Dataset for CDS BCL2L1 of organism Mola mola

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A3Q3WIW8_BCL2L1-      atgtc---tgtaaacagagaactggtggcttactacataaactataaact
A0A3Q3X5M5_BCL2L1-      atgtcgcacagtaacagagagctggtggagttctttataagctacaaact
                        *****       ******** *******  * **  **** *** *****

A0A3Q3WIW8_BCL2L1-      ctcccatagaggctgtcctctcaaccacatgggactcatagagcctccca
A0A3Q3X5M5_BCL2L1-      gactcaaaagaactacccaacctctctgttaaggccagaagataccggtg
                          * ** *    **  **   *   *   *  * *    ***  *     

A0A3Q3WIW8_BCL2L1-      acaggactgagggggggcaggcagtgtcagatg--aggaacagcgggtag
A0A3Q3X5M5_BCL2L1-      ggaggactgaaggagacaaggccagctctgctgccagaaatggcttgctg
                          ******** ** *   ****    ** * **  ** **  **  *  *

A0A3Q3WIW8_BCL2L1-      cgacacacgccaatgggacttttaacggtacgagtcccgggacccctcca
A0A3Q3X5M5_BCL2L1-      --------gtcaacagcagtagtaggggt----------ggact------
                                * ***  * * *  **  ***          ****       

A0A3Q3WIW8_BCL2L1-      aggtccccgctgcggctgcaaccgtcgacaacaagtctggacgcagtaaa
A0A3Q3X5M5_BCL2L1-      --gtctcctt-----ccacaggtgctgaca-------tggaggctgttaa
                          *** **       *  **   *  ****       **** ** ** **

A0A3Q3WIW8_BCL2L1-      agatgccctgcgggactctgccaacgagttcgagctgcggtatgcccgcg
A0A3Q3X5M5_BCL2L1-      gtcggcgcttagggactcagccaatgagtttgagcagctcttcacacaag
                            ** **  ******* ***** ***** **** **  *   * *  *

A0A3Q3WIW8_BCL2L1-      ccttcagtgacctgcacaaccagctccacatcacaccggccaccgcctac
A0A3Q3X5M5_BCL2L1-      cgttcagtgacctctcctcgcagcttgacatcacccctgacacagcctat
                        * ***********   *   *****  ******* ** * *** ***** 

A0A3Q3WIW8_BCL2L1-      caaagctttgagaacgtgatggacgaggtgttcagggacggtgtcaactg
A0A3Q3X5M5_BCL2L1-      cacagttttaagagcgtgatggacgaggtgttcaaggacggggtcaactg
                        ** ** *** *** ******************** ****** ********

A0A3Q3WIW8_BCL2L1-      gggacgcatagtcggactcttcgctttcggcggtgcactgtgcgtagagt
A0A3Q3X5M5_BCL2L1-      gggacgtatagtgggactgtttgcctttggaggtgttctatgtgtggaat
                        ****** ***** ***** ** ** ** ** ****  ** ** ** ** *

A0A3Q3WIW8_BCL2L1-      gcgttgagaaggagatgagtccactggtgggcaggatcatcgagtggatg
A0A3Q3X5M5_BCL2L1-      gtgctgagaaggatacaggtgagcttgtttgccgcattgcagactggatg
                        * * ********* *   **   ** **  ** * **    ** ******

A0A3Q3WIW8_BCL2L1-      acggtctatctggacaaccaaatccagccctggatcgagagccagggagg
A0A3Q3X5M5_BCL2L1-      accacttacctggatgagcatattaatccgtggatccagagtcaaggtgg
                        **    ** *****  * ** **  * ** ****** **** ** ** **

A0A3Q3WIW8_BCL2L1-      atggcaacgctttgccgaaatcttcggacaggacgcggctgctgagagca
A0A3Q3X5M5_BCL2L1-      atggggctgctttgctgaggtttttgggcacaacgccgctgcagaagcaa
                        ****    ******* **  * ** ** **  **** ***** **    *

A0A3Q3WIW8_BCL2L1-      ggaggtctcaggagagcttcaagaagtggctgctggccgggatgaccctg
A0A3Q3X5M5_BCL2L1-      ggagatctcaggagactctgaatagatggctcctagtcggggtggcgctg
                        **** **********   * ** *  ***** ** * **** ** * ***

A0A3Q3WIW8_BCL2L1-      gtgaccggagtcgtggttggctcgctcattgtccagaaacgcctgtga
A0A3Q3X5M5_BCL2L1-      ctaatgggagttatggtcggtgtgttcattgctaagaaaca---gtaa
                         * *  *****  **** **   * ******   ******    ** *

© 1998-2020Legal notice