Dataset for CDS BCL2L1 of organism Anabas testudineus

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A3Q1GZ93_BCL2L1-      atg-------tctcaa-----aacagagaactggtggttttctacataac
A0A3Q1JZ46_BCL2L1-      atggaagaaatgtcgaacagtaacagagagctggtggagttcttcataat
                        ***       * ** *     ******** *******  **** ***** 

A0A3Q1GZ93_BCL2L1-      atataaactatcccagagaaactatcctctcaaccacttgggactcaatg
A0A3Q1JZ46_BCL2L1-      gtacaaactgtctcaaagaaaccacccagcctctcttctgaggccagatg
                         ** ***** ** ** ****** * **   *   *   ** * *   ***

A0A3Q1GZ93_BCL2L1-      agactcccaacaggactgatgggggggaagatgggttgagtgaggaacag
A0A3Q1JZ46_BCL2L1-      a------------taccggtggagtgggagacagacccaactcag--cag
                        *             ** * *** * ** ***  *    *     *  ***

A0A3Q1GZ93_BCL2L1-      cggatagcaac--gcacgccaacgggacttttaatggtagaagtcccggg
A0A3Q1JZ46_BCL2L1-      ctgctaacggcctgccggtcagcagga---------gtggcgagctgggg
                        * * ** *  *  **  * ** * ***         ** *    *  ***

A0A3Q1GZ93_BCL2L1-      acccccccagcgtccccgctgcggcaacaacggttgccatcaacgacgag
A0A3Q1JZ46_BCL2L1-      aact------cgtcacctccgtg---------------------taagag
                        * *       **** ** * * *                      * ***

A0A3Q1GZ93_BCL2L1-      cctggatgcggtgaaagaggccctccgggactcggccaacgagtttgagt
A0A3Q1JZ46_BCL2L1-      catggaggccgtaaaaacagctcttagggactctgctgacgagtttgaac
                        * **** ** ** ***   ** **  ******* **  **********  

A0A3Q1GZ93_BCL2L1-      tacgatacgctcgagccttcagcgatctgcacaaccagctgcatatcacg
A0A3Q1JZ46_BCL2L1-      tgctcttcacacaagcgtttagtgacctttcctcgcagcttgatgtcacg
                        * *  * * * * *** ** ** ** **   *   *****  ** *****

A0A3Q1GZ93_BCL2L1-      cctgccacagcctaccaaagcttcgagaacgtcatggatgaagtgttccg
A0A3Q1JZ46_BCL2L1-      cccgacacggcctatcaaagctttaagagtgtgatggacgagttgttcaa
                        ** * *** ***** ********  ***  ** ***** **  *****  

A0A3Q1GZ93_BCL2L1-      ggacggtgtcaactggggccgcattgtagggctttttgcgttcggtgggg
A0A3Q1JZ46_BCL2L1-      ggatggagtcaactggggacgtatagtggggctgtttgccttcggtggcg
                        *** ** *********** ** ** ** ***** ***** ******** *

A0A3Q1GZ93_BCL2L1-      cgctgtgcgtcgagtgtgtggagaaggagatgagtcagctggtgggaagg
A0A3Q1JZ46_BCL2L1-      tgctgtgtgtggaatgtgtggagaagaatatgagtgagctggtatcccga
                         ****** ** ** ************ * ****** *******     * 

A0A3Q1GZ93_BCL2L1-      atcgtagagtggatgacagtctacctggacaaccacattcagccctggat
A0A3Q1JZ46_BCL2L1-      atcgcagactggatgaccatgtacctggatgagcacatcagtccttggat
                        **** *** ********  * ********  * *****    ** *****

A0A3Q1GZ93_BCL2L1-      ccaaagccaaggaggatgggagcgctttgctgagctcttcggccacgacg
A0A3Q1JZ46_BCL2L1-      ccagagccagggaggatgggactgctttgctgagatatttgggcaagatg
                        *** ***** ***********  *********** * ** ** ** ** *

A0A3Q1GZ93_BCL2L1-      cagcagcagagggcaggcggtctcaggagagtttcaagaagtggctgctg
A0A3Q1JZ46_BCL2L1-      ccgctgctgaggcgaggagatctcgggaggctctgagaagatggctgcta
                        * ** ** ****  *** * **** ****  * * *  *  ******** 

A0A3Q1GZ93_BCL2L1-      gcaggcatgaccctggtgactggggtcgtggtggggtcactcatagcgca
A0A3Q1JZ46_BCL2L1-      gttggagtggtgctgctcacgggagtgctgttaggtgtgctcattgctaa
                        *  **  **   *** * ** ** **  ** * **    ***** **  *

A0A3Q1GZ93_BCL2L1-      gaaacgcctgtga
A0A3Q1JZ46_BCL2L1-      gaaacg---gtga
                        ******   ****

© 1998-2022Legal notice