Dataset for CDS BCL-2-like of organism Heterocephalus glaber

[Download (right click)] [Edit] [Sequences] [Repertoires]

5 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

G5BQH7_BCL2L1-01      atgtct-----------------cagag-----caactgggagctggtgg
G5BGZ7_BCL2-01        atggcg----cacgctgggagaacagggtatgataaccgggagatagtga
G5BGZ7_BCL2-02        atggcg----cacgctgggagaacagggtatgataaccgggagatagtga
G5ASL3_BCL2L2-01      atggcgaccccagcct-------cagcaccagacacacgggctctggtgg
G5ASL3_BCL2L2-02      atggcgaccccagcct-------cagcaccagacacacgggctctggtgg
                      *** *                  ***        *   ***   * *** 

G5BQH7_BCL2L1-01      ttgactttctctcctacaagctttcccagaaaggatacagctggagtcag
G5BGZ7_BCL2-01        tgaagtacatccactataagctgtcccagaggggctacgagtgg------
G5BGZ7_BCL2-02        tgaagtacatccactataagctgtcccagaggggctacgagtgg------
G5ASL3_BCL2L2-01      ctgactttgtaggctataagctgaggcagaagggttatgtctgt------
G5ASL3_BCL2L2-02      ctgactttgtaggctataagctgaggcagaagggttatgtctgt------
                         * *   *   *** *****    ****  ** **    **       

G5BQH7_BCL2L1-01      ttcagtgatgtggaagagagcaggactgaagccccagaagggactgaatc
G5BGZ7_BCL2-01        ------gatgccggagacggcagcgccgcgccccctg--gggccgccccc
G5BGZ7_BCL2-02        ------gatgccggagacggcagcgccgcgccccctg--gggccgccccc
G5ASL3_BCL2L2-01      ------ggagctgg------------------ccctg--ggg--------
G5ASL3_BCL2L2-02      ------ggagctgg------------------ccctg--ggg--------
                            *  *  *                   *** *  ***        

G5BQH7_BCL2L1-01      agagatggagacccccagtgccatcagtggcaa--------------ccc
G5BGZ7_BCL2-01        acgcctggcatcttctcctcccagccgggtcgaaattccccgcccgctgc
G5BGZ7_BCL2-02        acgcctggcatcttctcctcccagccgggtcgaaattccccgcccgctgc
G5ASL3_BCL2L2-01      --------------------------------------------------
G5ASL3_BCL2L2-02      --------------------------------------------------

G5BQH7_BCL2L1-01      atcctggcacctggcgg--atagccccacggtgaac------ggggcaac
G5BGZ7_BCL2-01        gccccgggacctggccgccaggacctcgccgccgccgcccctggccggcc
G5BGZ7_BCL2-02        gccccgggacctggccgccaggacctcgccgccgccgcccctggccggcc
G5ASL3_BCL2L2-01      -------------------agggcccagcagctgac--------------
G5ASL3_BCL2L2-02      -------------------agggcccagcagctgac--------------
                                         *   **   * *    *              

G5BQH7_BCL2L1-01      tggccacagcagcagtttggatgcccgggaggtgatccccatggcagcag
G5BGZ7_BCL2-01        tcgccgctgccgcggggcctgtgctcagtccggtgccac-----ctgtgg
G5BGZ7_BCL2-02        tcgccgctgccgcggggcctgtgctcagtccggtgccac-----ctgtgg
G5ASL3_BCL2L2-01      ---ccactgcaccaagccatgcgggca-----------------------
G5ASL3_BCL2L2-02      ---ccactgcaccaagccatgcgggca-----------------------
                         ** * **  *         *  *                        

G5BQH7_BCL2L1-01      tgaagcaggctctgagggaagcaggtgacgagtttgaacttcggtaccgg
G5BGZ7_BCL2-01        tccacctgaccctccgccaggccggcgatgacttctcccgtcgctaccgc
G5BGZ7_BCL2-02        tccacctgaccctccgccaggccggcgatgacttctcccgtcgctaccgc
G5ASL3_BCL2L2-01      --------------------gctggagatgagttcgagacccgcttccgt
G5ASL3_BCL2L2-02      --------------------gctggagatgagttcgagacccgcttccgt
                                          ** ** ** ** **       ** * *** 

G5BQH7_BCL2L1-01      cgggcattcagtgacctaacatctcagctccacatcaccccagggacagc
G5BGZ7_BCL2-01        cgcgacttcgccgagatgtccagccagctgcacctgacgcctttcaccgc
G5BGZ7_BCL2-02        cgcgacttcgccgagatgtccagccagctgcacctgacgcctttcaccgc
G5ASL3_BCL2L2-01      cgcaccttctctgatctggctgctcagctgcatgtgacccctggctcagc
G5ASL3_BCL2L2-02      cgcaccttctctgatctggctgctcagctgcatgtgacccctggctcagc
                      **    ***   **  *  *    ***** **  * ** **     * **

G5BQH7_BCL2L1-01      atatcagagctttgaacaggtagtgaatgaactcttccgggatggggtaa
G5BGZ7_BCL2-01        gaggggacgctttgccacggtggtggaggagctcttcagggatggggtga
G5BGZ7_BCL2-02        gaggggacgctttgccacggtggtggaggagctcttcagggatggggtga
G5ASL3_BCL2L2-01      ccagcaacgcttcacccaggtctccgacgaacttttccaagggggcccaa
G5ASL3_BCL2L2-02      ccagcaacgcttcacccaggtctccgacgaacttttccaagggggcccaa
                              ****      ***     * ** ** ***   *  **    *

G5BQH7_BCL2L1-01      actggggtcgcattgtggcctttttctccttcggcggggcattgtgcgtg
G5BGZ7_BCL2-01        actgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtg
G5BGZ7_BCL2-02        actgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtg
G5ASL3_BCL2L2-01      actggggccgtcttgtggccttctttgtctttggggctgccctatgtgct
G5ASL3_BCL2L2-02      actggggccgtcttgtggccttctttgtctttggggctgccctatgtgct
                      *******  *  ********** **    ** ** *  *   * ** *  

G5BQH7_BCL2L1-01      gagagcgtagacaaggagatgcaggtattggtgaggcggatcgcaagctg
G5BGZ7_BCL2-01        gagagcgtcaaccgggagatgtcgcccctggtggacaacattgccctctg
G5BGZ7_BCL2-02        gagagcgtcaaccgggagatgtcgcccctggtggacaacattgccctctg
G5ASL3_BCL2L2-01      gagagtgtcaacaaagagatggaaccactggtgggccaagtgcaggagtg
G5ASL3_BCL2L2-02      gagagtgtcaacaaagagatggaaccactggtgggccaagtgcaggagtg
                      ***** **  **   ******       *****       *       **

G5BQH7_BCL2L1-01      gatggccacttacctgaatgaccacctagagccttggatccaggagaacg
G5BGZ7_BCL2-01        gatgactgagtacctgaaccggcacctgcacacctggatccaggataacg
G5BGZ7_BCL2-02        gatgactgagtacctgaaccggcacctgcacacctggatccaggataacg
G5ASL3_BCL2L2-01      gatggtggcttacctggagacgagactggccgactggatccacagcagtg
G5ASL3_BCL2L2-02      gatggtggcttacctggagacgagactggccgactggatccacagcagtg
                      ****      ****** *       **       ********    *  *

G5BQH7_BCL2L1-01      gaggctgggacacttttgtggaactctacgggaacaatgcagcagccgag
G5BGZ7_BCL2-01        gaggctgggacgcctttgtggagctgtatggccccagtgtt---------
G5BGZ7_BCL2-02        gaggctgg---------gtaggacta------------------------
G5ASL3_BCL2L2-01      ggggctgggcggagttcacagctctatacggggacggggccctggaggag
G5ASL3_BCL2L2-02      ggggctgg------------------------------------------
                      * ******                                          

G5BQH7_BCL2L1-01      agccggaagggccaggaacgcttcaaccgctggttcctgacgggcatgac
G5BGZ7_BCL2-01        ---cggcctctgtttgacttctc------ctggctgtctttgaa---gac
G5BGZ7_BCL2-02        ------------------------------agacagcccacaga---tac
G5ASL3_BCL2L2-01      gcgcggcgtctgcgggaggggaa------ctgggcatcagtgag---gac
G5ASL3_BCL2L2-02      -----------------------------ctgatctccaggggg---aa-
                                                     *                * 

G5BQH7_BCL2L1-01      tgtggctggcatggttctg----------ctgggctcact----------
G5BGZ7_BCL2-01        tctgctcagcctggccctg--gtgggagcctgcatcaccc-tgggtgcct
G5BGZ7_BCL2-02        tatggcaagtctcatgtgt--gttggcctctgggttaaat-tgggggc--
G5ASL3_BCL2L2-01      agtgctgacgggggccgtggcactgggggccctggtaactgtaggggcct
G5ASL3_BCL2L2-02      ------gatgggggctctg--attggcggctggggcagctg---------

G5BQH7_BCL2L1-01      -cttcagtcggaaatga
G5BGZ7_BCL2-01        acctgggacacaagtga
G5BGZ7_BCL2-02        -------------atga
G5ASL3_BCL2L2-01      tttttgctagcaagtga
G5ASL3_BCL2L2-02      ----tgctgggaaggag

© 1998-2021Legal notice