Dataset for CDS BCL-2-like of organism Saimiri boliviensis boliviensis

[Download (right click)] [Edit] [Sequences] [Repertoires]

14 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A2K6TLG6_BCL2A1-      ---------------------------------atgacagaccacgaatt
A0A2K6TLG6_BCL2A1-      ---------------------------------atgacagaccacgaatt
A0A2K6TLG6_BCL2A1-      ---------------------------------atgacagaccacgaatt
A0A2K6UEL3_BCL2-01      ---------------------------------atggcgcacgctgggag
A0A2K6UWY8_BCL2L1-      --------------------------------------------------
A0A2K6UWY8_BCL2L1-      --------------------------------------------------
A0A2K6TM77_BCL2L2-      ---------------------------------atggcgacccc---agc
A0A2K6TM77_BCL2L2-      catctttcatccttgcctcttatagccgcccggatggcgacccc---agc
A0A2K6TM77_BCL2L2-      --------------------------------------------------
A0A2K6TM77_BCL2L2-      ---------------------------------atggcgacccc---agc
A0A2K6TIT7_BCL2L10      ---------------------------------atggctgaccc---gct
A0A2K6V5X4_MCL1-02      ---------------------------------atgttcggcct----cc
A0A2K6V5X4_MCL1-01      ---------------------------------atgttcggcct----cc
A0A2K6V5X4_MCL1-03      ---------------------------------atgttcggcct----cc
                                                                          

A0A2K6TLG6_BCL2A1-      tggatatattcacaatctaactca---------------ggactatctgc
A0A2K6TLG6_BCL2A1-      tggatatattcacaatctaactca---------------ggactatctgc
A0A2K6TLG6_BCL2A1-      tggatatattcacaatctaactca---------------ggactatctgc
A0A2K6UEL3_BCL2-01      aacagggtacgataaccgggag---------atagtgatgaagtacatcc
A0A2K6UWY8_BCL2L1-      -atgtctcagagcaaccgggag---------ctggtggttgactttctct
A0A2K6UWY8_BCL2L1-      --------------------------------------------------
A0A2K6TM77_BCL2L2-      ctcagccccagacacacgggct---------ctggtggcagactttgtag
A0A2K6TM77_BCL2L2-      ctcagccccagacacacgggct---------ctggtggcagactttgtag
A0A2K6TM77_BCL2L2-      --------------------------------------------------
A0A2K6TM77_BCL2L2-      ctcagccccagacacacgggct---------ctggtggcagactttgtag
A0A2K6TIT7_BCL2L10      gcagcagcgcaccgagcag------------ctggtggcggactacctgg
A0A2K6V5X4_MCL1-02      aaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttg
A0A2K6V5X4_MCL1-01      aaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttg
A0A2K6V5X4_MCL1-03      aaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttg
                                                                          

A0A2K6TLG6_BCL2A1-      ggtatgtcctgcagataccacaatctggaacgggtcc-------------
A0A2K6TLG6_BCL2A1-      ggtatgtcctgcagataccacaatctggaacgggtcc-------------
A0A2K6TLG6_BCL2A1-      ggtatgtcctgcagataccacaatctggaacgggtcc-------------
A0A2K6UEL3_BCL2-01      actataagctgtcgcagaggggctacgagtgggatgc-------------
A0A2K6UWY8_BCL2L1-      cctacaagctttcccagaaaggatacagctggagtcagtttagtgatgtg
A0A2K6UWY8_BCL2L1-      ---------------------------------------------atgtg
A0A2K6TM77_BCL2L2-      gttataagctgaggcagaagggttatgtctgt------------------
A0A2K6TM77_BCL2L2-      gttataagctgaggcagaagggttatgtctgt------------------
A0A2K6TM77_BCL2L2-      --------------------------------------------------
A0A2K6TM77_BCL2L2-      gttataagctgaggcagaagggttatgtctgt------------------
A0A2K6TIT7_BCL2L10      agtactgctcccgggagcccggcacccccgagtcgccacc----------
A0A2K6V5X4_MCL1-02      ggggccggcagcggcggcgccacccccccgggagggcggcttctggccgc
A0A2K6V5X4_MCL1-01      ggggccggcagcggcggcgccacccccccgggagggcggcttctggccgc
A0A2K6V5X4_MCL1-03      ggggccggcagcggcggcgccacccccccgggagggcggcttct------
                                                                          

A0A2K6TLG6_BCL2A1-      -aagcaaaacgtccagagtactacaaaaggttgcattctcag--------
A0A2K6TLG6_BCL2A1-      -aagcaaaacgtccagagtactacaaaaggttgcattctcag--------
A0A2K6TLG6_BCL2A1-      -aagcaaaacgtccagagtactacaaaaggttgcattctcag--------
A0A2K6UEL3_BCL2-01      -cggagatgtgggcgccgcgcccccaggcgccgcccccgcgccgggcatc
A0A2K6UWY8_BCL2L1-      gaagagaacaggactgaggccccagaagggactgattcggagatggagac
A0A2K6UWY8_BCL2L1-      gaagagaacaggactgaggccccagaagggactgattcggagatggagac
A0A2K6TM77_BCL2L2-      ----------ggagctggccccggggagggccc-------agcagctgac
A0A2K6TM77_BCL2L2-      ----------ggagctggccccggggagggccc-------agcagctgac
A0A2K6TM77_BCL2L2-      --------------------------------------------------
A0A2K6TM77_BCL2L2-      ----------ggagctggccccggggagggccc-------agcagctgac
A0A2K6TIT7_BCL2L10      ----------ggccacggcc---------------------gaggccgct
A0A2K6V5X4_MCL1-02      ggagaagga-ggcctcggcccagcgagaggtagggggaggggaggccggc
A0A2K6V5X4_MCL1-01      ggagaagga-ggcctcggcccagcgagaggtagggggaggggaggccggc
A0A2K6V5X4_MCL1-03      --------------------------------------------------
                                                                          

A0A2K6TLG6_BCL2A1-      --------------------------------------------------
A0A2K6TLG6_BCL2A1-      --------------------------------------------------
A0A2K6TLG6_BCL2A1-      --------------------------------------------------
A0A2K6UEL3_BCL2-01      ttctcctcccagcccgggcacacgcccggtcccgctgcgccccgggaccc
A0A2K6UWY8_BCL2L1-      ccccagtgccatcaatggcaacccagcctggcacctggcggacagccccg
A0A2K6UWY8_BCL2L1-      ccccagtgccatcaat----------------------------------
A0A2K6TM77_BCL2L2-      ccgctgcacca---------------------------------------
A0A2K6TM77_BCL2L2-      ccgctgcacca---------------------------------------
A0A2K6TM77_BCL2L2-      --------------------------------------------------
A0A2K6TM77_BCL2L2-      ccgctgcacca---------------------------------------
A0A2K6TIT7_BCL2L10      gtgctg---------------------cgcgccacggccgcc--------
A0A2K6V5X4_MCL1-02      gcggtgattggcggaagcgccggcgctagccctccggccgccctgacgcc
A0A2K6V5X4_MCL1-01      gcggtgattggcggaagcgccggcgctagccctccggccgccctgacgcc
A0A2K6V5X4_MCL1-03      --------------------------------------------------
                                                                          

A0A2K6TLG6_BCL2A1-      --------------------------------------------------
A0A2K6TLG6_BCL2A1-      --------------------------------------------------
A0A2K6TLG6_BCL2A1-      --------------------------------------------------
A0A2K6UEL3_BCL2-01      tgtcgccaggaccnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
A0A2K6UWY8_BCL2L1-      cggtgaatgga--------------------------------------g
A0A2K6UWY8_BCL2L1-      --------------------------------------------------
A0A2K6TM77_BCL2L2-      --------------------------------------------------
A0A2K6TM77_BCL2L2-      --------------------------------------------------
A0A2K6TM77_BCL2L2-      --------------------------------------------------
A0A2K6TM77_BCL2L2-      --------------------------------------------------
A0A2K6TIT7_BCL2L10      -gttgtacgga--------------------------------------a
A0A2K6V5X4_MCL1-02      tgacgcccgga--------------------------------------g
A0A2K6V5X4_MCL1-01      tgacgcccgga--------------------------------------g
A0A2K6V5X4_MCL1-03      --------------------------------------------------
                                                                          

A0A2K6TLG6_BCL2A1-      --------------------------------------------------
A0A2K6TLG6_BCL2A1-      --------------------------------------------------
A0A2K6TLG6_BCL2A1-      --------------------------------------------------
A0A2K6UEL3_BCL2-01      nnnnnnnnnnnnncagcccagtgccacctgtggtccacct----------
A0A2K6UWY8_BCL2L1-      ccacgggccacagcagcagtttggatgcccgggaggtgatccccatggca
A0A2K6UWY8_BCL2L1-      --------------------------------------------------
A0A2K6TM77_BCL2L2-      --------------------------------------------------
A0A2K6TM77_BCL2L2-      --------------------------------------------------
A0A2K6TM77_BCL2L2-      --------------------------------------------------
A0A2K6TM77_BCL2L2-      --------------------------------------------------
A0A2K6TIT7_BCL2L10      actc---tacccgtccttcttctccgc-----------------------
A0A2K6V5X4_MCL1-02      ggtcgtgcggccgccgcccattggcgccgaggtccccgac----------
A0A2K6V5X4_MCL1-01      ggtcgtgcggccgccgcccattggcgccgaggtccccgac----------
A0A2K6V5X4_MCL1-03      --------------------------------------------------
                                                                          

A0A2K6TLG6_BCL2A1-      --------------------------------------------------
A0A2K6TLG6_BCL2A1-      --------------------------------------------------
A0A2K6TLG6_BCL2A1-      --------------------------------------------------
A0A2K6UEL3_BCL2-01      -----------gaccctccgccaggccggcgacgac--------------
A0A2K6UWY8_BCL2L1-      gcaataaagcaagcactgagggaggcaggcgacgag--------------
A0A2K6UWY8_BCL2L1-      --------------------------------------------------
A0A2K6TM77_BCL2L2-      -----------agcaatgcgggcagctggagatgag--------------
A0A2K6TM77_BCL2L2-      -----------agcaatgcgggcagctggagatgag--------------
A0A2K6TM77_BCL2L2-      --------------------------------------------------
A0A2K6TM77_BCL2L2-      -----------agcaatgcgggcagctggagatgag--------------
A0A2K6TIT7_BCL2L10      ------------ttaccgcggctaccccagga------------------
A0A2K6V5X4_MCL1-02      -----------gtcaccgcgaccccctcgaggctgctgttcttcgcgccc
A0A2K6V5X4_MCL1-01      -----------gtcaccgcgaccccctcgaggctgctgttcttcgcgccc
A0A2K6V5X4_MCL1-03      --------------------------------------------------
                                                                          

A0A2K6TLG6_BCL2A1-      ----tccaaaaggaagtggaagagagtctgaagccatgcttggacaacgt
A0A2K6TLG6_BCL2A1-      ----tccaaaaggaagtggaagagagtctgaagccatgcttggacaacgt
A0A2K6TLG6_BCL2A1-      ----tccaaaaggaagtggaagagagtctgaagccatgcttggacaacgt
A0A2K6UEL3_BCL2-01      ----ttctcccgccgctatcgccgcgacttcgccgagatgtccagccagc
A0A2K6UWY8_BCL2L1-      ----tttgaactgcggtaccggcgggcatttagtgacctgacatcccagc
A0A2K6UWY8_BCL2L1-      ------------------------------------------------gc
A0A2K6TM77_BCL2L2-      ----ttcgagacccgcttccggcgcaccttctctgatctggcggctcagc
A0A2K6TM77_BCL2L2-      ----ttcgagacccgcttccggcgcaccttctctgatctggcggctcagc
A0A2K6TM77_BCL2L2-      --------------------------------------------------
A0A2K6TM77_BCL2L2-      ----ttcgagacccgcttccggcgcaccttctctgatctggcggctcagc
A0A2K6TIT7_BCL2L10      ----accgcgtcgagctggtggcgaggatgg-------cggaggccttgc
A0A2K6V5X4_MCL1-02      acccgccgcgcggcgccgctggaggagat----------ggaagccccgg
A0A2K6V5X4_MCL1-01      acccgccgcgcggcgccgctggaggagat----------ggaagccccgg
A0A2K6V5X4_MCL1-03      --------------------------------------------------
                                                                          

A0A2K6TLG6_BCL2A1-      tcatattgtgtccatggacaatgccagaacaatattcagtcaagtgatgg
A0A2K6TLG6_BCL2A1-      tcatattgtgtccatggacaatgccagaacaatattcagtcaagtgatgg
A0A2K6TLG6_BCL2A1-      tcatattgtgtccatggacaatgccagaacaatattcagtcaagtgatgg
A0A2K6UEL3_BCL2-01      tgcacctgacgcccttcaccgcgcggggacg--ctttgccacggtggtgg
A0A2K6UWY8_BCL2L1-      tccacatcacccccgggacagcgtatcaaag--ctttgaacaggtagtga
A0A2K6UWY8_BCL2L1-      tccacatcacccccgggacagcgtatcaaag--ctttgaacaggtagtga
A0A2K6TM77_BCL2L2-      tgcatgtgaccccaggctcagcccaacaacg--cttcacccaggtctccg
A0A2K6TM77_BCL2L2-      tgcatgtgaccccaggctcagcccaacaacg--cttcacccaggtctccg
A0A2K6TM77_BCL2L2-      --------------------------------------------------
A0A2K6TM77_BCL2L2-      tgcatgtgaccccaggctcagcccaacaacg--cttcacccaggtctccg
A0A2K6TIT7_BCL2L10      tctccgacagtcccggtcccacctggggcaa--cgt----ggtgatgctc
A0A2K6V5X4_MCL1-02      ccgccgacgccatcatgtcgcccgaagacga--gctggacgggtacgagc
A0A2K6V5X4_MCL1-01      ccgccgacgccatcatgtcgcccgaagacga--gctggacgggtacgagc
A0A2K6V5X4_MCL1-03      --------------------------------------------------
                                                                          

A0A2K6TLG6_BCL2A1-      aaaaggaatttgaaga--------------------tggcattattaact
A0A2K6TLG6_BCL2A1-      aaaaggaatttgaaga--------------------tggcattattaact
A0A2K6TLG6_BCL2A1-      aaaaggaatttgaaga--------------------tggcattattaact
A0A2K6UEL3_BCL2-01      aggagctcttcaggga-----------------------cggggtgaact
A0A2K6UWY8_BCL2L1-      acgaactcttccggga-----------------------tggggtgaact
A0A2K6UWY8_BCL2L1-      acgaactcttccggga-----------------------tggggtgaact
A0A2K6TM77_BCL2L2-      atgaacttttccaagg-----------------------gggtcccaact
A0A2K6TM77_BCL2L2-      atgaacttttccaagg-----------------------gggtcccaact
A0A2K6TM77_BCL2L2-      --------------------------------------------------
A0A2K6TM77_BCL2L2-      atgaacttttccaagg-----------------------gggtcccaact
A0A2K6TIT7_BCL2L10      ctggccttcgcgggga-----------------cgctgctagagag----
A0A2K6V5X4_MCL1-02      cggagcctctcgggaagcggccggctgtcctgcccctgctggagctggtc
A0A2K6V5X4_MCL1-01      cggagcctctcgggaagcggccggctgtcctgcccctgctggagctggtc
A0A2K6V5X4_MCL1-03      --------------------------------------------------
                                                                          

A0A2K6TLG6_BCL2A1-      ggggaagaattgtaaccatatttgcatttgaaggtattctcatcaag--a
A0A2K6TLG6_BCL2A1-      ggggaagaattgtaaccatatttgcatttgaaggtattctcatcaag--a
A0A2K6TLG6_BCL2A1-      ggggaagaattgtaaccatatttgcatttgaaggtattctcatcaag--a
A0A2K6UEL3_BCL2-01      gggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggag
A0A2K6UWY8_BCL2L1-      ggggtcgcattgtggcctttttctccttcggcggggcactgtgcgtggaa
A0A2K6UWY8_BCL2L1-      ggggtcgcattgtggcctttttctccttcggcggggcactgtgcgtggaa
A0A2K6TM77_BCL2L2-      ggggccgccttgtagccttctttgtctttggggctgcactgtgtgctgag
A0A2K6TM77_BCL2L2-      ggggccgccttgtagccttctttgtctttggggctgcactgtgtgctgag
A0A2K6TM77_BCL2L2-      --------------------------------------------------
A0A2K6TM77_BCL2L2-      ggggccgccttgtagccttctttgtctttggggctgcactgtgtgctgag
A0A2K6TIT7_BCL2L10      ggggccgctggtgaccgcccggtggaagaagtggggcttc--------ca
A0A2K6V5X4_MCL1-02      ggggagcctggtcatggctccagtacggacgggtcactcccctcgacgcc
A0A2K6V5X4_MCL1-01      ggggagcctggtcatggctccagtacggacgggtcactcccctcgacgcc
A0A2K6V5X4_MCL1-03      --------------------------------------------------
                                                                          

A0A2K6TLG6_BCL2A1-      aacttctacgagagcgaattgccccggatg--------------------
A0A2K6TLG6_BCL2A1-      aacttctacgagagcgaattgccccggatg--------------------
A0A2K6TLG6_BCL2A1-      aacttctacgagagcgaattgccccggatg--------------------
A0A2K6UEL3_BCL2-01      agcgtcaaccgggagatgtcgcccctggtggacaacatcgccctgtgga-
A0A2K6UWY8_BCL2L1-      agcgtagacaaggagatgcaagtattggtgagtcggatcgcagcttgga-
A0A2K6UWY8_BCL2L1-      agcgtagacaaggagatgcaagtattggtgagtcggatcgcagcttgga-
A0A2K6TM77_BCL2L2-      agtgtcaacaaggagatggaaccactggtgggacaagtgcaggagtgga-
A0A2K6TM77_BCL2L2-      agtgtcaacaaggagatggaaccactggtgggacaagtgcaggagtgga-
A0A2K6TM77_BCL2L2-      --------------------------------------------------
A0A2K6TM77_BCL2L2-      agtgtcaacaaggagatggaaccactggtgggacaagtgcaggagtgga-
A0A2K6TIT7_BCL2L10      gtcgcggttgaaggagccggagggcga-----------cgtcgcccggga
A0A2K6V5X4_MCL1-02      gccgcccgcagaggaggaggaggacgagttgtaccggcagtcgctggaga
A0A2K6V5X4_MCL1-01      gccgcccgcagaggaggaggaggacgagttgtaccggcagtcgctggaga
A0A2K6V5X4_MCL1-03      --------------------------------------------------
                                                                          

A0A2K6TLG6_BCL2A1-      -----------tggatacttacaaggagatttcgtattttgttgctgagt
A0A2K6TLG6_BCL2A1-      -----------tggatacttacaaggagatttcgtattttgttgctgagt
A0A2K6TLG6_BCL2A1-      -----------tggatacttacaaggagatttcgtattttgttgctgagt
A0A2K6UEL3_BCL2-01      -----------tgaccgagtacctgaa---ccggcacctgcacacctgga
A0A2K6UWY8_BCL2L1-      -----------tggccacttacctgaa---tgaccacctagagccttgga
A0A2K6UWY8_BCL2L1-      -----------tggccacttacctgaa---tgaccacctagagccttgga
A0A2K6TM77_BCL2L2-      -----------tggtggcctacctgga---gacgcggctggccgactgga
A0A2K6TM77_BCL2L2-      -----------tggtggcctacctgga---gacgcggctggccgactgga
A0A2K6TM77_BCL2L2-      --------------------------------------------------
A0A2K6TM77_BCL2L2-      -----------tggtggcctacctgga---gacgcggctggccgactgga
A0A2K6TIT7_BCL2L10      ctgccagcgcctggtgggcttgctgag---ctcgcggctcgtggggcag-
A0A2K6V5X4_MCL1-02      ttatc----tctcggtacctccgggag---caggcgaccggcgccaagga
A0A2K6V5X4_MCL1-01      ttatc----tctcggtacctccgggag---caggcgaccggcgccaagga
A0A2K6V5X4_MCL1-03      --------------------------------ggcgaccggcgccaagga
                                                                          

A0A2K6TLG6_BCL2A1-      tca-------taatgaataacacaggagaatggata--------------
A0A2K6TLG6_BCL2A1-      tca-------taatgaataacacaggagaatggata--------------
A0A2K6TLG6_BCL2A1-      tca-------taatgaataacacaggagaatggata--------------
A0A2K6UEL3_BCL2-01      tcc-------------aggataacggaggctgggat--------------
A0A2K6UWY8_BCL2L1-      tcc-------------aggagaacggcggctgggac--------------
A0A2K6UWY8_BCL2L1-      tcc-------------aggagaacggcggctgggac--------------
A0A2K6TM77_BCL2L2-      tcc-------------acagcagtgggggctgggcg--------------
A0A2K6TM77_BCL2L2-      tcc-------------acagcagtgggggctgggcg--------------
A0A2K6TM77_BCL2L2-      --------------------------------------------------
A0A2K6TM77_BCL2L2-      tcc-------------acagcagtgggggctgggagctggaagctatcaa
A0A2K6TIT7_BCL2L10      caccgtgcctggctggaggctcagggcggctgggtg--------------
A0A2K6V5X4_MCL1-02      cacaaagccaatgggcaggtccggggccgcc-agca--------------
A0A2K6V5X4_MCL1-01      cacaaagccaatgggcaggtccggggccgcc-agca--------------
A0A2K6V5X4_MCL1-03      cacaaagccaatgggcaggtccggggccgcc-agca--------------
                                                                          

A0A2K6TLG6_BCL2A1-      --------------------------------------------------
A0A2K6TLG6_BCL2A1-      --------------------------------------------------
A0A2K6TLG6_BCL2A1-      --------------------------------------------------
A0A2K6UEL3_BCL2-01      --------------------------------------------------
A0A2K6UWY8_BCL2L1-      --------------------------------------------------
A0A2K6UWY8_BCL2L1-      --------------------------------------------------
A0A2K6TM77_BCL2L2-      --------------------------------------------------
A0A2K6TM77_BCL2L2-      --------------------------------------------------
A0A2K6TM77_BCL2L2-      ----------------atggaggaagaagctgagaagctaaaggaactac
A0A2K6TM77_BCL2L2-      agctcgagtcagggagatggaggaagaagctgagaagctaaaggaactac
A0A2K6TIT7_BCL2L10      --------------------------------------------------
A0A2K6V5X4_MCL1-02      --------------------------------------------------
A0A2K6V5X4_MCL1-01      --------------------------------------------------
A0A2K6V5X4_MCL1-03      --------------------------------------------------
                                                                          

A0A2K6TLG6_BCL2A1-      --------------------------------------------------
A0A2K6TLG6_BCL2A1-      --------------------------------------------------
A0A2K6TLG6_BCL2A1-      --------------------------------------------------
A0A2K6UEL3_BCL2-01      ------------------------------------------gcctttgt
A0A2K6UWY8_BCL2L1-      --------------------acttttgtggaactctatggaaacaatgca
A0A2K6UWY8_BCL2L1-      --------------------acttttgtggaactctatggaaacaatgca
A0A2K6TM77_BCL2L2-      ----------------------------gagttcacagct---ctatacg
A0A2K6TM77_BCL2L2-      ----------------------------gagttcacagct---ctatacg
A0A2K6TM77_BCL2L2-      agaacgaggtagagaagcagatgaatatgagtccacctccaggcaatgct
A0A2K6TM77_BCL2L2-      agaacgaggtagagaagcagatgaatatgagtccacctccaggcaatgct
A0A2K6TIT7_BCL2L10      -------------------------------------agcacgcggagga
A0A2K6V5X4_MCL1-02      -------------------------------------ggaaggcgctgga
A0A2K6V5X4_MCL1-01      -------------------------------------ggaaggcgctgga
A0A2K6V5X4_MCL1-03      -------------------------------------ggaaggcgctgga
                                                                          

A0A2K6TLG6_BCL2A1-      -----------------------agacgaaacggaggc------------
A0A2K6TLG6_BCL2A1-      -----------------------agacgaaacggaggc------------
A0A2K6TLG6_BCL2A1-      -----------------------agacgaaacggaggc------------
A0A2K6UEL3_BCL2-01      ggaactg------------------------tatggccc-----------
A0A2K6UWY8_BCL2L1-      gcagccg----------------agagcagaaagggcc------------
A0A2K6UWY8_BCL2L1-      gcagccg----------------agagcagaaagggcc------------
A0A2K6TM77_BCL2L2-      gggacgg-------ggccctggaggaggcg-cggcgtctg----------
A0A2K6TM77_BCL2L2-      gggacgg-------ggccctggaggaggcg-cggcgtctg----------
A0A2K6TM77_BCL2L2-      ggaccagtgatcatgtccattgaggagaagatggaggctgatgcccgttc
A0A2K6TM77_BCL2L2-      ggaccagtgatcatgtccattgaggagaagatggaggctgatgcccgttc
A0A2K6TIT7_BCL2L10      ggacgtg----------------gggcgggatggg---------------
A0A2K6V5X4_MCL1-02      gaccctg----------------cggcgggtcggggacggcgtgcagcgc
A0A2K6V5X4_MCL1-01      gaccctg----------------cggcgggtcggggacggcgtgcagcgc
A0A2K6V5X4_MCL1-03      gaccctg----------------cggcgggtcggggacggcgtgcagcgc
                                                                          

A0A2K6TLG6_BCL2A1-      --------------------------------tgggggaa-------atg
A0A2K6TLG6_BCL2A1-      --------------------------------tgggaaaatggctttgta
A0A2K6TLG6_BCL2A1-      --------------------------------tgggac------------
A0A2K6UEL3_BCL2-01      --------------------------------cagcatgcggcctctgtt
A0A2K6UWY8_BCL2L1-      ------------------------------------aggagcgcttcaac
A0A2K6UWY8_BCL2L1-      ------------------------------------aggagcgcttcaac
A0A2K6TM77_BCL2L2-      --------------------------------cgggaggggaactgg---
A0A2K6TM77_BCL2L2-      --------------------------------cgggaggggaactgg---
A0A2K6TM77_BCL2L2-      catctatgttggcaatgtggactatggtgcaacagcagaagagctggaag
A0A2K6TM77_BCL2L2-      catctatgttggcaatgtggactatggtgcaacagcagaagagctggaag
A0A2K6TIT7_BCL2L10      cac-----------------------------ctgggaagggcccgccag
A0A2K6V5X4_MCL1-02      aac-----------------------------cacgagacggccttccaa
A0A2K6V5X4_MCL1-01      aac-----------------------------cacgagacggccttccaa
A0A2K6V5X4_MCL1-03      aac-----------------------------cacgagacggccttccaa
                                                                          

A0A2K6TLG6_BCL2A1-      --------------------------------------------------
A0A2K6TLG6_BCL2A1-      --------------------------------------------------
A0A2K6TLG6_BCL2A1-      --------------------------------------------------
A0A2K6UEL3_BCL2-01      --------------------------------------------------
A0A2K6UWY8_BCL2L1-      --------------------------------------------------
A0A2K6UWY8_BCL2L1-      --------------------------------------------------
A0A2K6TM77_BCL2L2-      --------------------------------------------------
A0A2K6TM77_BCL2L2-      --------------------------------------------------
A0A2K6TM77_BCL2L2-      --------------------------------------------------
A0A2K6TM77_BCL2L2-      --------------------------------------------------
A0A2K6TIT7_BCL2L10      g-------------------------------------------------
A0A2K6V5X4_MCL1-02      --------------------------------------------------
A0A2K6V5X4_MCL1-01      ggcatgcttcggaaactggacatcaaaaacgaagacgatgtcaaatcttt
A0A2K6V5X4_MCL1-03      ggcatgcttcggaaactggacatcaaaaacgaagacgatgtcaaatcttt
                                                                          

A0A2K6TLG6_BCL2A1-      --------------------------------------------------
A0A2K6TLG6_BCL2A1-      --------------------------------------------------
A0A2K6TLG6_BCL2A1-      --------------------------------------------------
A0A2K6UEL3_BCL2-01      --------------------------------------------------
A0A2K6UWY8_BCL2L1-      --------------------------------------------------
A0A2K6UWY8_BCL2L1-      --------------------------------------------------
A0A2K6TM77_BCL2L2-      --------------------------------------------------
A0A2K6TM77_BCL2L2-      --------------------------------------------------
A0A2K6TM77_BCL2L2-      --------------------------------------------------
A0A2K6TM77_BCL2L2-      --------------------------------------------------
A0A2K6TIT7_BCL2L10      -------------------------------------------tggggta
A0A2K6V5X4_MCL1-02      --------------------------------------------------
A0A2K6V5X4_MCL1-01      gtctcgagtgatggtccatgttttcagcgacggcgtaacaaactggggta
A0A2K6V5X4_MCL1-03      gtctcgagtgatggtccatgttttcagcgacggcgtaacaaactggggta
                                                                          

A0A2K6TLG6_BCL2A1-      --------------------------------------------------
A0A2K6TLG6_BCL2A1-      --------------------------------------------------
A0A2K6TLG6_BCL2A1-      --------------------------------------------------
A0A2K6UEL3_BCL2-01      ---------------tgatttctcctggctg-------------------
A0A2K6UWY8_BCL2L1-      ---------------cgctggttcctgacgg-------------------
A0A2K6UWY8_BCL2L1-      ---------------cgctggttcctgacgg-------------------
A0A2K6TM77_BCL2L2-      --------------------------------------------------
A0A2K6TM77_BCL2L2-      --------------------------------------------------
A0A2K6TM77_BCL2L2-      ---------------ctcactttcatggctgtggttcagtcaaccgtgtt
A0A2K6TM77_BCL2L2-      ---------------ctcactttcatggctgtggttcagtcaaccgtgtt
A0A2K6TIT7_BCL2L10      t--------------ttttctcctgtgcctat------------------
A0A2K6V5X4_MCL1-02      --------------------------------------------------
A0A2K6V5X4_MCL1-01      ggattgtgactctcatttcttttggtgcctttgtggccaaacacttgaag
A0A2K6V5X4_MCL1-03      ggattgtgactctcatttcttttggtgcctttgtggccaaacacttgaag
                                                                          

A0A2K6TLG6_BCL2A1-      --------------------------------------------------
A0A2K6TLG6_BCL2A1-      --------------------------------------------------
A0A2K6TLG6_BCL2A1-      --------------------------------------------------
A0A2K6UEL3_BCL2-01      --------------------------------------------------
A0A2K6UWY8_BCL2L1-      --------------------------------------------------
A0A2K6UWY8_BCL2L1-      --------------------------------------------------
A0A2K6TM77_BCL2L2-      --------------------------------------------------
A0A2K6TM77_BCL2L2-      --------------------------------------------------
A0A2K6TM77_BCL2L2-      accatactctgtgacaaatttagtggccatcccaaagggtttgcatatat
A0A2K6TM77_BCL2L2-      accatactctgtgacaaatttagtggccatcccaaagggtttgcatatat
A0A2K6TIT7_BCL2L10      ------------------------------------taaatgacctccta
A0A2K6V5X4_MCL1-02      --------------------------------------------------
A0A2K6V5X4_MCL1-01      accataaaccaagaaagctgcattgaaccattagcagaaagtatcacaga
A0A2K6V5X4_MCL1-03      accataaaccaagaaagctgcattgaaccattagcagaaagtatcacaga
                                                                          

A0A2K6TLG6_BCL2A1-      ----------------------gaacagtctcatgcttatgctag-----
A0A2K6TLG6_BCL2A1-      ----------------------aagaagtttgaacctaaatctggctgga
A0A2K6TLG6_BCL2A1-      --------------------------------------------------
A0A2K6UEL3_BCL2-01      -------------------tctctgaagactctgctc------agcttgg
A0A2K6UWY8_BCL2L1-      ----------------gcatgactgtggcc-------------ggcgtgg
A0A2K6UWY8_BCL2L1-      ----------------gcatgactgtggcc-------------ggcgtgg
A0A2K6TM77_BCL2L2-      ----------------gcatcagtgaggacagtgctgacaggggccgtgg
A0A2K6TM77_BCL2L2-      ----------------gcatcagtgaggacagtgctgacaggggccgtgg
A0A2K6TM77_BCL2L2-      agagttctcagacaaagagtcagtgaggacttccttggccttagacgagt
A0A2K6TM77_BCL2L2-      agagttctcagacaaagagtcagtgaggacttccttggccttagacgagt
A0A2K6TIT7_BCL2L10      ctcgctggcatggagaaaac-----------------------tgctggt
A0A2K6V5X4_MCL1-02      ------------------------------------------------gg
A0A2K6V5X4_MCL1-01      cgttctcgtaaggacaaaacgggactggctagttaaacaaagaggctggg
A0A2K6V5X4_MCL1-03      cgttctcgtaaggacaaaacgggactggctagttaaacaaagaggctggg
                                                                          

A0A2K6TLG6_BCL2A1-      ---------tggagt-----------------------------------
A0A2K6TLG6_BCL2A1-      tgacttttctagaag-----------------------------------
A0A2K6TLG6_BCL2A1-      --------------------------------------------------
A0A2K6UEL3_BCL2-01      ccctggtgggagctt-----------------------------------
A0A2K6UWY8_BCL2L1-      ttctgct-------------------------------------------
A0A2K6UWY8_BCL2L1-      ttctgct-------------------------------------------
A0A2K6TM77_BCL2L2-      cact-----gggggc-----------------------------------
A0A2K6TM77_BCL2L2-      cact-----gggggc-----------------------------------
A0A2K6TM77_BCL2L2-      ccctatttagaggacggcaaatca--------------------------
A0A2K6TM77_BCL2L2-      ccctatttagaggacggcaaatcaaggttgactttaaggctttcatttat
A0A2K6TIT7_BCL2L10      cccggttt------t-----------------------------------
A0A2K6V5X4_MCL1-02      atgggtttgtggagt-----------------------------------
A0A2K6V5X4_MCL1-01      atgggtttgtggagt-----------------------------------
A0A2K6V5X4_MCL1-03      atgggtttgtggagt-----------------------------------
                                                                          

A0A2K6TLG6_BCL2A1-      --------------------cagcgcagaagaagaagaaaatggcttt--
A0A2K6TLG6_BCL2A1-      --------------------ttacaggaaagatctgtgaaatgctatctc
A0A2K6TLG6_BCL2A1-      -------------------------------------------ctatc--
A0A2K6UEL3_BCL2-01      -------------------------------------------------g
A0A2K6UWY8_BCL2L1-      --------------------------------------------------
A0A2K6UWY8_BCL2L1-      --------------------------------------------------
A0A2K6TM77_BCL2L2-      ---------------------------------------cctggtaactg
A0A2K6TM77_BCL2L2-      ---------------------------------------cctggtaactg
A0A2K6TM77_BCL2L2-      -------------aggtgatcccaaaacgaaccaacagaccaggcatcag
A0A2K6TM77_BCL2L2-      tcatctctgactcaggtgatcccaaaacgaaccaacagaccaggcatcag
A0A2K6TIT7_BCL2L10      ----------------cctgtcatg--------------gttgttaacag
A0A2K6V5X4_MCL1-02      ----------------tcttccatgtagaggatctagaaggtggcatcag
A0A2K6V5X4_MCL1-01      ----------------tcttccatgtagaggatctagaaggtggcatcag
A0A2K6V5X4_MCL1-03      ----------------tcttccatgtagaggatctagaaggtggcatcag
                                                                          

A0A2K6TLG6_BCL2A1-      --------------------------------------------------
A0A2K6TLG6_BCL2A1-      tcttg---------------------------------------------
A0A2K6TLG6_BCL2A1-      --------------------------------------------------
A0A2K6UEL3_BCL2-01      catcaccctgggtgcctat-------------------------------
A0A2K6UWY8_BCL2L1-      ------------gggctcact-----------------------------
A0A2K6UWY8_BCL2L1-      ------------gggctcact-----------------------------
A0A2K6TM77_BCL2L2-      ta---------ggggcctt-------------------------------
A0A2K6TM77_BCL2L2-      ta---------ggggcctt-------------------------------
A0A2K6TM77_BCL2L2-      cacaacagaccggggttttccacgagcccgctaccgcgcacggaccacca
A0A2K6TM77_BCL2L2-      cacaacagaccggggttttccacgagcccgctaccgcgcacggaccacca
A0A2K6TIT7_BCL2L10      cagcattcatct-acttctggacacgat----------------------
A0A2K6V5X4_MCL1-02      aaatgtgctgctggcttttgcaggtgttg---------------------
A0A2K6V5X4_MCL1-01      aaatgtgctgctggcttttgcaggtgttg---------------------
A0A2K6V5X4_MCL1-03      aaatgtgctgctggcttttgcaggtgttg---------------------
                                                                          

A0A2K6TLG6_BCL2A1-      ------------------------------------gtaa----------
A0A2K6TLG6_BCL2A1-      ----------------------------------aagcaatactac----
A0A2K6TLG6_BCL2A1-      ------------------------------------gcaatag-------
A0A2K6UEL3_BCL2-01      ----------------------------------ctgggccacaag----
A0A2K6UWY8_BCL2L1-      ----------------------------------ctttagtcggaa----
A0A2K6UWY8_BCL2L1-      ----------------------------------ctttagtcggaa----
A0A2K6TM77_BCL2L2-      ----------------------------------ttttgctagcaa----
A0A2K6TM77_BCL2L2-      ----------------------------------ttttgctagcaa----
A0A2K6TM77_BCL2L2-      actacaacagttcccgctctcgattctacagtggttttaacagcag----
A0A2K6TM77_BCL2L2-      actacaacagttcccgctctcgattctacagtggttttaacagcag----
A0A2K6TIT7_BCL2L10      -------------------------------------aattaggagtttt
A0A2K6V5X4_MCL1-02      ----------------------------------ctggagtaggag----
A0A2K6V5X4_MCL1-01      ----------------------------------ctggagtaggag----
A0A2K6V5X4_MCL1-03      ----------------------------------ctggagtaggag----
                                                                          

A0A2K6TLG6_BCL2A1-      --------------------------------------------------
A0A2K6TLG6_BCL2A1-      --------------------------------------------------
A0A2K6TLG6_BCL2A1-      --------------------------------------------------
A0A2K6UEL3_BCL2-01      --------------------------------------------------
A0A2K6UWY8_BCL2L1-      ---------a----------------------------------------
A0A2K6UWY8_BCL2L1-      ---------a----------------------------------------
A0A2K6TM77_BCL2L2-      ---------g----------------------------------------
A0A2K6TM77_BCL2L2-      ---------g----------------------------------------
A0A2K6TM77_BCL2L2-      ---------gccccggggtcgcgtctaca--ggtcaggatag--------
A0A2K6TM77_BCL2L2-      ---------gccccggggtcgcgtctacaggggccgggctagagcgacat
A0A2K6TIT7_BCL2L10      aaaatttttagcccacttctgcctgcccaac----------tg-------
A0A2K6V5X4_MCL1-02      ------------ctggtttggcatatctaataagatagccttg-------
A0A2K6V5X4_MCL1-01      ------------ctggtttggcatatctaataagatag------------
A0A2K6V5X4_MCL1-03      ------------ctggtttggcatatctaataagatag------------
                                                                          

A0A2K6TLG6_BCL2A1-      --------------------
A0A2K6TLG6_BCL2A1-      -----------------tga
A0A2K6TLG6_BCL2A1-      --------------------
A0A2K6UEL3_BCL2-01      -----------------tga
A0A2K6UWY8_BCL2L1-      -----------------tga
A0A2K6UWY8_BCL2L1-      -----------------tga
A0A2K6TM77_BCL2L2-      -----------------tga
A0A2K6TM77_BCL2L2-      -----------------tga
A0A2K6TM77_BCL2L2-      --------------------
A0A2K6TM77_BCL2L2-      catggtattccccttactaa
A0A2K6TIT7_BCL2L10      -----------------tga
A0A2K6V5X4_MCL1-02      -----------------taa
A0A2K6V5X4_MCL1-01      --------------------
A0A2K6V5X4_MCL1-03      --------------------
                                            

© 1998-2022Legal notice