Dataset for CDS BCL2L1 of organism Macaca mulatta

[Download (right click)] [Edit] [Sequences] [Repertoires]

5 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A5F7ZJK5_BCL2L1-      atgtctcagagcaaccgggagctggtggttgactttctctcctacaagct
A0A5F7ZJK5_BCL2L1-      atgtctcagagcaaccgggagctggtggttgactttctctcctacaagct
A0A5F7ZJK5_BCL2L1-      atgtctcagagcaaccgggagctggtggttgactttctctcctacaagct
A0A5F7ZJK5_BCL2L1-      atgtctcagagcaaccgggagctggtggttgactttctctcctacaagct
A0A5F7ZJK5_BCL2L1-      atgtctcagagcaaccgggagctggtggttgactttctctcctacaagct
                        **************************************************

A0A5F7ZJK5_BCL2L1-      ttcccagaaaggatacagctggagtcaatttagtgatgtggaagagaaca
A0A5F7ZJK5_BCL2L1-      ttcccagaaaggatacagctggagtcaatttagtgatgtggaagagaaca
A0A5F7ZJK5_BCL2L1-      ttcccagaaaggatacagctggagtcaatttagtgatgtggaagagaaca
A0A5F7ZJK5_BCL2L1-      ttcccagaaaggatacagctggagtcaatttagtgatgtggaagagaaca
A0A5F7ZJK5_BCL2L1-      ttcccagaaaggatacagctggagtcaatttagtgatgtggaagagaaca
                        **************************************************

A0A5F7ZJK5_BCL2L1-      ggactgaggccccagaagggactgaatcggagatggagacccccagtgcc
A0A5F7ZJK5_BCL2L1-      ggactgaggccccagaagggactgaatcggagatggagacccccagtgcc
A0A5F7ZJK5_BCL2L1-      ggactgaggccccagaagggactgaatcggagatggagacccccagtgcc
A0A5F7ZJK5_BCL2L1-      ggactgaggccccagaagggactgaatcggagatggagacccccagtgcc
A0A5F7ZJK5_BCL2L1-      ggactgaggccccagaagggactgaatcggagatggagacccccagtgcc
                        **************************************************

A0A5F7ZJK5_BCL2L1-      atcaatggcaacccatcctggcacctggtggacagccccgcggtgaatgg
A0A5F7ZJK5_BCL2L1-      atcaatggcaacccatcctggcacctggtggacagccccgcggtgaatgg
A0A5F7ZJK5_BCL2L1-      atcaatggcaacccatcctggcacctggtggacagccccgcggtgaatgg
A0A5F7ZJK5_BCL2L1-      atcaatggcaacccatcctggcacctggtggacagccccgcggtgaatgg
A0A5F7ZJK5_BCL2L1-      atcaatggcaacccatcctggcacctggtggacagccccgcggtgaatgg
                        **************************************************

A0A5F7ZJK5_BCL2L1-      agccactggccacagcagcagtttggatgcccgggaggtgatccccatgg
A0A5F7ZJK5_BCL2L1-      agccactggccacagcagcagtttggatgcccgggaggtgatccccatgg
A0A5F7ZJK5_BCL2L1-      agccactggccacagcagcagtttggatgcccgggaggtgatccccatgg
A0A5F7ZJK5_BCL2L1-      agccactggccacagcagcagtttggatgcccgggaggtgatccccatgg
A0A5F7ZJK5_BCL2L1-      agccactggccacagcagcagtttggatgcccgggaggtgatccccatgg
                        **************************************************

A0A5F7ZJK5_BCL2L1-      cagcagtaaagcaagcgctgagggaggcaggcgacgagtttgaactgcgg
A0A5F7ZJK5_BCL2L1-      cagcagtaaagcaagcgctgagggaggcaggcgacgagtttgaactgcgg
A0A5F7ZJK5_BCL2L1-      cagcagtaaagcaagcgctgagggaggcaggcgacgagtttgaactgcgg
A0A5F7ZJK5_BCL2L1-      cagcagtaaagcaagcgctgagggaggcaggcgacgagtttgaactgcgg
A0A5F7ZJK5_BCL2L1-      cagcagtaaagcaagcgctgagggaggcaggcgacgagtttgaactgcgg
                        **************************************************

A0A5F7ZJK5_BCL2L1-      taccggcgggcgttcagtgacctgacatcccagctccacatcaccccagg
A0A5F7ZJK5_BCL2L1-      taccggcgggcgttcagtgacctgacatcccagctccacatcaccccagg
A0A5F7ZJK5_BCL2L1-      taccggcgggcgttcagtgacctgacatcccagctccacatcaccccagg
A0A5F7ZJK5_BCL2L1-      taccggcgggcgttcagtgacctgacatcccagctccacatcaccccagg
A0A5F7ZJK5_BCL2L1-      taccggcgggcgttcagtgacctgacatcccagctccacatcaccccagg
                        **************************************************

A0A5F7ZJK5_BCL2L1-      gacagcatatcagagctttgaacaggtagtgaatgaactcttccgggatg
A0A5F7ZJK5_BCL2L1-      gacagcatatcagagctttgaacaggtagtgaatgaactcttccgggatg
A0A5F7ZJK5_BCL2L1-      gacagcatatcagagctttgaacaggtagtgaatgaactcttccgggatg
A0A5F7ZJK5_BCL2L1-      gacagcatatcagagctttgaacaggtagtgaatgaactcttccgggatg
A0A5F7ZJK5_BCL2L1-      gacagcatatcagagctttgaacaggtagtgaatgaactcttccgggatg
                        **************************************************

A0A5F7ZJK5_BCL2L1-      gggtaaactggggtcgcattgtggcctttttctccttcggcggggcactg
A0A5F7ZJK5_BCL2L1-      gggtaaactggggtcgcattgtggcctttttctccttcggcggggcactg
A0A5F7ZJK5_BCL2L1-      gggtaaactggggtcgcattgtggcctttttctccttcggcggggcactg
A0A5F7ZJK5_BCL2L1-      gggtaaactggggtcgcattgtggcctttttctccttcggcggggcactg
A0A5F7ZJK5_BCL2L1-      gggtaaactggggtcgcattgtggcctttttctccttcggcggggcactg
                        **************************************************

A0A5F7ZJK5_BCL2L1-      tgcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatcgc
A0A5F7ZJK5_BCL2L1-      tgcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatcgc
A0A5F7ZJK5_BCL2L1-      tgcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatcgc
A0A5F7ZJK5_BCL2L1-      tgcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatcgc
A0A5F7ZJK5_BCL2L1-      tgcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatcgc
                        **************************************************

A0A5F7ZJK5_BCL2L1-      agcttggatggccacttacctgaatgaccacctagagccttggatccagg
A0A5F7ZJK5_BCL2L1-      agcttggatggccacttacctgaatgaccacctagagccttggatccagg
A0A5F7ZJK5_BCL2L1-      agcttggatggccacttacctgaatgaccacctagagccttggatccagg
A0A5F7ZJK5_BCL2L1-      agcttggatggccacttacctgaatgaccacctagagccttggatccagg
A0A5F7ZJK5_BCL2L1-      agcttggatggccacttacctgaatgaccacctagagccttggatccagg
                        **************************************************

A0A5F7ZJK5_BCL2L1-      agaacggcggctgggacacttttgtggaactctatgggaacaatgcagca
A0A5F7ZJK5_BCL2L1-      agaacggcggctgggacacttttgtggaactctatgggaacaatgcagca
A0A5F7ZJK5_BCL2L1-      agaacggcggctgggacacttttgtggaactctatgggaacaatgcagca
A0A5F7ZJK5_BCL2L1-      agaacggcggctgggacacttttgtggaactctatgggaacaatgcagca
A0A5F7ZJK5_BCL2L1-      agaacggcggctggagtcttgctgtgtcgccc----------aggctgaa
                        **************     *  ****   * *          * ** * *

A0A5F7ZJK5_BCL2L1-      gccgagagccgaaagggccaggagcgcttcaaccgctggttcctgacggg
A0A5F7ZJK5_BCL2L1-      gccgagagccgaaagggccaggagcgcttcaaccgctggttcctgacggg
A0A5F7ZJK5_BCL2L1-      gccgagagccgaaagggccaggagcgcttcaaccgctggttcctgacggg
A0A5F7ZJK5_BCL2L1-      gccgagagccgaaagggccaggagcgcttcaaccgctggttcctgacggg
A0A5F7ZJK5_BCL2L1-      gttcagtggcgcaa--tctcagctcactacaagctccgcctcccg-----
                        *   ** * ** **   *   *  * ** *** * * *  *** *     

A0A5F7ZJK5_BCL2L1-      catgactgtggccggcgtggttctgctgggctcactcttcagtcggaaat
A0A5F7ZJK5_BCL2L1-      catgactgtggccggcgtggttctgctgggctcactcttcagtcggaaat
A0A5F7ZJK5_BCL2L1-      catgactgtggccggcgtggttctgctgggctcactcttcagtcggaaat
A0A5F7ZJK5_BCL2L1-      catgactgtggccggcgtggttctgctgggctcactcttcagtcggaaat
A0A5F7ZJK5_BCL2L1-      ------tgttcacgccattctcctgc----ctcagcctcc---------t
                              ***   ** * *  * ****    ****  ** *         *

A0A5F7ZJK5_BCL2L1-      ga
A0A5F7ZJK5_BCL2L1-      ga
A0A5F7ZJK5_BCL2L1-      ga
A0A5F7ZJK5_BCL2L1-      ga
A0A5F7ZJK5_BCL2L1-      ga
                        **

© 1998-2020Legal notice