Dataset for CDS BAX-like of Organism Esox lucius

[Download (right click)] [Edit] [Sequences] [Repertoires]

5 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A3P8XLU6_BOK-01      atggagatgctg--------------------------------------
A0A3P8Z3P5_BOK-01      atggaggtgatt--------------------------------------
A0A3P9AFN3_BAX-01      atggcagcgctgtcgggaggaggcga------------------------
A0A3P8Z0R7_BAX-01      atggcagactccagagaaagaaagaaaatagtcgaagatgagccccaggg
C1BWE2_BAX-01          --------------------------------------------------
                                                                         

A0A3P8XLU6_BOK-01      ---------------------cgtcgttcctcagtattcgcagcagaagt
A0A3P8Z3P5_BOK-01      ---------------------cgtcgctcctctgtgtttgcagctggggt
A0A3P9AFN3_BAX-01      ------ttcagattcaggtaatggaactgatcaaattctagaactgg---
A0A3P8Z0R7_BAX-01      tgcagttgggggtgaagatgtcgtcgatgacagaattatggagc------
C1BWE2_BAX-01          -------------------------------------atggagc------
                                                                * *      

A0A3P8XLU6_BOK-01      gatggaagtgtttgaccgttcccccacagacaaggagcttgtatca----
A0A3P8Z3P5_BOK-01      gatggaggcctttgactattccccgtcggacaaagagctggtgttc----
A0A3P9AFN3_BAX-01      gaaaaacattactggccgatttcatctacgagcgggtttgtcgtcatggt
A0A3P8Z0R7_BAX-01      gaacagc------gattgttttc-------agagggtttgtcatccgaag
C1BWE2_BAX-01          gaacagc------gattgttttc-------agagggtttgtcatccgaag
                       **           *     *  *           *   *    *      

A0A3P8XLU6_BOK-01      --caggcaaaggcgctatgcagggactacatcaattccaggctgaatcga
A0A3P8Z3P5_BOK-01      --caggccaaggccttgtgcagggactacatccactccagactcaacctc
A0A3P9AFN3_BAX-01      gacagcagcactcagttgtcagtgac--a--cggacccag----------
A0A3P8Z0R7_BAX-01      gattagtacagatgatccacagagac--atttgtctccaga---------
C1BWE2_BAX-01          gattagtacagatgatccacagagac--atttgtctccaga---------
                                *     *   *** ***          ****          

A0A3P8XLU6_BOK-01      acagggattgggtggt----cgaaa---caggataatatgttgtctgcat
A0A3P8Z3P5_BOK-01      tacggactgggctcgt----ccaaaacccagg------------------
A0A3P9AFN3_BAX-01      -------ttgggcggg------agtgagctgt------------------
A0A3P8Z0R7_BAX-01      ---agaccttggcggtgaatccaatgaactgg------------------
C1BWE2_BAX-01          ---agaccttggcggtgaatccaatgaactgg------------------
                                 *   *       *     * *                   

A0A3P8XLU6_BOK-01      cgggcgggacgcttggagaggtgtcctctgtcctcctttggttaggcgat
A0A3P8Z3P5_BOK-01      tggactcgacgccttgtgaggtgtccgctgtgcttctctgtctcggtgac
A0A3P9AFN3_BAX-01      gtgaccccaaccataaaaagctggcccagtgtcttcagcagattggcgac
A0A3P8Z0R7_BAX-01      aggaccgtcaaattaaagatgtagtcagccagctgctgataatcgctgac
C1BWE2_BAX-01          aggaccgtcaaattaaagatgtagtcagccagctgctgataatcgctgac
                         * *        *    *  *   *      ** *      * *  ** 

A0A3P8XLU6_BOK-01      gagttggagtacctgcggcctaacatttaccgcaacgtagctcggcagct
A0A3P8Z3P5_BOK-01      gagctggagtgcatgcgaccaagtgtttaccgcaatgtggcgaagcagct
A0A3P9AFN3_BAX-01      gagcttg---------------------atggcaatgcacagctgcaaag
A0A3P8Z0R7_BAX-01      gacctga---------------------atcgaaacgctgagctacaaca
C1BWE2_BAX-01          gacctga---------------------atcgaaacgctgagctacaaca
                       **  *                       *  * ** *        **   

A0A3P8XLU6_BOK-01      c------aacatcaccgtggcatctgagagcgtggtgtcggacgccttcc
A0A3P8Z3P5_BOK-01      c------aacatctcagtggccatggagaccacagtgtccgatgccttcg
A0A3P9AFN3_BAX-01      catgataaataacactgcactccagcccagc------caggaggtgttca
A0A3P8Z0R7_BAX-01      cctaatgagca------cagttcaggccaactgtgcacaggatgtcttct
C1BWE2_BAX-01          cctaatgagca------cagttcaggccaactgtgcacaggatgtcttct
                       *      *  *                 * *         ** *  *** 

A0A3P8XLU6_BOK-01      tggccgtggctgcagagatcttctccacgggtg---taacgtgggggaag
A0A3P8Z3P5_BOK-01      tcgctgtggcaacggagatattctctgcaggaa---tcacttgggggaag
A0A3P9AFN3_BAX-01      tgaaagttgcctgtgaaattttctctgatggcaagttcaactggggcagg
A0A3P8Z0R7_BAX-01      tctcggtggccagggaaatccttgtagatggca---tcaactggggacgt
C1BWE2_BAX-01          tctcggtggccagggaaatccttgtagatggca---tcaactggggacgt
                       *    ** **    ** **  *       **     * *  *****    

A0A3P8XLU6_BOK-01      gtggt-gtccttgtatgcggtggcgggagccctggcgg--tggactgcgt
A0A3P8Z3P5_BOK-01      gtggt-atccatgtatgcggtggctggtgctctagcag--tggactgtgt
A0A3P9AFN3_BAX-01      gtagtggccctcttttactttgcctgccgtcttgtcatcaaggctctgtt
A0A3P8Z0R7_BAX-01      gtggttgcactttttcacctggcttacaagcttatctacttggc---att
C1BWE2_BAX-01          gtggttgcactttttcacctggcttacaagcttatctacttggc---att
                       ** **    *   *   *   *          *  *     **      *

A0A3P8XLU6_BOK-01      gcgccatggttatcccgccatggtccacaccatcgtagactgc-atgggg
A0A3P8Z3P5_BOK-01      gcgtcagaaccagcctgctacggtccagaccatcgtggacagc-ctgggt
A0A3P9AFN3_BAX-01      gaccaagattcct---gacatcatcagaaccattataagctgg---gcca
A0A3P8Z0R7_BAX-01      gacacagaaccacttagaaatcattaagaagattataagctgg-ttatta
C1BWE2_BAX-01          gacacagaaccacttagaaatcattaagaagattataagctggtttatta
                       *    *          *  *   *    *  **  *   * *        

A0A3P8XLU6_BOK-01      gagtttgtccgcaagagcctg--gtctcctggctgaagaggagagggggc
A0A3P8Z3P5_BOK-01      cacttcgtacgtaagaacctg--gcccattggctgaagaaacgtggagga
A0A3P9AFN3_BAX-01      cagactatctgcgggatcatgtgatcaactggatcagggagcagggtggc
A0A3P8Z0R7_BAX-01      cagttcatc--agggaacacgtctccgcttggatcagacagcaaggagga
C1BWE2_BAX-01          cagttcatc--agggaacacgtctccgcttggatcagacagcaaggagga
                        *     *      ** *  *    *   *** * *        ** ** 

A0A3P8XLU6_BOK-01      tgggtggatattacaaagtgcgtggtaaacacggacccaagcttccgctc
A0A3P8Z3P5_BOK-01      tgggcggacattaagaactgtgttgtcaaagtagatgccgtttctcagac
A0A3P9AFN3_BAX-01      tgggagggtattcgttcctattttggca------ctcccacctggcagac
A0A3P8Z0R7_BAX-01      tggga-ggcggtcatcagaagcgtgtca------c-----actggcgtac
C1BWE2_BAX-01          tggga-ggcggtcatcagaagcgtgtca------c-----actggcgtac
                       ****  *    *            *  *              *  *   *

A0A3P8XLU6_BOK-01      ccattggttggtttctgcagcgtgcacctgtggacattacctgaaggccg
A0A3P8Z3P5_BOK-01      ccattggctgtctcctgttgcggagtcctgcaagcactttttgtcaacac
A0A3P9AFN3_BAX-01      tatcggggtgtttct------gg----ctggag-----ttctaaccactg
A0A3P8Z0R7_BAX-01      t------gtgtcgctcgcggcgg----caatag-----ctttcattgccg
C1BWE2_BAX-01          t------gtgtcgctcgcggcgg----caatag-----ctttcattgccg
                               **           *     *             *     *  

A0A3P8XLU6_BOK-01      ttgtgttttacctgcttcgggacaagtga-----
A0A3P8Z3P5_BOK-01      tttatatttacattatgaaggagtcatga-----
A0A3P9AFN3_BAX-01      tgctggtgatccgtaagatg------tga-----
A0A3P8Z0R7_BAX-01      tagtggtttactggaggaaaacccactga-----
C1BWE2_BAX-01          tagtggtttactggaggaaaacccactgacctga
                       *     *   *               ***     

© 1998-2023Legal notice