Dataset for CDS MCL-1 of organism Periophthalmus magnuspinnatus

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A3B4AFB7_MCL1-01      --------------------------ga----------------cacc--
A0A3B4AFB7_MCL1-02      atgaatattattaattctccgaagaggaccgcgttaaaactgtccaccat
                                                  **                ****  

A0A3B4AFB7_MCL1-01      --------------------------------------acatgcctacag
A0A3B4AFB7_MCL1-02      gggcttgtttctgcctcaaaatggactcgcggagggggacatgcactgtg
                                                              ******     *

A0A3B4AFB7_MCL1-01      ggtgtgctaactccaccgcttgg---------------------------
A0A3B4AFB7_MCL1-02      gggctgcagattcttccgcgcagatgcctaggcctgcaactatggacact
                        **  ***  * **  ****   *                           

A0A3B4AFB7_MCL1-01      -----------cacagcccacatttgcggctctcctcatccacgacccac
A0A3B4AFB7_MCL1-02      cgtaaagggaatacggcctcca---gcggctctcctcatccacgacccac
                                    ** ***  **   *************************

A0A3B4AFB7_MCL1-01      agctcttgtaatgaaaaacgaacttttaaataagaacacgcgagaagagg
A0A3B4AFB7_MCL1-02      agctcttgtaatgaaaaacgaacttttaaataagaacacgcgagaagagg

A0A3B4AFB7_MCL1-01      attacgaaaactcagaggggtctctgccatgtacgccagaattccactca
A0A3B4AFB7_MCL1-02      attacgaaaactcagaggggtctctgccatgtacgccagaattccactca

A0A3B4AFB7_MCL1-01      gacagtgaaatggagctctccagctactcggcggagcacgaagtgttaga
A0A3B4AFB7_MCL1-02      gacagtgaaatggagctctccagctactcggcggagcacgaagtgttaga

A0A3B4AFB7_MCL1-01      gagcgacacgaggcagcttcttagcgattttttcaagcttttcacgggga
A0A3B4AFB7_MCL1-02      gagcgacacgaggcagcttcttagcgattttttcaagcttttcacgggga

A0A3B4AFB7_MCL1-01      tttctcagccgaagtggaaacaacgtccggccctatctacaatgaaggga
A0A3B4AFB7_MCL1-02      tttctcagccgaagtggaaacaacgtccggccctatctacaatgaaggga

A0A3B4AFB7_MCL1-01      gttgtggacaagcttttggaaaagcacagatacgcatataatggtatgat
A0A3B4AFB7_MCL1-02      gttgtggacaagcttttggaaaagcacagatacgcatataatggtatgat

A0A3B4AFB7_MCL1-01      aaacaaactggctctggacgacaggggggacgacgtatcgtttattggca
A0A3B4AFB7_MCL1-02      aaacaaactggctctggacgacaggggggacgacgtatcgtttattggca

A0A3B4AFB7_MCL1-01      cagtagccaagagtatctttgaagatggtaccactaactggggtcgtatt
A0A3B4AFB7_MCL1-02      cagtagccaagagtatctttgaagatggtaccactaactggggtcgtatt

A0A3B4AFB7_MCL1-01      gccagccttatagcctttggggctgtggtgtgccagtacctcaagacaaa
A0A3B4AFB7_MCL1-02      gccagccttatagcctttggggctgtggtgtgccagtacctcaagacaaa

A0A3B4AFB7_MCL1-01      aggaagagaaagctgtgtggagcgagtgggccaagaaatttcctcatacc
A0A3B4AFB7_MCL1-02      aggaagagaaagctgtgtggagcgagtgggccaagaaatttcctcatacc

A0A3B4AFB7_MCL1-01      tcctgttggaccaacgagactggctagtcaggaataatgcctgggatggc
A0A3B4AFB7_MCL1-02      tcctgttggaccaacgagactggctagtcaggaataatgcctgggatggc

A0A3B4AFB7_MCL1-01      tttgtcgacttcttcagagtagaagacccagagtcagcagtgaggaacac
A0A3B4AFB7_MCL1-02      tttgtcgacttcttcagagtagaagacccagagtcagcagtgaggaacac

A0A3B4AFB7_MCL1-01      gcttatggctgtagctggattagctggtattggtgcaacgctggccatgt
A0A3B4AFB7_MCL1-02      gcttatggctgtagctggattagctggtattggtgcaacgctggccatgt

A0A3B4AFB7_MCL1-01      tgatcaggtga
A0A3B4AFB7_MCL1-02      tgatcaggtga

© 1998-2020Legal notice