Dataset for CDS BAX-like of Organism Cavia porcellus

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A286Y2U9_BAX-01      ---------------------atgg--------------acgggtcc---
A0A286Y2U9_BAX-02      ---------------------atgg--------------acgggtcc---
A0A286XGM4_BOK-01      gtgagaatcaggttggtggcaatggggttaggtgaag--tcaagt-----
H0UT71_BAK1-01         ---------------------atggcatcagaccaaggcccaggtcctct
                                            ****               *  **     

A0A286Y2U9_BAX-01      ---ggcgagcaccctagagg-----------------aagcgggccca-c
A0A286Y2U9_BAX-02      ---ggcgagcaccctagagg-----------------aagcgggccca-c
A0A286XGM4_BOK-01      ---ggagatcagcctggaggtc---------------atggggccccagc
H0UT71_BAK1-01         ccgggagggctgcggaggggcctccccgctgtctgaggaggagcagcagg
                          ** *  *  *   * **                   *  *   **  

A0A286Y2U9_BAX-01      cagctctgagcaca---------tcatgaagacaggggcccttttgcttc
A0A286Y2U9_BAX-02      cagctctgagcaca---------tcatgaagacaggggcccttttgcttc
A0A286XGM4_BOK-01      cagcctgg--catgggagctgtctctcactcacatgtgtgt-----ccac
H0UT71_BAK1-01         tggtccgggacaccgaggaagttttccagagctacgtgtaccatcgccac
                         *    *  **           *         * * *        *  *

A0A286Y2U9_BAX-01      agggtttcatccaggatcgagcagggcgcatgggcggggacactttggaa
A0A286Y2U9_BAX-02      agg-----------------------------------------------
A0A286XGM4_BOK-01      cag----------------------------gggacgag---ctggagca
H0UT71_BAK1-01         cag--------caggatagaggagggacacagggccgggtacctcgggcg

A0A286Y2U9_BAX-01      -------ctggccatgg----agccggcgccccaggacgcgtccaccaag
A0A286Y2U9_BAX-02      --------------------------------------------------
A0A286XGM4_BOK-01      gatt---cggcccagtg--------tgtaccgcaac---------gtggc
H0UT71_BAK1-01         catcctactgctcactgctgcttcctgtccagcaccctgacccaggtggg

A0A286Y2U9_BAX-01      aagctgggcgagtgtctcaagcgaattggggacgaactggacagcaatat
A0A286Y2U9_BAX-02      --------------------------------------------------
A0A286XGM4_BOK-01      ccgccagctgcacatctccctgcagtcagagcctgtggtgactg------
H0UT71_BAK1-01         ctgccagctggccatc--------atcggagacgacatcaaccg------

A0A286Y2U9_BAX-01      ggagctacagaggatgattgcggccgtgga--------cacagactccc-
A0A286Y2U9_BAX-02      -----------ggatgattgcggccgtgga--------cacagactccc-
A0A286XGM4_BOK-01      -----------atgcgtttctggctgtggc----aggccacatcttctca
H0UT71_BAK1-01         -----------gcgc---tatggcagtgacattgaagccatg---ctcca
                                         *  *** ***          **        * 

A0A286Y2U9_BAX-01      ----------cccgagagg-----------tctttttccgagtggcagct
A0A286Y2U9_BAX-02      ----------cccgagagg-----------tctttttccgagtggcagct
A0A286XGM4_BOK-01      gcag--gcatcacatggggcaaggtggtgtccctctactcggtggctgcg
H0UT71_BAK1-01         gcagctgcagcccacggcggacaacg----ccccggacctgtt--ctaca
                                 * *  *  *            *     *    *  *  * 

A0A286Y2U9_BAX-01      gaaatgttcgctgatgg--------caacttcaactggggccgggttgtc
A0A286Y2U9_BAX-02      gaaatgttcgctgatgg--------caacttcaactggggccgggttgtc
A0A286XGM4_BOK-01      gggctggctgtggactgtgtgcgacaggcccagcctg-----ccatgg--
H0UT71_BAK1-01         agatcgcctgcagcctgtttaagcccggccccacctggggccgcgtggtg
                            *   *  *   *           *     ***        * *  

A0A286Y2U9_BAX-01      gcccttttctattttgccagcaaactggt---------------gctcaa
A0A286Y2U9_BAX-02      gcccttttctattttgccagcaaactggt---------------gctcaa
A0A286XGM4_BOK-01      ----ttcatgccctggtcgactgcctgggggagtttgt------gcgaaa
H0UT71_BAK1-01         gctctcctggccttcggctaccgcctagccctgcatgtctaccagcagca
                           *        * * *  *   ** *                **   *

A0A286Y2U9_BAX-01      ggcgctgtgcaccaaggtacccgagctgatcaggaccatcatgggctgga
A0A286Y2U9_BAX-02      g-------------------------------------------------
A0A286XGM4_BOK-01      gaccctggctacctggctg-----------------------cggcggcg
H0UT71_BAK1-01         cggcctgtctggctttctgggcaaggtgaccaggcttgtagtcgacagca

A0A286Y2U9_BAX-01      cactagacttcctccgagaccgcctgctgagctggatccaggaccagggt
A0A286Y2U9_BAX-02      --------------------------------------------------
A0A286XGM4_BOK-01      tggcgga--------tggaccgatg--tcctgaag---------tgtgtg
H0UT71_BAK1-01         tgctgcagttaaacgtggtccggtggatcgtggagaaaggcggctgggtg

A0A286Y2U9_BAX-01      ggctgggatggcctcctctcgtactttggaaccccgacctggcagacggt
A0A286Y2U9_BAX-02      --------------------------------------------------
A0A286XGM4_BOK-01      gtcagcaccgatcccagcc-------tccactccc--actggctcgtggc
H0UT71_BAK1-01         g-cagccctggactgggccggaaccttccgcccca--tctggactgtggt

A0A286Y2U9_BAX-01      -------gaccatctttgtggccggcgtgctcaccgcc------------
A0A286Y2U9_BAX-02      --------------------------------------------------
A0A286XGM4_BOK-01      cgcgctgtgcaactttgggcgct-tcctgaaggccgcc------------
H0UT71_BAK1-01         -------tacagccttcgccattgtcatggtgg--gccagtatgtgatac

A0A286Y2U9_BAX-01      --tcactgaccatctggaagaacatgggctga
A0A286Y2U9_BAX-02      --------------------------------
A0A286XGM4_BOK-01      -----ttctttgtgctcttgccagagagatga
H0UT71_BAK1-01         gaagattcttcaagtcatcg---------tga

© 1998-2023Legal notice