Dataset for CDS BCL-2-like of organism Saimiri boliviensis boliviensis

[Download (right click)] [Edit] [Sequences] [Repertoires]

10 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A2K6TLJ5_BCL2A1-      atgacagaccacgaatttggatatattcacaatctaactca---------
A0A2K6TLJ5_BCL2A1-      atgacagaccacgaatttggatatattcacaatctaactca---------
A0A2K6UEL3_BCL2-01      atggcgcacgctgggagaacagggtacgataaccgggag---------at
A0A2K6UWY8_BCL2L1-      atg------------------tctcagagcaaccgggag---------ct
A0A2K6UWY8_BCL2L1-      --------------------------------------------------
A0A2K6TM77_BCL2L2-      atggcgacccc---agcctcagccccagacacacgggct---------ct
A0A2K6TM77_BCL2L2-      atggcgacccc---agcctcagccccagacacacgggct---------ct
A0A2K6TIT7_BCL2L10      atggctgaccc---gctgcagcagcgcaccgagcag------------ct
A0A2K6V5Y3_MCL1-01      atgttcggcct----ccaaagaaacgcggtaatcggactcaacctctact
A0A2K6V5Y3_MCL1-03      atgttcggcct----ccaaagaaacgcggtaatcggactcaacctctact
                                                                          

A0A2K6TLJ5_BCL2A1-      ------ggactatctgcggtatgtcctgc-------------------ag
A0A2K6TLJ5_BCL2A1-      ------ggactatctgcggtatgtcctgc-------------------ag
A0A2K6UEL3_BCL2-01      agtgatgaagtacatccactataagctgtcgcag--------------ag
A0A2K6UWY8_BCL2L1-      ggtggttgactttctctcctacaagctttcccag--------------aa
A0A2K6UWY8_BCL2L1-      --------------------------------------------------
A0A2K6TM77_BCL2L2-      ggtggcagactttgtaggttataagctgaggcag--------------aa
A0A2K6TM77_BCL2L2-      ggtggcagactttgtaggttataagctgaggcag--------------aa
A0A2K6TIT7_BCL2L10      ggtggcggactacctggagtactgctcccgggagcccggcaccccc----
A0A2K6V5Y3_MCL1-01      gtgggggggccggcttgggggccggcagcggcggcgccacccccccggga
A0A2K6V5Y3_MCL1-03      gtgggggggccggcttgggggccggcagcggcggcgccacccccccggga
                                                                          

A0A2K6TLJ5_BCL2A1-      ataccacaatctgg-------------aacgg------------------
A0A2K6TLJ5_BCL2A1-      ataccacaatctgg-------------aacgg------------------
A0A2K6UEL3_BCL2-01      gggctacgagtggga------------tgccg------------------
A0A2K6UWY8_BCL2L1-      aggatacagctggagtcagtttagtgatgtgg------------------
A0A2K6UWY8_BCL2L1-      --------------------------atgtgg------------------
A0A2K6TM77_BCL2L2-      gggttatgtc-----------------tgtgg------------------
A0A2K6TM77_BCL2L2-      gggttatgtc-----------------tgtgg------------------
A0A2K6TIT7_BCL2L10      gagtcgccaccggc-------------cacgg------------------
A0A2K6V5Y3_MCL1-01      gggcggcttctggc-------------cgcggagaaggaggcctcggccc
A0A2K6V5Y3_MCL1-03      gggcggcttct---------------------------------------
                                                                          

A0A2K6TLJ5_BCL2A1-      --------------------------------------------------
A0A2K6TLJ5_BCL2A1-      --------------------------------------------------
A0A2K6UEL3_BCL2-01      --------------------------------------------------
A0A2K6UWY8_BCL2L1-      --------------------------------------------------
A0A2K6UWY8_BCL2L1-      --------------------------------------------------
A0A2K6TM77_BCL2L2-      --------------------------------------------------
A0A2K6TM77_BCL2L2-      --------------------------------------------------
A0A2K6TIT7_BCL2L10      --------------------------------------------------
A0A2K6V5Y3_MCL1-01      agcgagaggtagggggaggggaggccggcgcggtgattggcggaagcgcc
A0A2K6V5Y3_MCL1-03      --------------------------------------------------
                                                                          

A0A2K6TLJ5_BCL2A1-      --------------------------------------------------
A0A2K6TLJ5_BCL2A1-      --------------------------------------------------
A0A2K6UEL3_BCL2-01      --------------------------------------------------
A0A2K6UWY8_BCL2L1-      --------------------------------------------------
A0A2K6UWY8_BCL2L1-      --------------------------------------------------
A0A2K6TM77_BCL2L2-      --------------------------------------------------
A0A2K6TM77_BCL2L2-      --------------------------------------------------
A0A2K6TIT7_BCL2L10      --------------------------------------------------
A0A2K6V5Y3_MCL1-01      ggcgctagccctccggccgccctgacgcctgacgcccggagggtcgtgcg
A0A2K6V5Y3_MCL1-03      --------------------------------------------------
                                                                          

A0A2K6TLJ5_BCL2A1-      --------------------------------------------------
A0A2K6TLJ5_BCL2A1-      --------------------------------------------------
A0A2K6UEL3_BCL2-01      ------------------------------------------------ga
A0A2K6UWY8_BCL2L1-      ------------------------------------------------aa
A0A2K6UWY8_BCL2L1-      ------------------------------------------------aa
A0A2K6TM77_BCL2L2-      ------------------------------------------------a-
A0A2K6TM77_BCL2L2-      ------------------------------------------------a-
A0A2K6TIT7_BCL2L10      ----------------------------------------------ccga
A0A2K6V5Y3_MCL1-01      gccgccgcccattggcgccgaggtccccgacgtcaccgcgaccccctcga
A0A2K6V5Y3_MCL1-03      --------------------------------------------------
                                                                          

A0A2K6TLJ5_BCL2A1-      --------------------------------------------------
A0A2K6TLJ5_BCL2A1-      --------------------------------------------------
A0A2K6UEL3_BCL2-01      gatgtgggcgccgcg-----------------------------------
A0A2K6UWY8_BCL2L1-      gagaacaggactgag-----------------------------------
A0A2K6UWY8_BCL2L1-      gagaacaggactgag-----------------------------------
A0A2K6TM77_BCL2L2-      ---------gct--g-----------------------------------
A0A2K6TM77_BCL2L2-      ---------gct--g-----------------------------------
A0A2K6TIT7_BCL2L10      ggccgctgtgctgcgc----------------------------------
A0A2K6V5Y3_MCL1-01      ggctgctgttcttcgcgcccacccgccgcgcggcgccgctggaggagatg
A0A2K6V5Y3_MCL1-03      --------------------------------------------------
                                                                          

A0A2K6TLJ5_BCL2A1-      --------------------------------------------------
A0A2K6TLJ5_BCL2A1-      --------------------------------------------------
A0A2K6UEL3_BCL2-01      --------------------------------------------------
A0A2K6UWY8_BCL2L1-      --------------------------------------------------
A0A2K6UWY8_BCL2L1-      --------------------------------------------------
A0A2K6TM77_BCL2L2-      --------------------------------------------------
A0A2K6TM77_BCL2L2-      --------------------------------------------------
A0A2K6TIT7_BCL2L10      --------------------------------------------------
A0A2K6V5Y3_MCL1-01      gaagccccggccgccgacgccatcatgtcgcccgaagacgagctggacgg
A0A2K6V5Y3_MCL1-03      --------------------------------------------------
                                                                          

A0A2K6TLJ5_BCL2A1-      ---------------------------------------gtccaagcaaa
A0A2K6TLJ5_BCL2A1-      ---------------------------------------gtccaagcaaa
A0A2K6UEL3_BCL2-01      ---------------------------------------cccccaggcgc
A0A2K6UWY8_BCL2L1-      ---------------------------------------gccccagaagg
A0A2K6UWY8_BCL2L1-      ---------------------------------------gccccagaagg
A0A2K6TM77_BCL2L2-      ---------------------------------------gccccggggag
A0A2K6TM77_BCL2L2-      ---------------------------------------gccccggggag
A0A2K6TIT7_BCL2L10      ---------------------------------------gccacggccgc
A0A2K6V5Y3_MCL1-01      gtacgagccggagcctctcgggaagcggccggctgtcctgcccctgctgg
A0A2K6V5Y3_MCL1-03      --------------------------------------------------
                                                                          

A0A2K6TLJ5_BCL2A1-      a-------------------------------------------------
A0A2K6TLJ5_BCL2A1-      a-------------------------------------------------
A0A2K6UEL3_BCL2-01      cgcccccgcgccgggcatcttctcctcccagcccgggcacacgcccggtc
A0A2K6UWY8_BCL2L1-      gactgattcggagatgga--------------------------------
A0A2K6UWY8_BCL2L1-      gactgattcggagatgga--------------------------------
A0A2K6TM77_BCL2L2-      ggccca---gcagct-----------------------------------
A0A2K6TM77_BCL2L2-      ggccca---gcagct-----------------------------------
A0A2K6TIT7_BCL2L10      cgttgtacggaaactctacccgt------------------------cct
A0A2K6V5Y3_MCL1-01      agctggtcggggagcctggtcatggctccagtacggacgggtcactcccc
A0A2K6V5Y3_MCL1-03      --------------------------------------------------
                                                                          

A0A2K6TLJ5_BCL2A1-      --------------------------------------------------
A0A2K6TLJ5_BCL2A1-      --------------------------------------------------
A0A2K6UEL3_BCL2-01      ccgctgcgccccg-------------------------------------
A0A2K6UWY8_BCL2L1-      --------------------------------------------------
A0A2K6UWY8_BCL2L1-      --------------------------------------------------
A0A2K6TM77_BCL2L2-      --------------------------------------------------
A0A2K6TM77_BCL2L2-      --------------------------------------------------
A0A2K6TIT7_BCL2L10      tcttctccgcttaccgc---------------------------------
A0A2K6V5Y3_MCL1-01      tcgacgccgccgcccgcagaggaggaggaggacgagttgtaccggcagtc
A0A2K6V5Y3_MCL1-03      --------------------------------------------------
                                                                          

A0A2K6TLJ5_BCL2A1-      ---------------------------------cgtccagagtactacaa
A0A2K6TLJ5_BCL2A1-      ---------------------------------cgtccagagtactacaa
A0A2K6UEL3_BCL2-01      ---------------------------------ggaccctgtcgccagga
A0A2K6UWY8_BCL2L1-      ---------------------------------gacccccagtgccatca
A0A2K6UWY8_BCL2L1-      ---------------------------------gacccccagtgccatca
A0A2K6TM77_BCL2L2-      ---------------------------------gacccgctgcacca---
A0A2K6TM77_BCL2L2-      ---------------------------------gacccgctgcacca---
A0A2K6TIT7_BCL2L10      ---------------------------------ggctacc----ccagga
A0A2K6V5Y3_MCL1-01      gctggagattatctctcggtacctccgggagcaggcgaccggcgccaagg
A0A2K6V5Y3_MCL1-03      ---------------------------------ggcgaccggcgccaagg
                                                                    * *   

A0A2K6TLJ5_BCL2A1-      aaggttg-------------------------------------------
A0A2K6TLJ5_BCL2A1-      aaggttg-------------------------------------------
A0A2K6UEL3_BCL2-01      ccnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
A0A2K6UWY8_BCL2L1-      atggcaacccagcctggcacctggcggacagccccgcggtgaatggagcc
A0A2K6UWY8_BCL2L1-      at------------------------------------------------
A0A2K6TM77_BCL2L2-      --------------------------------------------------
A0A2K6TM77_BCL2L2-      --------------------------------------------------
A0A2K6TIT7_BCL2L10      ac------------------------------------------------
A0A2K6V5Y3_MCL1-01      acacaaa-------------------------------------------
A0A2K6V5Y3_MCL1-03      acacaaa-------------------------------------------
                                                                          

A0A2K6TLJ5_BCL2A1-      --------------------------------------------------
A0A2K6TLJ5_BCL2A1-      --------------------------------------------------
A0A2K6UEL3_BCL2-01      nncagcccagtgccacctgtggtccacct---------------------
A0A2K6UWY8_BCL2L1-      acgggccacagcagcagtttggatgcccgggaggtgatccccatggcagc
A0A2K6UWY8_BCL2L1-      --------------------------------------------------
A0A2K6TM77_BCL2L2-      --------------------------------------------------
A0A2K6TM77_BCL2L2-      --------------------------------------------------
A0A2K6TIT7_BCL2L10      --------------------------------------------------
A0A2K6V5Y3_MCL1-01      --------------------------------------------------
A0A2K6V5Y3_MCL1-03      --------------------------------------------------
                                                                          

A0A2K6TLJ5_BCL2A1-      ---------cattctcagtccaaaaggaagtg------gaagagagtctg
A0A2K6TLJ5_BCL2A1-      ---------cattctcagtccaaaaggaagtg------gaagagagtctg
A0A2K6UEL3_BCL2-01      ---------gaccctccgccaggccggcgacg------------acttct
A0A2K6UWY8_BCL2L1-      aataaagcaagcactgagggaggcaggcgacg------------agtttg
A0A2K6UWY8_BCL2L1-      --------------------------------------------------
A0A2K6TM77_BCL2L2-      ---------agcaatgcgggcagctggagatg------------agttcg
A0A2K6TM77_BCL2L2-      ---------agcaatgcgggcagctggagatg------------agttcg
A0A2K6TIT7_BCL2L10      --------------cgcgtcgagctggtggcg-----aggatggc---gg
A0A2K6V5Y3_MCL1-01      ---------gccaatgggcaggtccggggccgccagcaggaaggcgctgg
A0A2K6V5Y3_MCL1-03      ---------gccaatgggcaggtccggggccgccagcaggaaggcgctgg
                                                                          

A0A2K6TLJ5_BCL2A1-      aagccatg-------------cttggacaacgtt---------catattg
A0A2K6TLJ5_BCL2A1-      aagccatg-------------cttggacaacgtt---------catattg
A0A2K6UEL3_BCL2-01      cccgccgc--tatcgccgcgacttcgccgagatgtccagccagctgcacc
A0A2K6UWY8_BCL2L1-      aactgcgg--taccggcgggcatttagtgacctgacatcccagctccaca
A0A2K6UWY8_BCL2L1-      ------------------------------------------gctccaca
A0A2K6TM77_BCL2L2-      agacccgc--ttccggcgcaccttctctgatctggcggctcagctgcatg
A0A2K6TM77_BCL2L2-      agacccgc--ttccggcgcaccttctctgatctggcggctcagctgcatg
A0A2K6TIT7_BCL2L10      aggccttgctctccgacagtcccggtcccacctg---gggcaacgtggtg
A0A2K6V5Y3_MCL1-01      agaccctg-----cggcgggtcggggacggcgtg-cagcgcaaccacgag
A0A2K6V5Y3_MCL1-03      agaccctg-----cggcgggtcggggacggcgtg-cagcgcaaccacgag
                                                                   *      

A0A2K6TLJ5_BCL2A1-      tgtccatggacaatgccagaacaatattc-----------------agtc
A0A2K6TLJ5_BCL2A1-      tgtccatggacaatgccagaacaatattc-----------------agtc
A0A2K6UEL3_BCL2-01      tgacgcccttcaccgcgcggggacgcttt-----------------gcca
A0A2K6UWY8_BCL2L1-      tcacccccgggacagcgtatcaaagcttt-----------------gaac
A0A2K6UWY8_BCL2L1-      tcacccccgggacagcgtatcaaagcttt-----------------gaac
A0A2K6TM77_BCL2L2-      tgaccccaggctcagcccaacaacgcttc-----------------accc
A0A2K6TM77_BCL2L2-      tgaccccaggctcagcccaacaacgcttc-----------------accc
A0A2K6TIT7_BCL2L10      atgctcctggc-cttcgcggggacgctgc-------------tagagagg
A0A2K6V5Y3_MCL1-01      a------cggc-cttccaaggcatgcttcggaaactggacatcaaaaacg
A0A2K6V5Y3_MCL1-03      a------cggc-cttccaaggcatgcttcggaaactggacatcaaaaacg
                                       *      *   *                       

A0A2K6TLJ5_BCL2A1-      aagtgatggaaaaggaatt---------------------------tgaa
A0A2K6TLJ5_BCL2A1-      aagtgatggaaaaggaatt---------------------------tgaa
A0A2K6UEL3_BCL2-01      cggtggtggaggagctctt---------------------------cagg
A0A2K6UWY8_BCL2L1-      aggtagtgaacgaactctt---------------------------ccgg
A0A2K6UWY8_BCL2L1-      aggtagtgaacgaactctt---------------------------ccgg
A0A2K6TM77_BCL2L2-      aggtctccgatgaactttt---------------------------ccaa
A0A2K6TM77_BCL2L2-      aggtctccgatgaactttt---------------------------ccaa
A0A2K6TIT7_BCL2L10      gggccgctggtgaccgcccggtggaagaagtgg----ggcttccagtcgc
A0A2K6V5Y3_MCL1-01      aagacgatgtcaaatctttgtctcgagtgatggtccatgttttcagcgac
A0A2K6V5Y3_MCL1-03      aagacgatgtcaaatctttgtctcgagtgatggtccatgttttcagcgac
                          *         *                                     

A0A2K6TLJ5_BCL2A1-      gatggcattattaactggggaagaattgtaaccatatt---------tgc
A0A2K6TLJ5_BCL2A1-      gatggcattattaactggggaagaattgtaaccatatt---------tgc
A0A2K6UEL3_BCL2-01      gacgg---ggtgaactgggggaggattgtggccttctt---------tga
A0A2K6UWY8_BCL2L1-      gatgg---ggtgaactggggtcgcattgtggccttttt---------ctc
A0A2K6UWY8_BCL2L1-      gatgg---ggtgaactggggtcgcattgtggccttttt---------ctc
A0A2K6TM77_BCL2L2-      ggggg---tcccaactggggccgccttgtagccttctt---------tgt
A0A2K6TM77_BCL2L2-      ggggg---tcccaactggggccgccttgtagccttctt---------tgt
A0A2K6TIT7_BCL2L10      ggttg---aaggagccgg---agggcgacgtcgcccgggactgccagcgc
A0A2K6V5Y3_MCL1-01      ggcgt---aacaaactggggtaggattgtgactctcatttcttttggtgc
A0A2K6V5Y3_MCL1-03      ggcgt---aacaaactggggtaggattgtgactctcatttcttttggtgc
                        *           * * **    *        *                  

A0A2K6TLJ5_BCL2A1-      atttgaaggtattctcatcaagaaacttctacgagagcgaattgccccgg
A0A2K6TLJ5_BCL2A1-      atttgaaggtattctcatcaagaaacttctacgagagcgaattgccccgg
A0A2K6UEL3_BCL2-01      gttcggtggggtcatgtgtgtggagag----cgtcaaccgggag------
A0A2K6UWY8_BCL2L1-      cttcggcggggcactgtgcgtggaaag----cgtagacaaggag------
A0A2K6UWY8_BCL2L1-      cttcggcggggcactgtgcgtggaaag----cgtagacaaggag------
A0A2K6TM77_BCL2L2-      ctttggggctgcactgtgtgctgagag----tgtcaacaaggag------
A0A2K6TM77_BCL2L2-      ctttggggctgcactgtgtgctgagag----tgtcaacaaggag------
A0A2K6TIT7_BCL2L10      c-tggtgggcttgctgagctcgcggct----cgt--------ggggcagc
A0A2K6V5Y3_MCL1-01      ctttgtggccaaac---acttgaagac----cataaaccaagaaagctgc
A0A2K6V5Y3_MCL1-03      ctttgtggccaaac---acttgaagac----cataaaccaagaaagctgc
                          * *  *                                          

A0A2K6TLJ5_BCL2A1-      atgtggatacttacaagg-agatttcgtattttgttgctgagttcataat
A0A2K6TLJ5_BCL2A1-      atgtggatacttacaagg-agatttcgtattttgttgctgagttcataat
A0A2K6UEL3_BCL2-01      atgtcgcccctggtggacaacatcgccctgtggatgaccgagtacctgaa
A0A2K6UWY8_BCL2L1-      atgcaagtattggtgagtcggatcgcagcttggatggccacttacctgaa
A0A2K6UWY8_BCL2L1-      atgcaagtattggtgagtcggatcgcagcttggatggccacttacctgaa
A0A2K6TM77_BCL2L2-      atggaaccactggtgggacaagtgcaggagtggatggtggcctacctgga
A0A2K6TM77_BCL2L2-      atggaaccactggtgggacaagtgcaggagtggatggtggcctacctgga
A0A2K6TIT7_BCL2L10      accgtgcc--tggctgg--aggc-tcagggcggctgggtgagcacgcgga
A0A2K6V5Y3_MCL1-01      attgaaccattagcaga--aagtatcacagacgtt-------ctcgt-aa
A0A2K6V5Y3_MCL1-03      attgaaccattagcaga--aagtatcacagacgtt-------ctcgt-aa
                        *         *                       *         *     

A0A2K6TLJ5_BCL2A1-      gaataacacaggagaatggataagacgaaacggaggctggggg-------
A0A2K6TLJ5_BCL2A1-      gaataacacaggagaatggataagacgaaacggaggctggg---------
A0A2K6UEL3_BCL2-01      ccggcacctgcacacctggatccaggataacggaggctgggat------g
A0A2K6UWY8_BCL2L1-      tgaccacctagagccttggatccaggagaacggcggctgggac------a
A0A2K6UWY8_BCL2L1-      tgaccacctagagccttggatccaggagaacggcggctgggac------a
A0A2K6TM77_BCL2L2-      gacgcggctggccgactggatccacagcagtgggggctgggcg------g
A0A2K6TM77_BCL2L2-      gacgcggctggccgactggatccacagcagtgggggctgggagctggaag
A0A2K6TIT7_BCL2L10      ggaggacgtgg--ggcgggatgggcac---------ctgggaa------g
A0A2K6V5Y3_MCL1-01      ggacaaaacgg--gactggctagttaaacaaagaggctgggat------g
A0A2K6V5Y3_MCL1-03      ggacaaaacgg--gactggctagttaaacaaagaggctgggat------g
                                         ** *               *****         

A0A2K6TLJ5_BCL2A1-      --------aaatggaacagtctcatgct------------------tatg
A0A2K6TLJ5_BCL2A1-      -------------------------acc------------------tat-
A0A2K6UEL3_BCL2-01      cctttgtggaactgtatggccccagcatgcggcctctgtttgatt-tctc
A0A2K6UWY8_BCL2L1-      ctttt-----gtgga-------------------------------act-
A0A2K6UWY8_BCL2L1-      ctttt-----gtgga-------------------------------act-
A0A2K6TM77_BCL2L2-      agttc-----acagc-------------------------------tcta
A0A2K6TM77_BCL2L2-      ctatc-----aaagc-------------------------------tcga
A0A2K6TIT7_BCL2L10      ggcccgccaggtggggtatttttctcctgtgcctattaaatgacctccta
A0A2K6V5Y3_MCL1-01      ggttt-----gtggag-----ttcttccatg-----tagagga---tcta
A0A2K6V5Y3_MCL1-03      ggttt-----gtggag-----ttcttccatg-----tagagga---tcta
                                                                          

A0A2K6TLJ5_BCL2A1-      ctagtggag-----------------------------------------
A0A2K6TLJ5_BCL2A1-      --------------------------------------------------
A0A2K6UEL3_BCL2-01      ctggctg-------------------------------------------
A0A2K6UWY8_BCL2L1-      --------------------------------------------------
A0A2K6UWY8_BCL2L1-      --------------------------------------------------
A0A2K6TM77_BCL2L2-      tacgggg---------------------------------------acgg
A0A2K6TM77_BCL2L2-      gtcagggagatggaggaagaagctgagaagctaaaggaactacagaacga
A0A2K6TIT7_BCL2L10      ctcgctg-------------------------------------------
A0A2K6V5Y3_MCL1-01      gaaggtg-------------------------------------------
A0A2K6V5Y3_MCL1-03      gaaggtg-------------------------------------------
                                                                          

A0A2K6TLJ5_BCL2A1-      --------------------------------------------------
A0A2K6TLJ5_BCL2A1-      --------------------------------------------------
A0A2K6UEL3_BCL2-01      --------------------------------------------------
A0A2K6UWY8_BCL2L1-      --------------------------------------------------
A0A2K6UWY8_BCL2L1-      --------------------------------------------------
A0A2K6TM77_BCL2L2-      gg------------------------------------------------
A0A2K6TM77_BCL2L2-      ggtagagaagcagatgaatatgagtccacctccaggcaatgctggaccag
A0A2K6TIT7_BCL2L10      --------------------------------------------------
A0A2K6V5Y3_MCL1-01      --------------------------------------------------
A0A2K6V5Y3_MCL1-03      --------------------------------------------------
                                                                          

A0A2K6TLJ5_BCL2A1-      ---------tcagcgcagaagaagaagaaaatggctttg-----------
A0A2K6TLJ5_BCL2A1-      -------------cgcaatag-----------------------------
A0A2K6UEL3_BCL2-01      ---------tctctgaagactctgctcagcttggccct------------
A0A2K6UWY8_BCL2L1-      ---------ctatggaaacaatg-cagcagccg-----------------
A0A2K6UWY8_BCL2L1-      ---------ctatggaaacaatg-cagcagccg-----------------
A0A2K6TM77_BCL2L2-      ---------ccctggaggaggcg-cggcgtctg-----------------
A0A2K6TM77_BCL2L2-      tgatcatgtccattgaggagaagatggaggctgatgcccgttccatctat
A0A2K6TIT7_BCL2L10      ---------gcatggagaaaactgctggtcccggttttcctgtcatggtt
A0A2K6V5Y3_MCL1-01      ---------gcat-cagaaatgtgctg---ctggcttt------------
A0A2K6V5Y3_MCL1-03      ---------gcat-cagaaatgtgctg---ctggcttt------------
                                                                          

A0A2K6TLJ5_BCL2A1-      --------------------------------------------------
A0A2K6TLJ5_BCL2A1-      --------------------------------------------------
A0A2K6UEL3_BCL2-01      ------------------------------------ggtgggagc-----
A0A2K6UWY8_BCL2L1-      ------------------------agagcagaaagggccaggagc-----
A0A2K6UWY8_BCL2L1-      ------------------------agagcagaaagggccaggagc-----
A0A2K6TM77_BCL2L2-      -------------------------cgggag-gggaactgg---------
A0A2K6TM77_BCL2L2-      gttggcaatgtggactatggtgcaacagcag-aagagctggaagctcact
A0A2K6TIT7_BCL2L10      gttaacagcagcattcatctacttctggacacgataattaggagt-----
A0A2K6V5Y3_MCL1-01      -------------tgcaggtgttgctgg--------agtaggag------
A0A2K6V5Y3_MCL1-03      -------------tgcaggtgttgctgg--------agtaggag------
                                                                          

A0A2K6TLJ5_BCL2A1-      --------------------------------------------------
A0A2K6TLJ5_BCL2A1-      --------------------------------------------------
A0A2K6UEL3_BCL2-01      --------------------------------------------------
A0A2K6UWY8_BCL2L1-      --------------------------------------------------
A0A2K6UWY8_BCL2L1-      --------------------------------------------------
A0A2K6TM77_BCL2L2-      --------------------------------------------------
A0A2K6TM77_BCL2L2-      ttcatggctgtggttcagtcaaccgtgttaccatactctgtgacaaattt
A0A2K6TIT7_BCL2L10      --------------------------------------------------
A0A2K6V5Y3_MCL1-01      --------------------------------------------------
A0A2K6V5Y3_MCL1-03      --------------------------------------------------
                                                                          

A0A2K6TLJ5_BCL2A1-      --------------------------------------------------
A0A2K6TLJ5_BCL2A1-      --------------------------------------------------
A0A2K6UEL3_BCL2-01      --------------------------------------------------
A0A2K6UWY8_BCL2L1-      ---------------------------------------------gcttc
A0A2K6UWY8_BCL2L1-      ---------------------------------------------gcttc
A0A2K6TM77_BCL2L2-      ---------------------------------------------gcatc
A0A2K6TM77_BCL2L2-      agtggccatcccaaagggtttgcatatatagagttctcagacaaagagtc
A0A2K6TIT7_BCL2L10      --------------------------------------------------
A0A2K6V5Y3_MCL1-01      --------------------------------------------------
A0A2K6V5Y3_MCL1-03      --------------------------------------------------
                                                                          

A0A2K6TLJ5_BCL2A1-      --------------------------------------------------
A0A2K6TLJ5_BCL2A1-      --------------------------------------------------
A0A2K6UEL3_BCL2-01      --------------------------------------------------
A0A2K6UWY8_BCL2L1-      aac--------cgctggttcctgacgggcatgactgtggccggcg-----
A0A2K6UWY8_BCL2L1-      aac--------cgctggttcctgacgggcatgactgtggccggcg-----
A0A2K6TM77_BCL2L2-      agtgaggacagtgctgac-------------------aggggccg-----
A0A2K6TM77_BCL2L2-      agtgaggacttccttggccttagacgagtccctatttagaggacggcaaa
A0A2K6TIT7_BCL2L10      --------------------------------------------------
A0A2K6V5Y3_MCL1-01      --------------------------------------------------
A0A2K6V5Y3_MCL1-03      --------------------------------------------------
                                                                          

A0A2K6TLJ5_BCL2A1-      --------------------------------------------------
A0A2K6TLJ5_BCL2A1-      --------------------------------------------------
A0A2K6UEL3_BCL2-01      -------------------------------ttgcatcaccctgggtgcc
A0A2K6UWY8_BCL2L1-      ------------------------------------tggttctgctgggc
A0A2K6UWY8_BCL2L1-      ------------------------------------tggttctgctgggc
A0A2K6TM77_BCL2L2-      ------------------------------------tggcactgggggcc
A0A2K6TM77_BCL2L2-      tcaaggttgactttaaggctttcatttattcatctctgactcaggtgatc
A0A2K6TIT7_BCL2L10      --------------------tttaaaatttttagcccacttctgcctgcc
A0A2K6V5Y3_MCL1-01      -----------------------------------ctggtttggcatatc
A0A2K6V5Y3_MCL1-03      -----------------------------------ctggtttggcatatc
                                                                          

A0A2K6TLJ5_BCL2A1-      --------------------------------------------------
A0A2K6TLJ5_BCL2A1-      --------------------------------------------------
A0A2K6UEL3_BCL2-01      tatctg--------------------------------------------
A0A2K6UWY8_BCL2L1-      tcact---------------------------------------------
A0A2K6UWY8_BCL2L1-      tcact---------------------------------------------
A0A2K6TM77_BCL2L2-      ct-------------------ggtaactgta---------ggggcctt--
A0A2K6TM77_BCL2L2-      ccaaaacgaaccaacagaccaggcatcagcacaacagaccggggttttcc
A0A2K6TIT7_BCL2L10      caactg--------------------------------------------
A0A2K6V5Y3_MCL1-01      taa-ta--------------------------------------------
A0A2K6V5Y3_MCL1-03      taa-ta--------------------------------------------
                                                                          

A0A2K6TLJ5_BCL2A1-      --------------------------------------------------
A0A2K6TLJ5_BCL2A1-      --------------------------------------------------
A0A2K6UEL3_BCL2-01      --------------------------------------------------
A0A2K6UWY8_BCL2L1-      --------------------------------------------------
A0A2K6UWY8_BCL2L1-      --------------------------------------------------
A0A2K6TM77_BCL2L2-      --------------------------------------------------
A0A2K6TM77_BCL2L2-      acgagcccgctaccgcgcacggaccaccaactacaacagttcccgctctc
A0A2K6TIT7_BCL2L10      --------------------------------------------------
A0A2K6V5Y3_MCL1-01      --------------------------------------------------
A0A2K6V5Y3_MCL1-03      --------------------------------------------------
                                                                          

A0A2K6TLJ5_BCL2A1-      --------------------------------------------------
A0A2K6TLJ5_BCL2A1-      --------------------------------------------------
A0A2K6UEL3_BCL2-01      -----------------ggccacaag------------------------
A0A2K6UWY8_BCL2L1-      -------------ctttagtcggaaa------------------------
A0A2K6UWY8_BCL2L1-      -------------ctttagtcggaaa------------------------
A0A2K6TM77_BCL2L2-      -------------ttttgctagcaag------------------------
A0A2K6TM77_BCL2L2-      gattctacagtggttttaacagcaggccccggggtcgcgtctacaggggc
A0A2K6TIT7_BCL2L10      --------------------------------------------------
A0A2K6V5Y3_MCL1-01      --------------------------------------------------
A0A2K6V5Y3_MCL1-03      --------------------------------------------------
                                                                          

A0A2K6TLJ5_BCL2A1-      ---------------------------------taa---
A0A2K6TLJ5_BCL2A1-      ---------------------------------------
A0A2K6UEL3_BCL2-01      ---------------------------------tga---
A0A2K6UWY8_BCL2L1-      ---------------------------------tga---
A0A2K6UWY8_BCL2L1-      ---------------------------------tga---
A0A2K6TM77_BCL2L2-      ---------------------------------tga---
A0A2K6TM77_BCL2L2-      cgggctagagcgacatcatggtattccccttactaa---
A0A2K6TIT7_BCL2L10      ---------------------------------tga---
A0A2K6V5Y3_MCL1-01      ---------------------------------agatag
A0A2K6V5Y3_MCL1-03      ---------------------------------agatag
                                                               

© 1998-2020Legal notice