Dataset for CDS MCL-1 of organism Suricata suricatta

[Download (right click)] [Alignment] [Repertoires]

5 sequence(s)

>gnl|bcl2dbcds|A0A673TBH1_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Suricata suricatta GN=MCL-1 (length=1482 residues).
atgtttggcctcaagaggaacgccgtaatcggactcaacctctactgtgggggggccgggttgggggccgggagtggcgg
cgcctcctcttcgggaggggggcttttagccgtagggaaggaggccacggcccggcgggaggtagggggaggggaagccg
gtgcggtgattggcggaagcgccggcgcgagccccccggccacttttgcgcccgacgcccggagggtcgcgcggccctcg
cccattggcgccgagggccccgacgtcacggctacctccccgaagctgctgttctatgcggccacccgctgtgcgtcgcc
gcctgaagagatggaaggccccgcggccgacgccatcatgtcgcccgaagaggagctggacgggtacgagccggaaccct
tggggaagcggccggccgtcctgcctttgctggagctggtcggggaggccagcggtggccccggcacggacggctcactg
ccctcgacgccacccccggtggaggaggaggaggacgagttgttccggcagtcgttagagattatctctcggtaccttcg
ggagcaggcgaccggcgccaaggacgggaagccactgggcgggtccggggcggccagccgaaaggcgttagagaccctgc
gccgggtcggcgacggcgtacagcgaaaccacgagacggccttccaaggcatgcttcggaaactggacatcaaaaacgaa
gacgatgtcaaatctttgtctcgagtgatggtccacgttttcagtgacggagtaacaaactggggcaggattgtgactct
catttcttttggtgcctttgtggccaaacatttgaagagtataaaccaagaaagctgcatcgaaccattagcagaaagca
tcacagatgttctcgtaaggacgaaacgagactggctagtcaaacaaagaggctgggcacagggacccctggaagtctgg
cttctggaagtggagacctggactcagacctcagaattgccggggtcagataaaggggtcccaggctgcaggctcgcatg
tcaggggggcggcctcccggcgcacaggtctgctcacttgtacctactctggcttcctcctggctcaacccatgggcctc
cccactcccaaggcagactacggaccgtcgctggattcctgtcccacactcagcagagcactgttgaggaagtgatggcg
aactcgccgactcctctggccgcgcccacaccgcacggagcactgagggtaggagagcctcccagagcctggattcgcag
gcatcctcccgctcctccagttccagggcctttgacccaggacctgcctcagtccctgcctggccaattacgtgactctg
tgtgctggagggcaggctgggcatgtggctctgggccccaacccctggctcagtgtcttatctgctttatggatgggggc
tgcacaagagatctcattcatgaaaaagcttctgctgattaa
>gnl|bcl2dbcds|A0A673TBH1_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Suricata suricatta GN=MCL-1 (length=1029 residues).
atgtttggcctcaagaggaacgccgtaatcggactcaacctctactgtgggggggccgggttgggggccgggagtggcgg
cgcctcctcttcgggaggggggcttttagccgtagggaaggaggccacggcccggcgggaggtagggggaggggaagccg
gtgcggtgattggcggaagcgccggcgcgagccccccggccacttttgcgcccgacgcccggagggtcgcgcggccctcg
cccattggcgccgagggccccgacgtcacggctacctccccgaagctgctgttctatgcggccacccgctgtgcgtcgcc
gcctgaagagatggaaggccccgcggccgacgccatcatgtcgcccgaagaggagctggacgggtacgagccggaaccct
tggggaagcggccggccgtcctgcctttgctggagctggtcggggaggccagcggtggccccggcacggacggctcactg
ccctcgacgccacccccggtggaggaggaggaggacgagttgttccggcagtcgttagagattatctctcggtaccttcg
ggagcaggcgaccggcgccaaggacgggaagccactgggcgggtccggggcggccagccgaaaggcgttagagaccctgc
gccgggtcggcgacggcgtacagcgaaaccacgagacggccttccaaggcatgcttcggaaactggacatcaaaaacgaa
gacgatgtcaaatctttgtctcgagtgatggtccacgttttcagtgacggagtaacaaactggggcaggattgtgactct
catttcttttggtgcctttgtggccaaacatttgaagagtataaaccaagaaagctgcatcgaaccattagcagaaagca
tcacagatgttctcgtaaggacgaaacgagactggctagtcaaacaaagaggctgggcacagggacccctggaagtctgg
cttctggaagtggagacctggactcagacctcagaattgccggggtcagataaaggttccctgctttag
>gnl|bcl2dbcds|A0A673TBH1_MCL1-03 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Suricata suricatta GN=MCL-1 (length=1086 residues).
atgtttggcctcaagaggaacgccgtaatcggactcaacctctactgtgggggggccgggttgggggccgggagtggcgg
cgcctcctcttcgggaggggggcttttagccgtagggaaggaggccacggcccggcgggaggtagggggaggggaagccg
gtgcggtgattggcggaagcgccggcgcgagccccccggccacttttgcgcccgacgcccggagggtcgcgcggccctcg
cccattggcgccgagggccccgacgtcacggctacctccccgaagctgctgttctatgcggccacccgctgtgcgtcgcc
gcctgaagagatggaaggccccgcggccgacgccatcatgtcgcccgaagaggagctggacgggtacgagccggaaccct
tggggaagcggccggccgtcctgcctttgctggagctggtcggggaggccagcggtggccccggcacggacggctcactg
ccctcgacgccacccccggtggaggaggaggaggacgagttgttccggcagtcgttagagattatctctcggtaccttcg
ggagcaggcgaccggcgccaaggacgggaagccactgggcgggtccggggcggccagccgaaaggcgttagagaccctgc
gccgggtcggcgacggcgtacagcgaaaccacgagacggccttccaaggcatgcttcggaaactggacatcaaaaacgaa
gacgatgtcaaatctttgtctcgagtgatggtccacgttttcagtgacggagtaacaaactggggcaggattgtgactct
catttcttttggtgcctttgtggccaaacatttgaagagtataaaccaagaaagctgcatcgaaccattagcagaaagca
tcacagatgttctcgtaaggacgaaacgagactggctagtcaaacaaagaggctgggatgggtttgtggagttcttccat
gtagaggacctagaaggtggcatcagaaatgtgctgctggcttttgcaggcacagggacccctggaagtctggcttctgg
aagtggagacctggactcagacctcagaattgccggggtcagataa
>gnl|bcl2dbcds|A0A673TBH1_MCL1-04 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Suricata suricatta GN=MCL-1 (length=1053 residues).
atgtttggcctcaagaggaacgccgtaatcggactcaacctctactgtgggggggccgggttgggggccgggagtggcgg
cgcctcctcttcgggaggggggcttttagccgtagggaaggaggccacggcccggcgggaggtagggggaggggaagccg
gtgcggtgattggcggaagcgccggcgcgagccccccggccacttttgcgcccgacgcccggagggtcgcgcggccctcg
cccattggcgccgagggccccgacgtcacggctacctccccgaagctgctgttctatgcggccacccgctgtgcgtcgcc
gcctgaagagatggaaggccccgcggccgacgccatcatgtcgcccgaagaggagctggacgggtacgagccggaaccct
tggggaagcggccggccgtcctgcctttgctggagctggtcggggaggccagcggtggccccggcacggacggctcactg
ccctcgacgccacccccggtggaggaggaggaggacgagttgttccggcagtcgttagagattatctctcggtaccttcg
ggagcaggcgaccggcgccaaggacgggaagccactgggcgggtccggggcggccagccgaaaggcgttagagaccctgc
gccgggtcggcgacggcgtacagcgaaaccacgagacggccttccaaggcatgcttcggaaactggacatcaaaaacgaa
gacgatgtcaaatctttgtctcgagtgatggtccacgttttcagtgacggagtaacaaactggggcaggattgtgactct
catttcttttggtgcctttgtggccaaacatttgaagagtataaaccaagaaagctgcatcgaaccattagcagaaagca
tcacagatgttctcgtaaggacgaaacgagactggctagtcaaacaaagaggctgggatgggtttgtggagttcttccat
gtagaggacctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcata
tctaataagatag
>gnl|bcl2dbcds|A0A673TBH1_MCL1-05 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Suricata suricatta GN=MCL-1 (length=594 residues).
atgtttggcctcaagaggaacgccgtaatcggactcaacctctactgtgggggggccgggttgggggccgggagtggcgg
cgcctcctcttcgggaggggggcttttagcgaccggcgccaaggacgggaagccactgggcgggtccggggcggccagcc
gaaaggcgttagagaccctgcgccgggtcggcgacggcgtacagcgaaaccacgagacggccttccaaggcatgcttcgg
aaactggacatcaaaaacgaagacgatgtcaaatctttgtctcgagtgatggtccacgttttcagtgacggagtaacaaa
ctggggcaggattgtgactctcatttcttttggtgcctttgtggccaaacatttgaagagtataaaccaagaaagctgca
tcgaaccattagcagaaagcatcacagatgttctcgtaaggacgaaacgagactggctagtcaaacaaagaggctgggat
gggtttgtggagttcttccatgtagaggacctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctgg
agtaggagctggtttggcatatctaataagatag
© 1998-2020Legal notice