Dataset for CDS MCL-1 of organism Suricata suricatta

[Download (right click)] [Sequences] [Repertoires]

5 sequence(s)

CLUSTAL W (1.8) multiple sequence alignment


A0A673TBH1_MCL1-04      atgtttggcctcaagaggaacgccgtaatcggactcaacctctactgtgg
A0A673TBH1_MCL1-03      atgtttggcctcaagaggaacgccgtaatcggactcaacctctactgtgg
A0A673TBH1_MCL1-01      atgtttggcctcaagaggaacgccgtaatcggactcaacctctactgtgg
A0A673TBH1_MCL1-05      atgtttggcctcaagaggaacgccgtaatcggactcaacctctactgtgg
A0A673TBH1_MCL1-02      atgtttggcctcaagaggaacgccgtaatcggactcaacctctactgtgg
                        **************************************************

A0A673TBH1_MCL1-04      gggggccgggttgggggccgggagtggcggcgcctcctcttcgggagggg
A0A673TBH1_MCL1-03      gggggccgggttgggggccgggagtggcggcgcctcctcttcgggagggg
A0A673TBH1_MCL1-01      gggggccgggttgggggccgggagtggcggcgcctcctcttcgggagggg
A0A673TBH1_MCL1-05      gggggccgggttgggggccgggagtggcggcgcctcctcttcgggagggg
A0A673TBH1_MCL1-02      gggggccgggttgggggccgggagtggcggcgcctcctcttcgggagggg
                        **************************************************

A0A673TBH1_MCL1-04      ggcttttagccgtagggaaggaggccacggcccggcgggaggtaggggga
A0A673TBH1_MCL1-03      ggcttttagccgtagggaaggaggccacggcccggcgggaggtaggggga
A0A673TBH1_MCL1-01      ggcttttagccgtagggaaggaggccacggcccggcgggaggtaggggga
A0A673TBH1_MCL1-05      ggcttttag-----------------------------------------
A0A673TBH1_MCL1-02      ggcttttagccgtagggaaggaggccacggcccggcgggaggtaggggga
                        *********                                         

A0A673TBH1_MCL1-04      ggggaagccggtgcggtgattggcggaagcgccggcgcgagccccccggc
A0A673TBH1_MCL1-03      ggggaagccggtgcggtgattggcggaagcgccggcgcgagccccccggc
A0A673TBH1_MCL1-01      ggggaagccggtgcggtgattggcggaagcgccggcgcgagccccccggc
A0A673TBH1_MCL1-05      --------------------------------------------------
A0A673TBH1_MCL1-02      ggggaagccggtgcggtgattggcggaagcgccggcgcgagccccccggc
                                                                          

A0A673TBH1_MCL1-04      cacttttgcgcccgacgcccggagggtcgcgcggccctcgcccattggcg
A0A673TBH1_MCL1-03      cacttttgcgcccgacgcccggagggtcgcgcggccctcgcccattggcg
A0A673TBH1_MCL1-01      cacttttgcgcccgacgcccggagggtcgcgcggccctcgcccattggcg
A0A673TBH1_MCL1-05      --------------------------------------------------
A0A673TBH1_MCL1-02      cacttttgcgcccgacgcccggagggtcgcgcggccctcgcccattggcg
                                                                          

A0A673TBH1_MCL1-04      ccgagggccccgacgtcacggctacctccccgaagctgctgttctatgcg
A0A673TBH1_MCL1-03      ccgagggccccgacgtcacggctacctccccgaagctgctgttctatgcg
A0A673TBH1_MCL1-01      ccgagggccccgacgtcacggctacctccccgaagctgctgttctatgcg
A0A673TBH1_MCL1-05      --------------------------------------------------
A0A673TBH1_MCL1-02      ccgagggccccgacgtcacggctacctccccgaagctgctgttctatgcg
                                                                          

A0A673TBH1_MCL1-04      gccacccgctgtgcgtcgccgcctgaagagatggaaggccccgcggccga
A0A673TBH1_MCL1-03      gccacccgctgtgcgtcgccgcctgaagagatggaaggccccgcggccga
A0A673TBH1_MCL1-01      gccacccgctgtgcgtcgccgcctgaagagatggaaggccccgcggccga
A0A673TBH1_MCL1-05      --------------------------------------------------
A0A673TBH1_MCL1-02      gccacccgctgtgcgtcgccgcctgaagagatggaaggccccgcggccga
                                                                          

A0A673TBH1_MCL1-04      cgccatcatgtcgcccgaagaggagctggacgggtacgagccggaaccct
A0A673TBH1_MCL1-03      cgccatcatgtcgcccgaagaggagctggacgggtacgagccggaaccct
A0A673TBH1_MCL1-01      cgccatcatgtcgcccgaagaggagctggacgggtacgagccggaaccct
A0A673TBH1_MCL1-05      --------------------------------------------------
A0A673TBH1_MCL1-02      cgccatcatgtcgcccgaagaggagctggacgggtacgagccggaaccct
                                                                          

A0A673TBH1_MCL1-04      tggggaagcggccggccgtcctgcctttgctggagctggtcggggaggcc
A0A673TBH1_MCL1-03      tggggaagcggccggccgtcctgcctttgctggagctggtcggggaggcc
A0A673TBH1_MCL1-01      tggggaagcggccggccgtcctgcctttgctggagctggtcggggaggcc
A0A673TBH1_MCL1-05      --------------------------------------------------
A0A673TBH1_MCL1-02      tggggaagcggccggccgtcctgcctttgctggagctggtcggggaggcc
                                                                          

A0A673TBH1_MCL1-04      agcggtggccccggcacggacggctcactgccctcgacgccacccccggt
A0A673TBH1_MCL1-03      agcggtggccccggcacggacggctcactgccctcgacgccacccccggt
A0A673TBH1_MCL1-01      agcggtggccccggcacggacggctcactgccctcgacgccacccccggt
A0A673TBH1_MCL1-05      --------------------------------------------------
A0A673TBH1_MCL1-02      agcggtggccccggcacggacggctcactgccctcgacgccacccccggt
                                                                          

A0A673TBH1_MCL1-04      ggaggaggaggaggacgagttgttccggcagtcgttagagattatctctc
A0A673TBH1_MCL1-03      ggaggaggaggaggacgagttgttccggcagtcgttagagattatctctc
A0A673TBH1_MCL1-01      ggaggaggaggaggacgagttgttccggcagtcgttagagattatctctc
A0A673TBH1_MCL1-05      --------------------------------------------------
A0A673TBH1_MCL1-02      ggaggaggaggaggacgagttgttccggcagtcgttagagattatctctc
                                                                          

A0A673TBH1_MCL1-04      ggtaccttcgggagcaggcgaccggcgccaaggacgggaagccactgggc
A0A673TBH1_MCL1-03      ggtaccttcgggagcaggcgaccggcgccaaggacgggaagccactgggc
A0A673TBH1_MCL1-01      ggtaccttcgggagcaggcgaccggcgccaaggacgggaagccactgggc
A0A673TBH1_MCL1-05      ------------------cgaccggcgccaaggacgggaagccactgggc
A0A673TBH1_MCL1-02      ggtaccttcgggagcaggcgaccggcgccaaggacgggaagccactgggc
                                          ********************************

A0A673TBH1_MCL1-04      gggtccggggcggccagccgaaaggcgttagagaccctgcgccgggtcgg
A0A673TBH1_MCL1-03      gggtccggggcggccagccgaaaggcgttagagaccctgcgccgggtcgg
A0A673TBH1_MCL1-01      gggtccggggcggccagccgaaaggcgttagagaccctgcgccgggtcgg
A0A673TBH1_MCL1-05      gggtccggggcggccagccgaaaggcgttagagaccctgcgccgggtcgg
A0A673TBH1_MCL1-02      gggtccggggcggccagccgaaaggcgttagagaccctgcgccgggtcgg
                        **************************************************

A0A673TBH1_MCL1-04      cgacggcgtacagcgaaaccacgagacggccttccaaggcatgcttcgga
A0A673TBH1_MCL1-03      cgacggcgtacagcgaaaccacgagacggccttccaaggcatgcttcgga
A0A673TBH1_MCL1-01      cgacggcgtacagcgaaaccacgagacggccttccaaggcatgcttcgga
A0A673TBH1_MCL1-05      cgacggcgtacagcgaaaccacgagacggccttccaaggcatgcttcgga
A0A673TBH1_MCL1-02      cgacggcgtacagcgaaaccacgagacggccttccaaggcatgcttcgga
                        **************************************************

A0A673TBH1_MCL1-04      aactggacatcaaaaacgaagacgatgtcaaatctttgtctcgagtgatg
A0A673TBH1_MCL1-03      aactggacatcaaaaacgaagacgatgtcaaatctttgtctcgagtgatg
A0A673TBH1_MCL1-01      aactggacatcaaaaacgaagacgatgtcaaatctttgtctcgagtgatg
A0A673TBH1_MCL1-05      aactggacatcaaaaacgaagacgatgtcaaatctttgtctcgagtgatg
A0A673TBH1_MCL1-02      aactggacatcaaaaacgaagacgatgtcaaatctttgtctcgagtgatg
                        **************************************************

A0A673TBH1_MCL1-04      gtccacgttttcagtgacggagtaacaaactggggcaggattgtgactct
A0A673TBH1_MCL1-03      gtccacgttttcagtgacggagtaacaaactggggcaggattgtgactct
A0A673TBH1_MCL1-01      gtccacgttttcagtgacggagtaacaaactggggcaggattgtgactct
A0A673TBH1_MCL1-05      gtccacgttttcagtgacggagtaacaaactggggcaggattgtgactct
A0A673TBH1_MCL1-02      gtccacgttttcagtgacggagtaacaaactggggcaggattgtgactct
                        **************************************************

A0A673TBH1_MCL1-04      catttcttttggtgcctttgtggccaaacatttgaagagtataaaccaag
A0A673TBH1_MCL1-03      catttcttttggtgcctttgtggccaaacatttgaagagtataaaccaag
A0A673TBH1_MCL1-01      catttcttttggtgcctttgtggccaaacatttgaagagtataaaccaag
A0A673TBH1_MCL1-05      catttcttttggtgcctttgtggccaaacatttgaagagtataaaccaag
A0A673TBH1_MCL1-02      catttcttttggtgcctttgtggccaaacatttgaagagtataaaccaag
                        **************************************************

A0A673TBH1_MCL1-04      aaagctgcatcgaaccattagcagaaagcatcacagatgttctcgtaagg
A0A673TBH1_MCL1-03      aaagctgcatcgaaccattagcagaaagcatcacagatgttctcgtaagg
A0A673TBH1_MCL1-01      aaagctgcatcgaaccattagcagaaagcatcacagatgttctcgtaagg
A0A673TBH1_MCL1-05      aaagctgcatcgaaccattagcagaaagcatcacagatgttctcgtaagg
A0A673TBH1_MCL1-02      aaagctgcatcgaaccattagcagaaagcatcacagatgttctcgtaagg
                        **************************************************

A0A673TBH1_MCL1-04      acgaaacgagactggctagtcaaacaaagaggctgggatgg---gtttgt
A0A673TBH1_MCL1-03      acgaaacgagactggctagtcaaacaaagaggctgggatgg---gtttgt
A0A673TBH1_MCL1-01      acgaaacgagactggctagtcaaacaaagaggctgggcacagggacccct
A0A673TBH1_MCL1-05      acgaaacgagactggctagtcaaacaaagaggctgggatgg---gtttgt
A0A673TBH1_MCL1-02      acgaaacgagactggctagtcaaacaaagaggctgggcacagggacccct
                        *************************************            *

A0A673TBH1_MCL1-04      ggagttcttccatgtaga-----ggacctagaaggtggcatcagaaatgt
A0A673TBH1_MCL1-03      ggagttcttccatgtaga-----ggacctagaaggtggcatcagaaatgt
A0A673TBH1_MCL1-01      ggaagtctggcttctggaagtggagacctggactcagacctcagaattgc
A0A673TBH1_MCL1-05      ggagttcttccatgtaga-----ggacctagaaggtggcatcagaaatgt
A0A673TBH1_MCL1-02      ggaagtctggcttctggaagtggagacctggactcagacctcagaattgc
                        ***  ***  * * * **      ***** **    * * ****** ** 

A0A673TBH1_MCL1-04      gctgct--------------------------------------------
A0A673TBH1_MCL1-03      gctgct--------------------------------------------
A0A673TBH1_MCL1-01      cggggtcagataaaggggtcccaggctgcaggctcgcatgtcaggggggc
A0A673TBH1_MCL1-05      gctgct--------------------------------------------
A0A673TBH1_MCL1-02      cggggtcagataaaggttccc-----------------------------
                           * *                                            

A0A673TBH1_MCL1-04      ------------------------ggcttttg------------------
A0A673TBH1_MCL1-03      ------------------------ggcttttg------------------
A0A673TBH1_MCL1-01      ggcctcccggcgcacaggtctgctcacttgtacctactctggcttcctcc
A0A673TBH1_MCL1-05      ------------------------ggcttttg------------------
A0A673TBH1_MCL1-02      --------------------------------------------------
                                                                          

A0A673TBH1_MCL1-04      --------------------------------------------------
A0A673TBH1_MCL1-03      --------------------------------------------------
A0A673TBH1_MCL1-01      tggctcaacccatgggcctccccactcccaaggcagactacggaccgtcg
A0A673TBH1_MCL1-05      --------------------------------------------------
A0A673TBH1_MCL1-02      --------------------------------------------------
                                                                          

A0A673TBH1_MCL1-04      --------------------------------------caggtg------
A0A673TBH1_MCL1-03      --------------------------------------caggca------
A0A673TBH1_MCL1-01      ctggattcctgtcccacactcagcagagcactgttgaggaagtgatggcg
A0A673TBH1_MCL1-05      --------------------------------------caggtg------
A0A673TBH1_MCL1-02      --------------------------------------------------
                                                                          

A0A673TBH1_MCL1-04      --------------------------------------------------
A0A673TBH1_MCL1-03      --------------------------------------------------
A0A673TBH1_MCL1-01      aactcgccgactcctctggccgcgcccacaccgcacggagcactgagggt
A0A673TBH1_MCL1-05      --------------------------------------------------
A0A673TBH1_MCL1-02      --------------------------------------------------
                                                                          

A0A673TBH1_MCL1-04      --------------------------------------------------
A0A673TBH1_MCL1-03      --------------------------------------------------
A0A673TBH1_MCL1-01      aggagagcctcccagagcctggattcgcaggcatcctcccgctcctccag
A0A673TBH1_MCL1-05      --------------------------------------------------
A0A673TBH1_MCL1-02      --------------------------------------------------
                                                                          

A0A673TBH1_MCL1-04      --------------------------------------------------
A0A673TBH1_MCL1-03      --------------------------------------------------
A0A673TBH1_MCL1-01      ttccagggcctttgacccaggacctgcctcagtccctgcctggccaatta
A0A673TBH1_MCL1-05      --------------------------------------------------
A0A673TBH1_MCL1-02      --------------------------------------------------
                                                                          

A0A673TBH1_MCL1-04      -----------tt---------------------gctggagtaggagctg
A0A673TBH1_MCL1-03      -----------cagggacccctggaagtctggcttctggaagtggagacc
A0A673TBH1_MCL1-01      cgtgactctgtgt---------------------gctggaggg----cag
A0A673TBH1_MCL1-05      -----------tt---------------------gctggagtaggagctg
A0A673TBH1_MCL1-02      --------------------------------------------------
                                                                          

A0A673TBH1_MCL1-04      gtttggcatat-----------------------------------c---
A0A673TBH1_MCL1-03      tggactcagac-----------------------------------c---
A0A673TBH1_MCL1-01      gctgggcatgtggctctgggccccaacccctggctcagtgtcttatctgc
A0A673TBH1_MCL1-05      gtttggcatat-----------------------------------c---
A0A673TBH1_MCL1-02      --------------------------------------------------
                                                                          

A0A673TBH1_MCL1-04      ----------------------------t------------------aat
A0A673TBH1_MCL1-03      ----------------------------t------cagaattgccggggt
A0A673TBH1_MCL1-01      tttatggatgggggctgcacaagagatctcattcatgaaaaagcttctgc
A0A673TBH1_MCL1-05      ----------------------------t------------------aat
A0A673TBH1_MCL1-02      -------------------------------------------------t
                                                                          

A0A673TBH1_MCL1-04      aagatag
A0A673TBH1_MCL1-03      cagataa
A0A673TBH1_MCL1-01      tgattaa
A0A673TBH1_MCL1-05      aagatag
A0A673TBH1_MCL1-02      gctttag
                            ** 

© 1998-2023Centre National de la Recherche Scientifique logoInstitut national de la sante et de la recherche médicale logoUniversité de Lyon logoLegal notice