Dataset for CDS BCL2L2 of organism Chinchilla lanigera

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C2VJ88_BCL2L2-      atggcgaccccagcctcggccccagacacacgggctctggtggctgactt
A0A8C2VJ88_BCL2L2-      atggcgaccccagcctcggccccagacacacgggctctggtggctgactt
                        **************************************************

A0A8C2VJ88_BCL2L2-      tgtaggctataagctgaggcagaagggttatgtctgtggagctggccctg
A0A8C2VJ88_BCL2L2-      tgtaggctataagctgaggcagaagggttatgtctgtggagctggccctg
                        **************************************************

A0A8C2VJ88_BCL2L2-      gggagggcccagcagctgacccactgcaccaagccatgcgggcagctgga
A0A8C2VJ88_BCL2L2-      gggagggcccagcagctgacccactgcaccaagccatgcgggcagctgga
                        **************************************************

A0A8C2VJ88_BCL2L2-      gatgagttcgagacccggttccggcgcaccttctcagatctggctgctca
A0A8C2VJ88_BCL2L2-      gatgagttcgagacccggttccggcgcaccttctcagatctggctgctca
                        **************************************************

A0A8C2VJ88_BCL2L2-      gctgcatgtgacccctggctcagcccagcagcgcttcacccaggtctccg
A0A8C2VJ88_BCL2L2-      gctgcatgtgacccctggctcagcccagcagcgcttcacccaggtctccg
                        **************************************************

A0A8C2VJ88_BCL2L2-      acgaacttttccaagggggccccaactggggccgtcttgtggccttcttt
A0A8C2VJ88_BCL2L2-      acgaacttttccaagggggccccaactggggccgtcttgtggccttcttt
                        **************************************************

A0A8C2VJ88_BCL2L2-      gtctttggggctgccctgtgtgctgagagtgtcaacaaagagatggaacc
A0A8C2VJ88_BCL2L2-      gtctttggggctgccctgtgtgctgagagtgtcaacaaagagatggaacc
                        **************************************************

A0A8C2VJ88_BCL2L2-      actggtgggccaagtgcaggagtggatggtggcctacctggagacgcgcc
A0A8C2VJ88_BCL2L2-      actggtgggccaagtgcaggagtggatggtggcctacctggagacgcgcc
                        **************************************************

A0A8C2VJ88_BCL2L2-      tggccgactggatccacagcagtgggggctgggcggagttcacagctcta
A0A8C2VJ88_BCL2L2-      tggccgactggatccacagcagtgggggctggcc-----------ctctg
                        ******************************** *           **** 

A0A8C2VJ88_BCL2L2-      tacggggacggggccctggaggaggcgcggcgtctgcgggaggggaactg
A0A8C2VJ88_BCL2L2-      ca------------------------------------------aagctg
                         *                                           * ***

A0A8C2VJ88_BCL2L2-      ggcatcagtgaggacagtgctgacgggggctgtggcactgggggccctgg
A0A8C2VJ88_BCL2L2-      atctccagggggaa-------gatgggggctctg--attggcagctggga
                          *  *** * * *       ** ******* **  * ***  **   * 

A0A8C2VJ88_BCL2L2-      taactgtaggggccttttttgctagcaagtga
A0A8C2VJ88_BCL2L2-      cagctg-------------tgctaggaaggag
                         * ***             ****** ***   

© 1998-2022Legal notice