Dataset for CDS MCL-1 of organism Suricata suricatta

[Download (right click)] [Edit] [Sequences] [Repertoires]

5 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A673TBH1_MCL1-04      atgtttggcctcaagaggaacgccgtaatcggactcaacctctactgtgg
A0A673TBH1_MCL1-05      atgtttggcctcaagaggaacgccgtaatcggactcaacctctactgtgg
A0A673TBH1_MCL1-03      atgtttggcctcaagaggaacgccgtaatcggactcaacctctactgtgg
A0A673TBH1_MCL1-01      atgtttggcctcaagaggaacgccgtaatcggactcaacctctactgtgg
A0A673TBH1_MCL1-02      atgtttggcctcaagaggaacgccgtaatcggactcaacctctactgtgg

A0A673TBH1_MCL1-04      gggggccgggttgggggccgggagtggcggcgcctcctcttcgggagggg
A0A673TBH1_MCL1-05      gggggccgggttgggggccgggagtggcggcgcctcctcttcgggagggg
A0A673TBH1_MCL1-03      gggggccgggttgggggccgggagtggcggcgcctcctcttcgggagggg
A0A673TBH1_MCL1-01      gggggccgggttgggggccgggagtggcggcgcctcctcttcgggagggg
A0A673TBH1_MCL1-02      gggggccgggttgggggccgggagtggcggcgcctcctcttcgggagggg

A0A673TBH1_MCL1-04      ggcttttagccgtagggaaggaggccacggcccggcgggaggtaggggga
A0A673TBH1_MCL1-05      ggctttta------------------------------------------
A0A673TBH1_MCL1-03      ggcttttagccgtagggaaggaggccacggcccggcgggaggtaggggga
A0A673TBH1_MCL1-01      ggcttttagccgtagggaaggaggccacggcccggcgggaggtaggggga
A0A673TBH1_MCL1-02      ggcttttagccgtagggaaggaggccacggcccggcgggaggtaggggga

A0A673TBH1_MCL1-04      ggggaagccggtgcggtgattggcggaagcgccggcgcgagccccccggc
A0A673TBH1_MCL1-05      --------------------------------------------------
A0A673TBH1_MCL1-03      ggggaagccggtgcggtgattggcggaagcgccggcgcgagccccccggc
A0A673TBH1_MCL1-01      ggggaagccggtgcggtgattggcggaagcgccggcgcgagccccccggc
A0A673TBH1_MCL1-02      ggggaagccggtgcggtgattggcggaagcgccggcgcgagccccccggc

A0A673TBH1_MCL1-04      cacttttgcgcccgacgcccggagggtcgcgcggccctcgcccattggcg
A0A673TBH1_MCL1-05      --------------------------------------------------
A0A673TBH1_MCL1-03      cacttttgcgcccgacgcccggagggtcgcgcggccctcgcccattggcg
A0A673TBH1_MCL1-01      cacttttgcgcccgacgcccggagggtcgcgcggccctcgcccattggcg
A0A673TBH1_MCL1-02      cacttttgcgcccgacgcccggagggtcgcgcggccctcgcccattggcg

A0A673TBH1_MCL1-04      ccgagggccccgacgtcacggctacctccccgaagctgctgttctatgcg
A0A673TBH1_MCL1-05      --------------------------------------------------
A0A673TBH1_MCL1-03      ccgagggccccgacgtcacggctacctccccgaagctgctgttctatgcg
A0A673TBH1_MCL1-01      ccgagggccccgacgtcacggctacctccccgaagctgctgttctatgcg
A0A673TBH1_MCL1-02      ccgagggccccgacgtcacggctacctccccgaagctgctgttctatgcg

A0A673TBH1_MCL1-04      gccacccgctgtgcgtcgccgcctgaagagatggaaggccccgcggccga
A0A673TBH1_MCL1-05      --------------------------------------------------
A0A673TBH1_MCL1-03      gccacccgctgtgcgtcgccgcctgaagagatggaaggccccgcggccga
A0A673TBH1_MCL1-01      gccacccgctgtgcgtcgccgcctgaagagatggaaggccccgcggccga
A0A673TBH1_MCL1-02      gccacccgctgtgcgtcgccgcctgaagagatggaaggccccgcggccga

A0A673TBH1_MCL1-04      cgccatcatgtcgcccgaagaggagctggacgggtacgagccggaaccct
A0A673TBH1_MCL1-05      --------------------------------------------------
A0A673TBH1_MCL1-03      cgccatcatgtcgcccgaagaggagctggacgggtacgagccggaaccct
A0A673TBH1_MCL1-01      cgccatcatgtcgcccgaagaggagctggacgggtacgagccggaaccct
A0A673TBH1_MCL1-02      cgccatcatgtcgcccgaagaggagctggacgggtacgagccggaaccct

A0A673TBH1_MCL1-04      tggggaagcggccggccgtcctgcctttgctggagctggtcggggaggcc
A0A673TBH1_MCL1-05      --------------------------------------------------
A0A673TBH1_MCL1-03      tggggaagcggccggccgtcctgcctttgctggagctggtcggggaggcc
A0A673TBH1_MCL1-01      tggggaagcggccggccgtcctgcctttgctggagctggtcggggaggcc
A0A673TBH1_MCL1-02      tggggaagcggccggccgtcctgcctttgctggagctggtcggggaggcc

A0A673TBH1_MCL1-04      agcggtggccccggcacggacggctcactgccctcgacgccacccccggt
A0A673TBH1_MCL1-05      --------------------------------------------------
A0A673TBH1_MCL1-03      agcggtggccccggcacggacggctcactgccctcgacgccacccccggt
A0A673TBH1_MCL1-01      agcggtggccccggcacggacggctcactgccctcgacgccacccccggt
A0A673TBH1_MCL1-02      agcggtggccccggcacggacggctcactgccctcgacgccacccccggt

A0A673TBH1_MCL1-04      ggaggaggaggaggacgagttgttccggcagtcgttagagattatctctc
A0A673TBH1_MCL1-05      --------------------------------------------------
A0A673TBH1_MCL1-03      ggaggaggaggaggacgagttgttccggcagtcgttagagattatctctc
A0A673TBH1_MCL1-01      ggaggaggaggaggacgagttgttccggcagtcgttagagattatctctc
A0A673TBH1_MCL1-02      ggaggaggaggaggacgagttgttccggcagtcgttagagattatctctc

A0A673TBH1_MCL1-04      ggtaccttcgggagcaggcgaccggcgccaaggacgggaagccactgggc
A0A673TBH1_MCL1-05      -----------------gcgaccggcgccaaggacgggaagccactgggc
A0A673TBH1_MCL1-03      ggtaccttcgggagcaggcgaccggcgccaaggacgggaagccactgggc
A0A673TBH1_MCL1-01      ggtaccttcgggagcaggcgaccggcgccaaggacgggaagccactgggc
A0A673TBH1_MCL1-02      ggtaccttcgggagcaggcgaccggcgccaaggacgggaagccactgggc

A0A673TBH1_MCL1-04      gggtccggggcggccagccgaaaggcgttagagaccctgcgccgggtcgg
A0A673TBH1_MCL1-05      gggtccggggcggccagccgaaaggcgttagagaccctgcgccgggtcgg
A0A673TBH1_MCL1-03      gggtccggggcggccagccgaaaggcgttagagaccctgcgccgggtcgg
A0A673TBH1_MCL1-01      gggtccggggcggccagccgaaaggcgttagagaccctgcgccgggtcgg
A0A673TBH1_MCL1-02      gggtccggggcggccagccgaaaggcgttagagaccctgcgccgggtcgg

A0A673TBH1_MCL1-04      cgacggcgtacagcgaaaccacgagacggccttccaaggcatgcttcgga
A0A673TBH1_MCL1-05      cgacggcgtacagcgaaaccacgagacggccttccaaggcatgcttcgga
A0A673TBH1_MCL1-03      cgacggcgtacagcgaaaccacgagacggccttccaaggcatgcttcgga
A0A673TBH1_MCL1-01      cgacggcgtacagcgaaaccacgagacggccttccaaggcatgcttcgga
A0A673TBH1_MCL1-02      cgacggcgtacagcgaaaccacgagacggccttccaaggcatgcttcgga

A0A673TBH1_MCL1-04      aactggacatcaaaaacgaagacgatgtcaaatctttgtctcgagtgatg
A0A673TBH1_MCL1-05      aactggacatcaaaaacgaagacgatgtcaaatctttgtctcgagtgatg
A0A673TBH1_MCL1-03      aactggacatcaaaaacgaagacgatgtcaaatctttgtctcgagtgatg
A0A673TBH1_MCL1-01      aactggacatcaaaaacgaagacgatgtcaaatctttgtctcgagtgatg
A0A673TBH1_MCL1-02      aactggacatcaaaaacgaagacgatgtcaaatctttgtctcgagtgatg

A0A673TBH1_MCL1-04      gtccacgttttcagtgacggagtaacaaactggggcaggattgtgactct
A0A673TBH1_MCL1-05      gtccacgttttcagtgacggagtaacaaactggggcaggattgtgactct
A0A673TBH1_MCL1-03      gtccacgttttcagtgacggagtaacaaactggggcaggattgtgactct
A0A673TBH1_MCL1-01      gtccacgttttcagtgacggagtaacaaactggggcaggattgtgactct
A0A673TBH1_MCL1-02      gtccacgttttcagtgacggagtaacaaactggggcaggattgtgactct

A0A673TBH1_MCL1-04      catttcttttggtgcctttgtggccaaacatttgaagagtataaaccaag
A0A673TBH1_MCL1-05      catttcttttggtgcctttgtggccaaacatttgaagagtataaaccaag
A0A673TBH1_MCL1-03      catttcttttggtgcctttgtggccaaacatttgaagagtataaaccaag
A0A673TBH1_MCL1-01      catttcttttggtgcctttgtggccaaacatttgaagagtataaaccaag
A0A673TBH1_MCL1-02      catttcttttggtgcctttgtggccaaacatttgaagagtataaaccaag

A0A673TBH1_MCL1-04      aaagctgcatcgaaccattagcagaaagcatcacagatgttctcgtaagg
A0A673TBH1_MCL1-05      aaagctgcatcgaaccattagcagaaagcatcacagatgttctcgtaagg
A0A673TBH1_MCL1-03      aaagctgcatcgaaccattagcagaaagcatcacagatgttctcgtaagg
A0A673TBH1_MCL1-01      aaagctgcatcgaaccattagcagaaagcatcacagatgttctcgtaagg
A0A673TBH1_MCL1-02      aaagctgcatcgaaccattagcagaaagcatcacagatgttctcgtaagg

A0A673TBH1_MCL1-04      acgaaacgagactggctagtcaaacaaagaggctgggatgggtttgtgga
A0A673TBH1_MCL1-05      acgaaacgagactggctagtcaaacaaagaggctgggatgggtttgtgga
A0A673TBH1_MCL1-03      acgaaacgagactggctagtcaaacaaagaggctgggatgggtttgtgga
A0A673TBH1_MCL1-01      acgaaacgagactggctagtcaaacaaagaggctg---------------
A0A673TBH1_MCL1-02      acgaaacgagactggctagtcaaacaaagaggctg---------------

A0A673TBH1_MCL1-04      gttcttccatgtagaggacctagaaggtggcatcagaaatgtgctgctgg
A0A673TBH1_MCL1-05      gttcttccatgtagaggacctagaaggtggcatcagaaatgtgctgctgg
A0A673TBH1_MCL1-03      gttcttccatgtagaggacctagaaggtggcatcagaaatgtgctgctgg
A0A673TBH1_MCL1-01      --------------------------------------------------
A0A673TBH1_MCL1-02      --------------------------------------------------

A0A673TBH1_MCL1-04      cttttgcaggt---------------------gttgctggagtaggag--
A0A673TBH1_MCL1-05      cttttgcaggt---------------------gttgctggagtaggag--
A0A673TBH1_MCL1-03      cttttgcaggcacagggacccctggaagtctggcttctggaagtggagac
A0A673TBH1_MCL1-01      --------ggcacagggacccctggaagtctggcttctggaagtggagac
A0A673TBH1_MCL1-02      --------ggcacagggacccctggaagtctggcttctggaagtggagac
                                **                      * * *****   ****  

A0A673TBH1_MCL1-04      ctggtttggcatatctaa----------taagatag--------------
A0A673TBH1_MCL1-05      ctggtttggcatatctaa----------taagatag--------------
A0A673TBH1_MCL1-03      ctggactcagacctcagaattgccggggtcagataa--------------
A0A673TBH1_MCL1-01      ctggactcagacctcagaattgccggggtcagataaaggggtcccaggct
A0A673TBH1_MCL1-02      ctggactcagacctcagaattgccggggtcagataaagg-----------
                        ****  *   *  **  *          * *****               

A0A673TBH1_MCL1-04      --------------------------------------------------
A0A673TBH1_MCL1-05      --------------------------------------------------
A0A673TBH1_MCL1-03      --------------------------------------------------
A0A673TBH1_MCL1-01      gcaggctcgcatgtcaggggggcggcctcccggcgcacaggtctgctcac
A0A673TBH1_MCL1-02      --------------------------------------------------

A0A673TBH1_MCL1-04      --------------------------------------------------
A0A673TBH1_MCL1-05      --------------------------------------------------
A0A673TBH1_MCL1-03      --------------------------------------------------
A0A673TBH1_MCL1-01      ttgtacctactctggcttcctcctggctcaacccatgggcctccccactc
A0A673TBH1_MCL1-02      --------------------------------------------------

A0A673TBH1_MCL1-04      --------------------------------------------------
A0A673TBH1_MCL1-05      --------------------------------------------------
A0A673TBH1_MCL1-03      --------------------------------------------------
A0A673TBH1_MCL1-01      ccaaggcagactacggaccgtcgctggattcctgtcccacactcagcaga
A0A673TBH1_MCL1-02      --------------------------------------------------

A0A673TBH1_MCL1-04      --------------------------------------------------
A0A673TBH1_MCL1-05      --------------------------------------------------
A0A673TBH1_MCL1-03      --------------------------------------------------
A0A673TBH1_MCL1-01      gcactgttgaggaagtgatggcgaactcgccgactcctctggccgcgccc
A0A673TBH1_MCL1-02      --------------------------------------------------

A0A673TBH1_MCL1-04      --------------------------------------------------
A0A673TBH1_MCL1-05      --------------------------------------------------
A0A673TBH1_MCL1-03      --------------------------------------------------
A0A673TBH1_MCL1-01      acaccgcacggagcactgagggtaggagagcctcccagagcctggattcg
A0A673TBH1_MCL1-02      --------------------------------------------------

A0A673TBH1_MCL1-04      --------------------------------------------------
A0A673TBH1_MCL1-05      --------------------------------------------------
A0A673TBH1_MCL1-03      --------------------------------------------------
A0A673TBH1_MCL1-01      caggcatcctcccgctcctccagttccagggcctttgacccaggacctgc
A0A673TBH1_MCL1-02      --------------------------------------------------

A0A673TBH1_MCL1-04      --------------------------------------------------
A0A673TBH1_MCL1-05      --------------------------------------------------
A0A673TBH1_MCL1-03      --------------------------------------------------
A0A673TBH1_MCL1-01      ctcagtccctgcctggccaattacgtgactctgtgtgctggagggcaggc
A0A673TBH1_MCL1-02      --------------------------------------------------

A0A673TBH1_MCL1-04      --------------------------------------------------
A0A673TBH1_MCL1-05      --------------------------------------------------
A0A673TBH1_MCL1-03      --------------------------------------------------
A0A673TBH1_MCL1-01      tgggcatgtggctctgggccccaacccctggctcagtgtcttatctgctt
A0A673TBH1_MCL1-02      ----------------------------------------ttccctgctt

A0A673TBH1_MCL1-04      --------------------------------------------------
A0A673TBH1_MCL1-05      --------------------------------------------------
A0A673TBH1_MCL1-03      --------------------------------------------------
A0A673TBH1_MCL1-01      tatggatgggggctgcacaagagatctcattcatgaaaaagcttctgctg
A0A673TBH1_MCL1-02      tag-----------------------------------------------

A0A673TBH1_MCL1-04      -----
A0A673TBH1_MCL1-05      -----
A0A673TBH1_MCL1-03      -----
A0A673TBH1_MCL1-01      attaa
A0A673TBH1_MCL1-02      -----

© 1998-2021Legal notice