ----------------------------------------ggcgccgagg
P70345_BCL2L2-01       -------------------------------------------------g
P70345_BCL2L2-02       --------------------------------------------------
P70345_BCL2L2-03       -------------------------------------------------g
P70345_BCL2L2-04       -------------------------------------------------g
                                                                         

O55178_BCL2A1-01       ----------------------------------------------gctg
Q07440_BCL2A1-01       ----------------------------------------------gctg
Q4FK02_BCL2A1-01       ----------------------------------------------gctg
O55177_BCL2A1-02       ----------------------------------------------gctg
Q8K164_BCL2A1-01       ----------------------------------------------gctg
Q9Z0F3_BCL2L10-01      -----------------tagacggctgctgtctgactacatattcttctg
O35843_BCL2L1-01       ----ctttcccagaaaggatacagctggagtcagtttagtgatgttgaag
Q64373_BCL2L1-03       ----ctttcccagaaaggatacagctggagtcagtttagtgatgtcgaag
Q64373_BCL2L1-04       ----ctttcccagaaaggatacagctggagtcagtttagtgatgtcgaag
Q5HZH3_BCL2L1-02       ----ctttcccagaaaggatacagctggagtcagtttagtgatgtcgaag
Q64373_BCL2L1-01       ----ctttcccagaaaggatacagctggagtcagtttagtgatgtcgaag
Q64373_BCL2L1-05       ----ctttcccagaaaggatacagctggagtcagtttagtgatgtcgaag
Q64373_BCL2L1-06       ----ctttcccagaaaggatacagctggagtcagtttagtgatgtcgaag
Q64373_BCL2L1-07       ----ctttcccagaaaggatacagctggagtcagtttagtgatgtcgaag
Q64373_BCL2L1-08       ----ctttcccagaaaggatacagctggagtcagtttagtgatgtcgaag
Q64373_BCL2L1-09       ----ctttcccagaaaggatacagctggagtcagtttagtgatgtcgaag
P10417_BCL2-01         ----ctgtcacagaggggctacgagtgg---------------gatgctg
P10417_BCL2-02         ----ctgtcacagaggggctacgagtgg---------------gatgctg
Q6NTH7_BCL2-01         ----ctgtcacagaggggctacgagtgg---------------gatgctg
P97287_MCL1-01         accccgacgtcaccgcgtcggccgaaag---------------gcggctg
P97287_MCL1-02         accccgacgtcaccgcgtcggccgaaag---------------gcggctg
P70345_BCL2L2-01       accccagcctca--------------------------------------
P70345_BCL2L2-02       --------------------------------------------------
P70345_BCL2L2-03       accccagcctca--------------------------------------
P70345_BCL2L2-04       accccagcctca--------------------------------------
                                                                         

O55178_BCL2A1-01       agca----------------------------------------------
Q07440_BCL2A1-01       agca----------------------------------------------
Q4FK02_BCL2A1-01       agca----------------------------------------------
O55177_BCL2A1-02       agca----------------------------------------------
Q8K164_BCL2A1-01       agca----------------------------------------------
Q9Z0F3_BCL2L10-01      cgcacgggagccggacaccccagag-------------------------
O35843_BCL2L1-01       agaataggactgaggccccagaagaaactgaagcagagagggagaccccc
Q64373_BCL2L1-03       agaataggactgaggccccagaagaaactgaagcagagagggagaccccc
Q64373_BCL2L1-04       agaataggactgaggccccagaagaaactgaagcagagagggagaccccc
Q5HZH3_BCL2L1-02       agaataggactgaggccccagaagaaactgaagcagagagggagaccccc
Q64373_BCL2L1-01       agaataggactgaggccccagaagaaactgaagcagagagggagaccccc
Q64373_BCL2L1-05       agaataggactgaggccccagaagaaactgaagcagagagggagaccccc
Q64373_BCL2L1-06       agaataggactgaggccccagaagaaactgaagcagagagggagaccccc
Q64373_BCL2L1-07       agaataggactgaggccccagaagaaactgaagcagagagggagaccccc
Q64373_BCL2L1-08       agaataggactgaggccccagaagaaactgaagcagagagggagaccccc
Q64373_BCL2L1-09       agaataggactgaggccccagaagaaactgaagcagagagggagaccccc
P10417_BCL2-01         gagatgcggacgcggcgcccctgggggctgc--cc---------------
P10417_BCL2-02         gagatgcggacgcggcgcccctgggggctgc--cc---------------
Q6NTH7_BCL2-01         gagatgcggacgcggcgcccctgggggctgc--cc---------------
P97287_MCL1-01         cataagtcgcccggcctcctcgccgtgccgc--ccgaggagatggccgcg
P97287_MCL1-02         cataagtcgcccggcctcctcgccgtgccgc--ccgaggagatggccgcg
P70345_BCL2L2-01       --------------------------------------------------
P70345_BCL2L2-02       --------------------------------------------------
P70345_BCL2L2-03       --------------------------------------------------
P70345_BCL2L2-04       --------------------------------------------------
                                                                         

O55178_BCL2A1-01       ----ctaccttcagtatgtgctacaggtaccc-------gcctttgagtc
Q07440_BCL2A1-01       ----ctaccttcagtatgtgctacaggtaccc-------gcctttgagtc
Q4FK02_BCL2A1-01       ----ctatcttcagtatgtgctacaggtaccc-------gcctttgagtc
O55177_BCL2A1-02       ----ctatcttcagtatgtgctacaggtaccc-------gcctttgagtc
Q8K164_BCL2A1-01       ----ctatcttcagtatgtgctacaggtaccc-------gcctttgagtc
Q9Z0F3_BCL2L10-01      ----ccaccgcccacgtct-----------gtcgaggcggccttgcttcg
O35843_BCL2L1-01       agtgccatcaatggcaacccatcctggcacctggcggatagccc------
Q64373_BCL2L1-03       agtgccatcaatggcaacccatcctggcacctggcggatagccc------
Q64373_BCL2L1-04       agtgccatcaatggcaacccatcctggcacctggcggatagccc------
Q5HZH3_BCL2L1-02       agtgccatcaatggcaacccatcctggcacctggcggatagccc------
Q64373_BCL2L1-01       agtgccatcaatggcaacccatcctggcacctggcggatagccc------
Q64373_BCL2L1-05       agtgccatcaatggcaacccatcctggcacctggcggatagccc------
Q64373_BCL2L1-06       agtgccatcaatggcaacccatcctggcacctggcggatagccc------
Q64373_BCL2L1-07       agtgccatcaatggcaacccatcctggcacctggcggatagccc------
Q64373_BCL2L1-08       agtgccatcaatggcaacccatcctggcacctggcggatagccc------
Q64373_BCL2L1-09       agtgccatcaatggcaacccatcctggcacctggcggatagccc------
P10417_BCL2-01         ----ccacccctggcatcttctccttccagcctgagagcaacccaatgcc
P10417_BCL2-02         ----ccacccctggcatcttctccttccagcctgagagcaacccaatgcc
Q6NTH7_BCL2-01         ----ccacccctggcatcttctccttccagcctgagagcaacccaatgcc
P97287_MCL1-01         tcggccgccgccgccatcgtgtct------ccggaggaggaact--ggac
P97287_MCL1-02         tcggccgccgccgccatcgtgtct------ccggaggaggaact--ggac
P70345_BCL2L2-01       ------accccagacacacgggct------ctagtggctgactt--tgta
P70345_BCL2L2-02       --------------------------------------------------
P70345_BCL2L2-03       ------accccagacacacgggct------ctagtggctgactt--tgta
P70345_BCL2L2-04       ------accccagacacacgggct------ctagtggctgactt--tgta
                                                                         

O55178_BCL2A1-01       ggctccaagccaagcattcag--agtgctacaaagagttgcttt------
Q07440_BCL2A1-01       ggctccaagccaagcatgcag--agtgctacaaagagttgcttt------
Q4FK02_BCL2A1-01       ggctccaagcaaagcatgcag--agtgctacaaagagttgcttt------
O55177_BCL2A1-02       ggctccaagccaagcatgcag--agtgctacaaagagttgcttt------
Q8K164_BCL2A1-01       ggctccaagccaagcatgcag--agtgctacaaagagttgcttt------
Q9Z0F3_BCL2L10-01      ctctgtgactaggcagatccagcaggagcaccaagaattttttt------
O35843_BCL2L1-01       ggccgtgaatgga-------gccactggccacagcagcagtttg------
Q64373_BCL2L1-03       ggccgtgaatgga-------gccactggccacagcagcagtttg------
Q64373_BCL2L1-04       ggccgtgaatgga-------gccactggccacagcagcagtttg------
Q5HZH3_BCL2L1-02       ggccgtgaatgga-------gccactggccacagcagcagtttg------
Q64373_BCL2L1-01       ggccgtgaatgga-------gccactggccacagcagcagtttg------
Q64373_BCL2L1-05       ggccgtgaatgga-------gccactggccacagcagcagtttg------
Q64373_BCL2L1-06       ggccgtgaatgga-------gccactggccacagcagcagtttg------
Q64373_BCL2L1-07       ggccgtgaatgga-------gccactggccacagcagcagtttg------
Q64373_BCL2L1-08       ggccgtgaatgga-------gccactggccacagcagcagtttg------
Q64373_BCL2L1-09       ggccgtgaatgga-------gccactggccacagcagcagtttg------
P10417_BCL2-01         cgctgtgcaccgg-------gacatggctgccaggacgtctcctctcagg
P10417_BCL2-02         cgctgtgcaccgg-------gacatggctgccaggacgtctcctctcagg
Q6NTH7_BCL2-01         cgctgtgcaccgg-------gacatggctgccaggacgtctcctctcagg
P97287_MCL1-01         ggctgcgagccgg-------a----ggccatcggcaagcgcccg------
P97287_MCL1-02         ggctgcgagccgg-------a----ggccatcggcaagcgcccg------
P70345_BCL2L2-01       ggctataagctga-------g----g-----cagaagggttatg------
P70345_BCL2L2-02       --------------------------------------------------
P70345_BCL2L2-03       ggctataagctga-------g----g-----cagaagggttatg------
P70345_BCL2L2-04       ggctataagctga-------g----g-----cagaagggttatg------
                                                                         

O55178_BCL2A1-01       --------------------------------------------------
Q07440_BCL2A1-01       --------------------------------------------------
Q4FK02_BCL2A1-01       --------------------------------------------------
O55177_BCL2A1-02       --------------------------------------------------
Q8K164_BCL2A1-01       --------------------------------------------------
Q9Z0F3_BCL2L10-01      --------------------------------------------------
O35843_BCL2L1-01       -----------------------------------------gatgcgcgg
Q64373_BCL2L1-03       -----------------------------------------gatgcgcgg
Q64373_BCL2L1-04       -----------------------------------------gatgcgcgg
Q5HZH3_BCL2L1-02       -----------------------------------------gatgcgcgg
Q64373_BCL2L1-01       -----------------------------------------gatgcgcgg
Q64373_BCL2L1-05       -----------------------------------------gatgcgcgg
Q64373_BCL2L1-06       -----------------------------------------gatgcgcgg
Q64373_BCL2L1-07       -----------------------------------------gatgcgcgg
Q64373_BCL2L1-08       -----------------------------------------gatgcgcgg
Q64373_BCL2L1-09       -----------------------------------------gatgcgcgg
P10417_BCL2-01         cccctcgttgccaccgctgggcc------------------tgcgctc--
P10417_BCL2-02         cccctcgttgccaccgctgggcc------------------tgcgctc--
Q6NTH7_BCL2-01         cccctcgttgccaccgctgggcc------------------tgcgctc--
P97287_MCL1-01         -gccgtgctgcccctcctggagcgcgtgagcgaggcggccaagagctccg
P97287_MCL1-02         -gccgtgctgcccctcctggagcgcgtgagcgaggcggccaagagctccg
P70345_BCL2L2-01       -tctgtggagctggccctgggg-------------------aaggccc--
P70345_BCL2L2-02       --------------------------------------------------
P70345_BCL2L2-03       -tctgtggagctggccctgggg-------------------aaggccc--
P70345_BCL2L2-04       -tctgtggagctggccctgggg-------------------aaggccc--
                                                                         

O55178_BCL2A1-01       ------------------------------ctccgttcagaaggaa----
Q07440_BCL2A1-01       ------------------------------ctccgttcagaaggaa----
Q4FK02_BCL2A1-01       ------------------------------ctccgttcagaaggaa----
O55177_BCL2A1-02       ------------------------------ctccgttcagaaggaa----
Q8K164_BCL2A1-01       ------------------------------ctccgttcagaaggaa----
Q9Z0F3_BCL2L10-01      -------cctccttctgcgaaagccggggcaatcgcctgga---------
O35843_BCL2L1-01       gaggtgattccca--tggcagcagtgaagcaagcgctgagagag------
Q64373_BCL2L1-03       gaggtgattccca--tggcagcagtgaagcaagcgctgagagag------
Q64373_BCL2L1-04       gaggtgattccca--tggcagcagtgaagcaagcgctgagagag------
Q5HZH3_BCL2L1-02       gaggtgattccca--tggcagcagtgaagcaagcgctgagagag------
Q64373_BCL2L1-01       gaggtgattccca--tggcagcagtgaagcaagcgctgagagag------
Q64373_BCL2L1-05       gaggtgattccca--tggcagcagtgaagcaagcgctgagagag------
Q64373_BCL2L1-06       gaggtgattccca--tggcagcagtgaagcaagcgctgagagag------
Q64373_BCL2L1-07       gaggtgattccca--tggcagcagtgaagcaagcgctgagagag------
Q64373_BCL2L1-08       --------------------------------------------------
Q64373_BCL2L1-09       gaggtgattccca--tggcagcagtgaagcaagcgctgagagag------
P10417_BCL2-01         -agccctgtgccacctgtggtccatctgaccctccgccgg----------
P10417_BCL2-02         -agccctgtgccacctgtggtccatctgaccctccgccgg----------
Q6NTH7_BCL2-01         -agccctgtgccacctgtggtccatctgaccctccgccgg----------
P97287_MCL1-01         gggccgacggctctctgccctccacgccgccgccgcccgaggaggaagag
P97287_MCL1-02         gggccgacggctctctgccctccacgccgccgccgcccgaggaggaagag
P70345_BCL2L2-01       -agccgccgacccgctgcaccaagccatgcgggctgctggagacga----
P70345_BCL2L2-02       --------------------------------------------------
P70345_BCL2L2-03       -agccgccgacccgctgcaccaagccatgcgggctgctggagacga----
P70345_BCL2L2-04       -agccgccgacccgctgcaccaagccatgcgggctgctggagacga----
                                                                         

O55178_BCL2A1-01       --------------------gttggaaagaacctaaagtcatact-----
Q07440_BCL2A1-01       --------------------gttgaaaagaatctgaagtcatact-----
Q4FK02_BCL2A1-01       --------------------gttgaaaagaatctgaagtcatact-----
O55177_BCL2A1-02       --------------------gttgaaaagaatctgaagtcatact-----
Q8K164_BCL2A1-01       --------------------gttgaaaagaatctgaagtcatact-----
Q9Z0F3_BCL2L10-01      --------------------gctggtgaa---------------------
O35843_BCL2L1-01       --------------------gcaggcgatgagtttgaactgcggt-----
Q64373_BCL2L1-03       --------------------gcaggcgatgagtttgaactgcggt-----
Q64373_BCL2L1-04       --------------------gcaggcgatgagtttgaactgcggt-----
Q5HZH3_BCL2L1-02       --------------------gcaggcgatgagtttgaactgcggt-----
Q64373_BCL2L1-01       --------------------gcaggcgatgagtttgaactgcggt-----
Q64373_BCL2L1-05       --------------------gcaggcgatgagtttgaactgcggt-----
Q64373_BCL2L1-06       --------------------gcaggcgatgagtttgaactgcggt-----
Q64373_BCL2L1-07       --------------------gcaggcgatgagtt----------------
Q64373_BCL2L1-08       --------------------------------------------------
Q64373_BCL2L1-09       --------------------gcaggcgatgagtttgaactgcggt-----
P10417_BCL2-01         --------------------gctggggatgacttctctcgtcgct-----
P10417_BCL2-02         --------------------gctggggatgacttctctcgtcgct-----
Q6NTH7_BCL2-01         --------------------gctggggatgacttctctcgtcgct-----
P97287_MCL1-01         gacgacctataccgccagtcgctggagat--catctcgcgctacttgcgg
P97287_MCL1-02         gacgacctataccgccagtcgctggagat--catctcgcgctacttgcgg
P70345_BCL2L2-01       --------------------gtttgagac--ccgtttccgccgc------
P70345_BCL2L2-02       --------------------------------------------------
P70345_BCL2L2-03       --------------------gtttgagac--ccgtttccgccgc------
P70345_BCL2L2-04       --------------------gtttgagac--ccgtttccgccgc------
                                                                         

O55178_BCL2A1-01       --------------------------------------------------
Q07440_BCL2A1-01       --------------------------------------------------
Q4FK02_BCL2A1-01       --------------------------------------------------
O55177_BCL2A1-02       --------------------------------------------------
Q8K164_BCL2A1-01       --------------------------------------------------
Q9Z0F3_BCL2L10-01      --------------------------------------------------
O35843_BCL2L1-01       ---------accggaga---------------------------------
Q64373_BCL2L1-03       ---------accggaga---------------------------------
Q64373_BCL2L1-04       ---------accggaga---------------------------------
Q5HZH3_BCL2L1-02       ---------accggaga---------------------------------
Q64373_BCL2L1-01       ---------accggaga---------------------------------
Q64373_BCL2L1-05       ---------accggaga---------------------------------
Q64373_BCL2L1-06       ---------accggaga---------------------------------
Q64373_BCL2L1-07       --------------------------------------------------
Q64373_BCL2L1-08       --------------------------------------------------
Q64373_BCL2L1-09       ---------accggaga---------------------------------
P10417_BCL2-01         ---------accgtcgt---------------------------------
P10417_BCL2-02         ---------accgtcgt---------------------------------
Q6NTH7_BCL2-01         ---------accgtcgt---------------------------------
P97287_MCL1-01         gagcaggcgaccggctccaaggactcgaagcctctgggcgaggcgggcgc
P97287_MCL1-02         gagcaggcgaccggctccaaggactcgaagcctctgggcgaggcgggcgc
P70345_BCL2L2-01       ---------accttctctga------------------------------
P70345_BCL2L2-02       --------------------------------------------------
P70345_BCL2L2-03       ---------accttctctga------------------------------
P70345_BCL2L2-04       ---------accttctctga------------------------------
                                                                         

O55178_BCL2A1-01       --------------------tggatgactttcacgtggaatccatagata
Q07440_BCL2A1-01       --------------------tggatgactttcacgtggaatccatagata
Q4FK02_BCL2A1-01       --------------------tggatgactttcacgtggaatccatagata
O55177_BCL2A1-02       --------------------tggatgactttcacgtggaatccatagata
Q8K164_BCL2A1-01       --------------------tggatgactttcacgtggaatccatagata
Q9Z0F3_BCL2L10-01      ------------acagatggcagataagttgc------------------
O35843_BCL2L1-01       ----gcgttcagtgatctaacatcccagcttcacata--accccaggg--
Q64373_BCL2L1-03       ----gcgttcagtgatctaacatcccagcttcacata--accccaggg--
Q64373_BCL2L1-04       ----gcgttcagtgatctaacatcccagcttcacata--accccaggg--
Q5HZH3_BCL2L1-02       ----gcgttcagtgatctaacatcccagcttcacata--accccaggg--
Q64373_BCL2L1-01       ----gcgttcagtgatctaacatcccagcttcacata--accccaggg--
Q64373_BCL2L1-05       ----gcgttcagtgatctaacatcccagcttcacata--accccaggg--
Q64373_BCL2L1-06       ----gcgttcagtgatctaacatcccagcttcacata--accccaggg--
Q64373_BCL2L1-07       --------------------------------------------------
Q64373_BCL2L1-08       --------------------------------------------------
Q64373_BCL2L1-09       ----gcgttcagtgatctaacatcccagcttcacata--accccaggg--
P10417_BCL2-01         ----gacttcgcagagatgtccagtcagctgcacctg--a-------cgc
P10417_BCL2-02         ----gacttcgcagagatgtccagtcagctgcacctg--a-------cgc
Q6NTH7_BCL2-01         ----gacttcgcagagatgtccagtcagctgcacctg--a-------cgc
P97287_MCL1-01         ggcgggccggagagcgctggagaccctgcggcgcgtg--ggcgacggcgt
P97287_MCL1-02         ggcgggccggagagcgctggagaccctgcggcgcgtg--ggcgacggcgt
P70345_BCL2L2-01       ---------------cctggccgctcagctacacgtg--accccaggc--
P70345_BCL2L2-02       --------------------------------------------------
P70345_BCL2L2-03       ---------------cctggccgctcagctacacgtg--accccaggc--
P70345_BCL2L2-04       ---------------cctggccgctcagctacacgtg--accccaggc--
                                                                         

O55178_BCL2A1-01       ccaccagaataata------------------------------------
Q07440_BCL2A1-01       ccgccagaataata------------------------------------
Q4FK02_BCL2A1-01       ccgccagaataata------------------------------------
O55177_BCL2A1-02       ccgccagaataata------------------------------------
Q8K164_BCL2A1-01       ccgccagaataata------------------------------------
Q9Z0F3_BCL2L10-01      --------------------------------------------------
O35843_BCL2L1-01       accgcgtatcagag------------------------------------
Q64373_BCL2L1-03       accgcgtatcagag------------------------------------
Q64373_BCL2L1-04       accgcgtatcagag------------------------------------
Q5HZH3_BCL2L1-02       accgcgtatcagag------------------------------------
Q64373_BCL2L1-01       accgcgtatcagag------------------------------------
Q64373_BCL2L1-05       accgcgtatcagag------------------------------------
Q64373_BCL2L1-06       accgcgtatcagag------------------------------------
Q64373_BCL2L1-07       --------------------------------------------------
Q64373_BCL2L1-08       --------------------------------------------------
Q64373_BCL2L1-09       accgcgtatcagag------------------------------------
P10417_BCL2-01         ccttcaccgcgaggggacg-------------------------------
P10417_BCL2-02         ccttcaccgcgaggggacg-------------------------------
Q6NTH7_BCL2-01         ccttcaccgcgaggggacg-------------------------------
P97287_MCL1-01         gcagcgcaaccacgagacggccttccagggcatgctccggaaactggaca
P97287_MCL1-02         gcagcgcaaccacgagacggccttccagggcatgctccggaaactggaca
P70345_BCL2L2-01       tcagcccagcaacg------------------------------------
P70345_BCL2L2-02       --------------------------------------------------
P70345_BCL2L2-03       tcagcccagcaacg------------------------------------
P70345_BCL2L2-04       tcagcccagcaacg------------------------------------
                                                                         

O55178_BCL2A1-01       --------------------------ttcaaccaagtgatggaaaaagag
Q07440_BCL2A1-01       --------------------------ttcaaccaagtgatggaaaaagag
Q4FK02_BCL2A1-01       --------------------------ttcaaccaagtgatggaaaaagag
O55177_BCL2A1-02       --------------------------ttcaaccaagtgatggaaaaagag
Q8K164_BCL2A1-01       --------------------------ttcaaccaagtgatggaaaaagag
Q9Z0F3_BCL2L10-01      ------------------------------------------------tc
O35843_BCL2L1-01       -------------------------ctttgagcaggtagtgaatgaactc
Q64373_BCL2L1-03       -------------------------ctttgagcaggtagtgaatgaactc
Q64373_BCL2L1-04       -------------------------ctttgagcaggtagtgaatgaactc
Q5HZH3_BCL2L1-02       -------------------------ctttgagcaggtagtgaatgaactc
Q64373_BCL2L1-01       -------------------------ctttgagcaggtagtgaatgaactc
Q64373_BCL2L1-05       -------------------------ctttgagcaggtagtgaatgaactc
Q64373_BCL2L1-06       -------------------------ctttgagcaggtagtgaatgaactc
Q64373_BCL2L1-07       --------------------------------------------------
Q64373_BCL2L1-08       --------------------------------------------------
Q64373_BCL2L1-09       -------------------------ctttgagcaggtagtgaatgaactc
P10417_BCL2-01         -------------------------ctttgccacggtggtggaggaactc
P10417_BCL2-02         -------------------------ctttgccacggtggtggaggaactc
Q6NTH7_BCL2-01         -------------------------ctttgccacggtggtggaggaactc
P97287_MCL1-01         ttaaaaacgaaggcgatgttaaatctttttctcgagtaatggtccatgtt
P97287_MCL1-02         ttaaaaacgaaggcgatgttaaatctttttctcgagtaatggtccatgtt
P70345_BCL2L2-01       -------------------------cttcacccaggtttccgacgaactt
P70345_BCL2L2-02       --------------------------------------------------
P70345_BCL2L2-03       -------------------------cttcacccaggtttccgacgaactt
P70345_BCL2L2-04       -------------------------cttcacccaggtttccgacgaactt
                                                                         

O55178_BCL2A1-01       tttgaagatggcatcattaattggggaaggattgtgactatatttgcctt
Q07440_BCL2A1-01       tttgaagatggcatcattaactggggaaggattgtgactatatttgcctt
Q4FK02_BCL2A1-01       tttgaagatggcatcattaactggggaaggattgtgactatatttgcctt
O55177_BCL2A1-02       tttgaagatggcatcattaactggggaaggattgtgactatatttgcctt
Q8K164_BCL2A1-01       tttgaagatggcatcattaactggggaaggattgtgactatatttgcctt
Q9Z0F3_BCL2L10-01      tccaaagaccaagacttcagctggagccaactggtgatgctcctggcctt
O35843_BCL2L1-01       tttcgggatgga---gtaaactggggtcgcatcgtggcctttttctcctt
Q64373_BCL2L1-03       tttcgggatgga---gtaaactggggtcgcatcgtggcctttttctcctt
Q64373_BCL2L1-04       tttcgggatgga---gtaaactggggtcgcatcgtggcctttttctcctt
Q5HZH3_BCL2L1-02       tttcgggatgga---gtaaactggggtcgcatcgtggcctttttctcctt
Q64373_BCL2L1-01       tttcgggatgga---gtaaactggggtcgcatcgtggcctttttctcctt
Q64373_BCL2L1-05       tttcgggatgga---gtaaactggggtcgcatcgtggcctttttctcctt
Q64373_BCL2L1-06       tttcgggatgga---gtaaactggggtcgcatcgtggcctttttctcctt
Q64373_BCL2L1-07       --------------------------------------------------
Q64373_BCL2L1-08       --------------------------------------------------
Q64373_BCL2L1-09       tttcgggatgga---gtaaactggggtcgcatcgtggcctttttctcctt
P10417_BCL2-01         ttcagggatggg---gtgaactgggggaggattgtggccttctttgagtt
P10417_BCL2-02         ttcagggatggg---gtgaactgggggaggattgtggccttctttgagtt
Q6NTH7_BCL2-01         ttcagggatggg---gtgaactgggggaggattgtggccttctttgagtt
P97287_MCL1-01         ttcaaagatggcgtaacaaactggggcaggattgtgactcttatttcttt
P97287_MCL1-02         ttcaaagatggcgtaacaaactggggcaggattgtgactcttatttcttt
P70345_BCL2L2-01       ttccaagggggc---cctaactggggccgtcttgtggcattctttgtctt
P70345_BCL2L2-02       --------------------------------------------------
P70345_BCL2L2-03       ttccaagggggc---cctaactggggccgtcttgtggcattctttgtctt
P70345_BCL2L2-04       ttccaagggggc---cctaactggggccgtcttgtggcattctttgtctt
                                                                         

O55178_BCL2A1-01       t-----gggg--------gtgttctcctcaaaaaaacttccacaagagca
Q07440_BCL2A1-01       t-----gggg--------gtgttctcctc-aaaaaacttccacaagagca
Q4FK02_BCL2A1-01       t-----gggg--------gtgttctcctc-aaaaaacttccgcaagagca
O55177_BCL2A1-02       t-----gggg--------gtgttctcctc-aaaaaacttccgcaagagca
Q8K164_BCL2A1-01       t-----gggg--------gtgttctcctc-aaaaaacttccgcaagagca
Q9Z0F3_BCL2L10-01      cgcggggacgcttatgaatcaaggcccttacatggctgtcaagcagaaga
O35843_BCL2L1-01       t-----ggcg------gggcactgtgcgtggaaagc-gtagacaaggag-
Q64373_BCL2L1-03       t-----ggcg------gggcactgtgcgtggaaagc-gtagacaaggag-
Q64373_BCL2L1-04       t-----ggcg------gggcactgtgcgtggaaagc-gtagacaaggag-
Q5HZH3_BCL2L1-02       t-----ggcg------gggcactgtgcgtggaaagc-gtagacaaggag-
Q64373_BCL2L1-01       t-----ggcg------gggcactgtgcgtggaaagc-gtagacaaggag-
Q64373_BCL2L1-05       t-----ggcg------gggcactgtgcgtggaaagc-gtagacaaggag-
Q64373_BCL2L1-06       t-----ggcg------gggcactgtgcgtggaaagc--------------
Q64373_BCL2L1-07       --------------------------------------------------
Q64373_BCL2L1-08       --------------------------------------------------
Q64373_BCL2L1-09       t-----ggcg------gggcactgtgcgtggaaagc-gtagacaaggag-
P10417_BCL2-01         c-----ggtg------gggtcatgtgtgtggagagc-gtcaacagggag-
P10417_BCL2-02         c-----ggtg------gggtcatgtgtgtggagagc-gtcaacagggag-
Q6NTH7_BCL2-01         c-----ggtg------gggtcatgtgtgtggagagc-gtcaacagggag-
P97287_MCL1-01         c-----ggtgcctttgtggccaaacacttaaagagc-gtaaaccaagaaa
P97287_MCL1-02         c-----ggtgcctttgtggccaaacacttaaagagc-gtaaaccaagaaa
P70345_BCL2L2-01       t-----ggggct------gccctgtgtgctgagagt-gtcaacaaagaa-
P70345_BCL2L2-02       --------------------------------------------------
P70345_BCL2L2-03       t-----ggggct------gccctgtgtgctgagagt-gtcaacaaagaa-
P70345_BCL2L2-04       t-----ggggct------gccctgtgtgctgagagt-gtcaacaaagaa-
                                                                         

O55178_BCL2A1-01       gattgccctgg------atgtacgtgcttacaaacaagtttccagttttg
Q07440_BCL2A1-01       gattgccctgg------atgtatgtgcttacaaacaagtttccagttttg
Q4FK02_BCL2A1-01       gattgccctgg------atgtaggtgcttacaaacaagtttccagttttg
O55177_BCL2A1-02       gattgccctgg------atgtaggtgcttacaaacaagtttccagttttg
Q8K164_BCL2A1-01       gattgccctgg------atgtaggtgcttacaaacaagtttccagttttg
Q9Z0F3_BCL2L10-01      gggatctggggaatcgtgtcatagtg-----acccgagactgctgtctca
O35843_BCL2L1-01       -----atgcag------gtattggtg-----agtcggattgcaagttgga
Q64373_BCL2L1-03       -----atgcag------gtattggtg-----agtcggattgcaagttgga
Q64373_BCL2L1-04       -----atgcag------gtattggtg-----agtcggattgcaagttgga
Q5HZH3_BCL2L1-02       -----atgcag------gtattggtg-----agtcggattgcaagttgga
Q64373_BCL2L1-01       -----atgcag------gtattggtg-----agtcggattgcaagttgga
Q64373_BCL2L1-05       -----atgcag------gtattggtg-----agtcggattgcaagttgga
Q64373_BCL2L1-06       --------------------------------------------------
Q64373_BCL2L1-07       --------------------------------------------------
Q64373_BCL2L1-08       --------------------------------------------------
Q64373_BCL2L1-09       -----atgcag------gtattggtg-----agtcggattgcaagttgga
P10417_BCL2-01         -----atgtca------cccctggtg-----gacaacatcgccctgtgga
P10417_BCL2-02         -----atgtca------cccctggtg-----gacaacatcgccctgtgga
Q6NTH7_BCL2-01         -----atgtca------cccctggtg-----gacaacatcgccctgtgga
P97287_MCL1-01         gcttcatcgaa------ccattagca-----gaaactatcacagat----
P97287_MCL1-02         gcttcatcgaa------ccattagca-----gaaactatcacagat----
P70345_BCL2L2-01       -----atggag------cctttggtg-----ggacaagtgcaggattgga
P70345_BCL2L2-02       -----atggag------cctttggtg-----ggacaagtgcaggattgga
P70345_BCL2L2-03       -----atggag------cctttggtg-----ggacaagtgcaggattgga
P70345_BCL2L2-04       -----atggag------cct------------------------------
                                                                         

O55178_BCL2A1-01       gggcagaattcata------------atgaataa----------------
Q07440_BCL2A1-01       tggcagaattcata------------atgaataacacagg---agaatgg
Q4FK02_BCL2A1-01       tggcagaattcata------------atcaataacacagg---agaatgg
O55177_BCL2A1-02       tggcagaattcata------------atcaataacacagg---agaatgg
Q8K164_BCL2A1-01       tggcagaattcata------------atcaataacacagg---agaatgg
Q9Z0F3_BCL2L10-01      tagtgaactttctgtataatctgctcatggggcgtcggcaccgcgccagg
O35843_BCL2L1-01       tggccacctatctg------------aatgaccacctaga---gccttgg
Q64373_BCL2L1-03       tggccacctatctg------------aatgaccacctaga---gccttgg
Q64373_BCL2L1-04       tggccacctatctg------------aatgaccacctaga---gccttgg
Q5HZH3_BCL2L1-02       tggccacctatctg------------aatgaccacctaga---gccttgg
Q64373_BCL2L1-01       tggccacctatctg------------aatgaccacctaga---gccttgg
Q64373_BCL2L1-05       tggccacctatctg------------aatgaccacctaga---gccttgg
Q64373_BCL2L1-06       --------------------------------------------------
Q64373_BCL2L1-07       --------------------------------------------------
Q64373_BCL2L1-08       --------------------------------------------------
Q64373_BCL2L1-09       tggccacctatctg------------aatgaccacctaga---gccttgg
P10417_BCL2-01         tgactgagtacctg------------aaccggcatctgca---cacctgg
P10417_BCL2-02         tgactgagtacctg------------aaccggcatctgca---cacctgg
Q6NTH7_BCL2-01         tgactgagtacctg------------aaccggcatctgca---cacctgg
P97287_MCL1-01         -----gttcttgta------------aggacgaaacgg------gactgg
P97287_MCL1-02         -----gttcttgta------------aggacgaaacgg------gactgg
P70345_BCL2L2-01       tggtggcctacctg------------gagacacgtctggc---tgactgg
P70345_BCL2L2-02       tggtggcctacctg------------gagacacgtctggc---tgactgg
P70345_BCL2L2-03       tggtggcctacctg------------gagacacgtctggc---tgactgg
P70345_BCL2L2-04       --------------------------------------------------
                                                                         

O55178_BCL2A1-01       --------------------------------------------------
Q07440_BCL2A1-01       atacggcagaatggaggttgggaagat-----------------------
Q4FK02_BCL2A1-01       atacggcggaatggaggttgggaagat-----------------------
O55177_BCL2A1-02       atacggcggaatggaggttgggaagat-----------------------
Q8K164_BCL2A1-01       atacggcggaatggaggttgggaagat-----------------------
Q9Z0F3_BCL2L10-01      ctggaggctctcggcggctgggatggc-----------------ttttgc
O35843_BCL2L1-01       atccaggagaacggcggctggg--gtgtgagtggaggtacacccctcaga
Q64373_BCL2L1-03       atccaggagaacggcggctggg----------------------------
Q64373_BCL2L1-04       atccaggagaacggcggctggg----------------------------
Q5HZH3_BCL2L1-02       atccaggagaacggcggctgggacacttttgtggatctctacgggaacaa
Q64373_BCL2L1-01       atccaggagaacggcggctgggacacttttgtggatctctacgggaacaa
Q64373_BCL2L1-05       atccaggagaacggcggctgg-----------------------------
Q64373_BCL2L1-06       --------------------------------------------------
Q64373_BCL2L1-07       --------------------------------------------------
Q64373_BCL2L1-08       --------------------------------------------------
Q64373_BCL2L1-09       atccaggagaacggcggctgggacacttttgtggatctctacgggaacaa
P10417_BCL2-01         atccaggataacggaggctgggatgcctttgtggaactatatggccccag
P10417_BCL2-02         atccaggataacggaggctggg----------------------------
Q6NTH7_BCL2-01         atccaggataacggaggctggg----------------------------
P97287_MCL1-01         cttgtcaaacaaagaggctgggatggg----------------tttgtgg
P97287_MCL1-02         cttgtcaaacaaagaggctgggatggg----------------tttgtgg
P70345_BCL2L2-01       atccacagcagtgggggctgggcggag------------------ttcac
P70345_BCL2L2-02       atccacagcagtgggggctgggcggag------------------ttcac
P70345_BCL2L2-03       atccacagcagtgggggctgggtaagaagttctcaattgctgctctccgc
P70345_BCL2L2-04       --------------------------------------------------
                                                                         

O55178_BCL2A1-01       --------------------------------------------------
Q07440_BCL2A1-01       ggcttcataaagaagtttgaac----------------------------
Q4FK02_BCL2A1-01       ggcttcataaagaagtttgaac----------------------------
O55177_BCL2A1-02       ggcttcataaagaagtttgaac----------------------------
Q8K164_BCL2A1-01       ggcttcataaagaagtttgaac----------------------------
Q9Z0F3_BCL2L10-01      cgcttcttcaagaatcctttaccgctcggc--------------------
O35843_BCL2L1-01       tctgtcttcagaaggcttg-------------------------------
Q64373_BCL2L1-03       --------------------------------------------------
Q64373_BCL2L1-04       --------------------------------------------------
Q5HZH3_BCL2L1-02       tgcagcagccgagagccggaaaggccaggagcgc----------------
Q64373_BCL2L1-01       tgcagcagccgagagccggaaaggccaggagcgc----------------
Q64373_BCL2L1-05       --------------------------------------------------
Q64373_BCL2L1-06       --------------------------------------------------
Q64373_BCL2L1-07       --------------------------------------------------
Q64373_BCL2L1-08       --------------------------------------------------
Q64373_BCL2L1-09       tgcagcagccgagagccggaaaggccaggagcgc----------------
P10417_BCL2-01         catgcgacctctgtttgatttctcctggctgtct----------------
P10417_BCL2-02         --------------------------------------------------
Q6NTH7_BCL2-01         --------------------------------------------------
P97287_MCL1-01         agttct-tccacgtacaggacctagaaggcggca----------------
P97287_MCL1-02         agttct-tccacgtacaggacctagaaggcggca----------------
P70345_BCL2L2-01       agctctatacggggacggggccctggaggaggcacggcgtctgcgggagg
P70345_BCL2L2-02       agctctatacggggacggggccctggaggaggcacggcgtctgcgggagg
P70345_BCL2L2-03       atccctctacaaagttggtcttcatgggaaaatagggcctctgatgggag
P70345_BCL2L2-04       --------------------------------------------------
                                                                         

O55178_BCL2A1-01       --------------------------------------------------
Q07440_BCL2A1-01       ---------------ccaaatctggctggctgacttttctgcagatgaca
Q4FK02_BCL2A1-01       ---------------ccaaatctggctggctgacttttctgcagatgaca
O55177_BCL2A1-02       ---------------ccaaatctggctggctgacttttctgcagatgaca
Q8K164_BCL2A1-01       ---------------ccaaatctggctggctgacttttctgcagatgaca
Q9Z0F3_BCL2L10-01      --------------ttctggagaagattgctgattcaggcttttctgtca
O35843_BCL2L1-01       --------------ttcaagtgccaggagtggcggagcacgtttgtgatc
Q64373_BCL2L1-03       ---------------taagaaccacgccccttgtgtgtccgccccttgct
Q64373_BCL2L1-04       ---------------taagaaccacgccccttgtgtgtccgccccttgct
Q5HZH3_BCL2L1-02       --------------ttcaaccgctggttcctgacgggcatgactgtggct
Q64373_BCL2L1-01       --------------ttcaaccgctggttcctgacgggcatgactgtggct
Q64373_BCL2L1-05       --------------------------------------------------
Q64373_BCL2L1-06       --------------------------------------------------
Q64373_BCL2L1-07       --------------------------------------------------
Q64373_BCL2L1-08       --------------------------------------------------
Q64373_BCL2L1-09       --------------ttcaaccgctggttcctgacgggcatgactgtggct
P10417_BCL2-01         -----------------ctgaagaccctgctcagcctggccctggtcggg
P10417_BCL2-02         --------------------------------------------------
Q6NTH7_BCL2-01         --------------------------------------------------
P97287_MCL1-01         ---------------tcagaaatgtgctgctggcttttgcgggtgttgct
P97287_MCL1-02         ---------------tcagaaatgtgctgctggcttttgcgggtgttgct
P70345_BCL2L2-01       ggaactgggcatcagtgaggacagtgctgacgggggccgtggcactgggg
P70345_BCL2L2-02       ggaactgggcatcagtgaggacagtgctgacgggggccgtggcactgggg
P70345_BCL2L2-03       --------------gctggggttgtgctgggaagggctga----------
P70345_BCL2L2-04       --------------------------------------------------
                                                                         

O55178_BCL2A1-01       --------------------------------------------------
Q07440_BCL2A1-01       ggacagatctgggaaatgctctttctcctcaagtaa--------------
Q4FK02_BCL2A1-01       ggacagttctgggaaatgctctttctcctcaagtag--------------
O55177_BCL2A1-02       ggacagttctgggaaatgctctttctcctcaagtaa--------------
Q8K164_BCL2A1-01       ggacagatctgggaaatgctctttctcctcaagtaa--------------
Q9Z0F3_BCL2L10-01      ggcttctttgcaacagccatcttttttatctggaaacgtttataa-----
O35843_BCL2L1-01       ccagcctttgggaggtggaaacagaaggatcggaagttcaaggccctcct
Q64373_BCL2L1-03       tgtgtctctcttctctgtgaacatccctaa--------------------
Q64373_BCL2L1-04       tgtgtctctcttctctgtgaacatccctaa--------------------
Q5HZH3_BCL2L1-02       ggtgtggttctgctgggctcactcttcagtcggaagtga-----------
Q64373_BCL2L1-01       ggtgtggttctgctgggctcactcttcagtcggaagtga-----------
Q64373_BCL2L1-05       --------------------------------------------------
Q64373_BCL2L1-06       --------------------------------------------------
Q64373_BCL2L1-07       --------------------------------------------------
Q64373_BCL2L1-08       --------------------------------------------------
Q64373_BCL2L1-09       ggtgtggttctgctgggctcactcttcagtcggaagtga-----------
P10417_BCL2-01         gcctgcatcactctgggtgcatacctgggccacaagtga-----------
P10417_BCL2-02         -------------taggtgcatgtctggt---tgaatga-----------
Q6NTH7_BCL2-01         -------------taggtgcatgtctggt---tgaatga-----------
P97287_MCL1-01         ggagtaggggctggtctggcatatctaataagatag--------------
P97287_MCL1-02         ggagtaggggctggtctggcatatctaataagatag--------------
P70345_BCL2L2-01       gccctggtaactgtaggggccttttttgctagcaagtga-----------
P70345_BCL2L2-02       gccctggtaactgtaggggccttttttgctagcaagtga-----------
P70345_BCL2L2-03       --------------------------------------------------
P70345_BCL2L2-04       --------------------------------------------------
                                                                         

O55178_BCL2A1-01       ------------
Q07440_BCL2A1-01       ------------
Q4FK02_BCL2A1-01       ------------
O55177_BCL2A1-02       ------------
Q8K164_BCL2A1-01       ------------
Q9Z0F3_BCL2L10-01      ------------
O35843_BCL2L1-01       cagctattatag
Q64373_BCL2L1-03       ------------
Q64373_BCL2L1-04       ------------
Q5HZH3_BCL2L1-02       ------------
Q64373_BCL2L1-01       ------------
Q64373_BCL2L1-05       ------------
Q64373_BCL2L1-06       ------------
Q64373_BCL2L1-07       ------------
Q64373_BCL2L1-08       ------------
Q64373_BCL2L1-09       ------------
P10417_BCL2-01         ------------
P10417_BCL2-02         ------------
Q6NTH7_BCL2-01         ------------
P97287_MCL1-01         ------------
P97287_MCL1-02         ------------
P70345_BCL2L2-01       ------------
P70345_BCL2L2-02       ------------
P70345_BCL2L2-03       ------------
P70345_BCL2L2-04       ------------
                                   

© 1998-2022Legal notice