Dataset for CDS MCL-1 of organism Leptobrachium leishanense

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A8C5PJK5_MCL1-01      atgtgcacgtgcacgctaatggagagggg---ttcaaggtgggcagggcc
A0A8C5QRL7_MCL1-01      atg--------------aatggggccgggcattttgtggtggcc------
                        ***              ***** *  ***   **   ***** *      

A0A8C5PJK5_MCL1-01      agaccagaggggctggcttaagcgcagggccgccatgagagcgaagccag
A0A8C5QRL7_MCL1-01      ---------gggctgtttt---------------gtgatggcagag--gg
                                 ******  **                ***  **  **   *

A0A8C5PJK5_MCL1-01      gcaccctccttcactcgctacgagaaggctatggatggattcccggccct
A0A8C5QRL7_MCL1-01      acatgttgtt---------------------tgagtggagcttta---tt
                         **   *  *                     **  ****          *

A0A8C5PJK5_MCL1-01      gtgcttccccctgatcacttcaataaagtttataaaaggcaaccaaacgc
A0A8C5QRL7_MCL1-01      gcgtttctcctgga------------------------------------
                        * * *** **  **                                    

A0A8C5PJK5_MCL1-01      cgtcttacggctgtctcaccaatgtcgtgaaagggcagcttttacagcag
A0A8C5QRL7_MCL1-01      -------------tattccccatgtttt------gcagtatttgcc----
                                     * *  ** ****  *      ****  *** *     

A0A8C5PJK5_MCL1-01      cagagagagacgccgcacgctgcctctcgctttgcggccactccctcgca
A0A8C5QRL7_MCL1-01      -------------------ccccctctcgtttccctggtggtctctcgt-
                                           *  ******* **  * *    ** ****  

A0A8C5PJK5_MCL1-01      cgcccggccactcccccgcgcttaaaactggttggcttgcagtttcccgc
A0A8C5QRL7_MCL1-01      ------gccgtcgcgtttcgctca---------ggcttgca---------
                              ***    *    **** *         ********         

A0A8C5PJK5_MCL1-01      gctgtctgctcagatcattatcaagatggaggcaggaaaggtggctgttg
A0A8C5QRL7_MCL1-01      ---------------catta------------------------------

A0A8C5PJK5_MCL1-01      cgatggcactgagagaaaaagaggtgcaggaagatgccgcaggctacggg
A0A8C5QRL7_MCL1-01      --------------------------catgaagctgctgta---------
                                                  ** **** *** * *         

A0A8C5PJK5_MCL1-01      gacacctgccgagccccggagagcatcatgcaggcctcaaatgccgagaa
A0A8C5QRL7_MCL1-01      --------------------------------------------------

A0A8C5PJK5_MCL1-01      gaaggagagagaggaccacggggacacctaccaggcccaggagaactcca
A0A8C5QRL7_MCL1-01      --------------------------------------------------

A0A8C5PJK5_MCL1-01      tgcaatcctcagaggccgagagagagggtgaggagggccctgaaaccacc
A0A8C5QRL7_MCL1-01      --------------------------------------------------

A0A8C5PJK5_MCL1-01      agagacacctgtcagacccaagagaaccccatgcaaccctcagaggccga
A0A8C5QRL7_MCL1-01      ----------------------------------------caagggccgg
                                                                **  ***** 

A0A8C5PJK5_MCL1-01      gagagaggagggccctgaaagcacctgtcaggcccagaagtgcttcttgg
A0A8C5QRL7_MCL1-01      cgg-----------------------------------------------

A0A8C5PJK5_MCL1-01      agacctcagaggccctggaggagagacaaggtgaggagagccctgaagac
A0A8C5QRL7_MCL1-01      --------------------------------------------------

A0A8C5PJK5_MCL1-01      agcacagacacctgtcagtccctgcagaacttcttggagtcttcagaggc
A0A8C5QRL7_MCL1-01      ------------tgtctgt-----------------------------gc
                                    **** **                             **

A0A8C5PJK5_MCL1-01      cgaacaggaggaggaggatagagatgacaaaaagatggaggctgatgtcc
A0A8C5QRL7_MCL1-01      cgaccag-------------------------------------------
                        *** ***                                           

A0A8C5PJK5_MCL1-01      cggggcccagtcctccgcctgaggatccgcagtgcagacaggacgagctc
A0A8C5QRL7_MCL1-01      ------------ctccgct-------------------------------

A0A8C5PJK5_MCL1-01      ttcctttactcccgcctgctgctcctaaccttcttcagggagtatgccgg
A0A8C5QRL7_MCL1-01      --------------------------------------------------

A0A8C5PJK5_MCL1-01      tggaccagacccgggcccagtgagggctctcatccagctggccatgccca
A0A8C5QRL7_MCL1-01      --------------------------------------------------

A0A8C5PJK5_MCL1-01      acacggccctgcagaccctactgagggtggcgagagagaccatagagagg
A0A8C5QRL7_MCL1-01      acatgg--------------------------------------------
                        *** **                                            

A0A8C5PJK5_MCL1-01      aaccacgcatgcttccagaacaccctgaacaggctttgcattgagaggcc
A0A8C5QRL7_MCL1-01      --------------------catgctgacgaagctgtctatccagcaagc
                                            **  ****  * *** *  **  **    *

A0A8C5PJK5_MCL1-01      agaacacctgcagaagctctccctggtaaccttcgcactgttcagtgatg
A0A8C5QRL7_MCL1-01      ggaggatctccagaagctctctgaggtgccttccttggtcttcaacgatg
                         **  * ** ***********   ***  * * *    * ****  ****

A0A8C5PJK5_MCL1-01      gtgccatcaactggggcagaatcgccaccctgttcagcttcaccgccctc
A0A8C5QRL7_MCL1-01      ggatcacaaattggggcaggattgtgacattaattagctttggcgctttc
                        *   **  ** ******** ** *  **  *  * *****   ***  **

A0A8C5PJK5_MCL1-01      gtggcccgacacctgaagaacctagggatgaatgacagcatctttacgct
A0A8C5QRL7_MCL1-01      cttgcaaaacatttgcagagcataaaactggaggactgtatcgttccact
                         * **   ***  ** *** * **    ** * *** * *** ** * **

A0A8C5PJK5_MCL1-01      cgcagacggcgtcgcccgattcctcaccatcaccaagagaagctggttcc
A0A8C5QRL7_MCL1-01      ggcagataatttcacggattaccttatgaccagcaaacgggaatggatta
                         *****     ** *    * *** *  * ** ***  *    *** *  

A0A8C5PJK5_MCL1-01      aggaacatcaaggctgggacggttttgtggagttcttccttgtcagtcgc
A0A8C5QRL7_MCL1-01      tgcaacaaaaaagctgggatggttttgtagagtttttccacgttgaggac
                         * ****  ** ******* ******** ***** ****  **      *

A0A8C5PJK5_MCL1-01      tggcaaaccggcatcaggattgccctgttggcactcgctatctttgcagg
A0A8C5QRL7_MCL1-01      tatgaaagcggactcagaactgttctgatgacctttgccggagttgctgg
                        *   *** ***  **** * **  *** ** *  * **     **** **

A0A8C5PJK5_MCL1-01      aatcgccacaagcctcctgtaccttatcatgtga
A0A8C5QRL7_MCL1-01      aatcggagcaagtcttgcctatatgatccggtga
                        *****   **** **    **  * ***  ****

© 1998-2023Legal notice