Dataset for CDS BCL2L1 of organism Neovison vison

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A8C7BPR9_BCL2L1-      atgtctcagagcaaccgggagctggtggttgactttctctcctacaagct
A0A8C7BPR9_BCL2L1-      atgtctcagagcaaccgggagctggtggttgactttctctcctacaagct

A0A8C7BPR9_BCL2L1-      ttcccagaaaggatacagctggagtcagtttagtgatgcagaagagaaca
A0A8C7BPR9_BCL2L1-      ttcccagaaaggatacagctggagtcagtttagtgatgcagaagagaaca

A0A8C7BPR9_BCL2L1-      gaactgaggccccagaagggactgaatcagagatggagacccccagtgcc
A0A8C7BPR9_BCL2L1-      gaactgaggccccagaagggactgaatcagagatggagacccccagtgcc

A0A8C7BPR9_BCL2L1-      atcaatggcaacccatcctggcacttggcggacagccctgcggtgaatgg
A0A8C7BPR9_BCL2L1-      atcaatggcaacccatcctggcacttggcggacagccctgcggtgaatgg

A0A8C7BPR9_BCL2L1-      agccactggccacagcagcagcttggatgcccgggaggtgatccccatgg
A0A8C7BPR9_BCL2L1-      agccactggccacagcagcagcttggatgcccgggaggtgatccccatgg

A0A8C7BPR9_BCL2L1-      cagcggtaaagcaagcgctaagggaggctggggatgagtttgaactgagg
A0A8C7BPR9_BCL2L1-      cagcggtaaagcaagcgctaagggaggctggggatgagtttgaactgagg

A0A8C7BPR9_BCL2L1-      taccggcgggcattcagtgacctgacatctcagcttcacatcacccccgg
A0A8C7BPR9_BCL2L1-      taccggcgggcattcagtgacctgacatctcagcttcacatcacccccgg

A0A8C7BPR9_BCL2L1-      gacagcgtatcagagctttgagcaggtggtgaacgaactcttccgggatg
A0A8C7BPR9_BCL2L1-      gacagcgtatcagagctttgagcaggtggtgaacgaactcttccgggatg

A0A8C7BPR9_BCL2L1-      gggtgaactggggtcgcattgtggcctttttctccttcggtggggctctg
A0A8C7BPR9_BCL2L1-      gggtgaactggggtcgcattgtggcctttttctccttcggtggggctctg

A0A8C7BPR9_BCL2L1-      tgcgtggagagcgtagacaaggagatgcaggcattggtgagtcggatcgc
A0A8C7BPR9_BCL2L1-      tgcgtggagagcgtagacaaggagatgcaggcattggtgagtcggatcgc

A0A8C7BPR9_BCL2L1-      aacttggatggccacttacctgaacgaccacctagagccttggatccagg
A0A8C7BPR9_BCL2L1-      aacttggatggccacttacctgaacgaccacctagagccttggatccagg

A0A8C7BPR9_BCL2L1-      agaacggcggctgggacactttcgtggaactctacgggaacaatgcagca
A0A8C7BPR9_BCL2L1-      agaacggcggctggg-----------------------------------

A0A8C7BPR9_BCL2L1-      gccgagagccggaagggccaggagcgcttcaaccgctggttcctgacagg
A0A8C7BPR9_BCL2L1-      -------tccggactggctta------ttttaccccgagttcctggcaca
                                *****  ***         **  *** *  ******* **  

A0A8C7BPR9_BCL2L1-      catgactgtggctgg--cgtggttctgctgggctcactcttcagtcggaa
A0A8C7BPR9_BCL2L1-      cg-gcctgaggttgggtaagggcttagccagcat--ctgctcagt-gaac
                        *  * *** ** ***     ** *  **  *  *  **  ***** * * 

A0A8C7BPR9_BCL2L1-      atga--------------
A0A8C7BPR9_BCL2L1-      atgaagggttattattag

© 1998-2023Legal notice