Dataset for CDS BCL-2-like of organism Colobus angolensis palliatus

[Download (right click)] [Edit] [Sequences] [Repertoires]

10 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A2K5KAA3_BCL2A1-      atgacagact-----------------gtgaatttggatatatttac---
A0A2K5KAA3_BCL2A1-      atgacagact-----------------gtgaatttggatatatttac---
A0A2K5HK49_BCL2-01      atggcgcacgctgggagaacagggtacgataaccgggagatagtgatgaa
A0A2K5H963_BCL2L1-      --------------------------------------------------
A0A2K5H963_BCL2L1-      ------------------atgtctcagagcaaccgggagctagtggttga
A0A2K5HEJ9_BCL2L2-      atggcgaccccag---cctcggccccagacacacgggctctggtggcaga
A0A2K5HEJ9_BCL2L2-      atggcgaccccag---cctcggccccagacacacgggctctggtggcaga
A0A2K5K3B0_BCL2L10      atggctgacc-----------------agttgcgggagcgcaccaacgtg
A0A2K5I9I0_MCL1-02      atgtttggcc------------------tcaaaagaaacgcggtaatcgg
A0A2K5I9I0_MCL1-03      atgtttggcc------------------tcaaaagaaacgcggtaatcgg
                                                                          

A0A2K5KAA3_BCL2A1-      --------------aggctagctcaggactatttgcag------------
A0A2K5KAA3_BCL2A1-      --------------aggctagctcaggactatttgcag------------
A0A2K5HK49_BCL2-01      gtacatccactat-aagctgtcgcagaggggctacgagtggga-------
A0A2K5H963_BCL2L1-      --------------------------------------------------
A0A2K5H963_BCL2L1-      ctttctctcctac-aagctttcccagaaaggatacagctggagtcagttt
A0A2K5HEJ9_BCL2L2-      ctttgtaggttat-aagctgaggcagaagggttatgtc------------
A0A2K5HEJ9_BCL2L2-      ctttgtaggttat-aagctgaggcagaagggttatgtc------------
A0A2K5K3B0_BCL2L10      gctgacccgttgc-gcgagcgcaccgagcggctgctgg------------
A0A2K5I9I0_MCL1-02      actcaacctctactgtgggggggccg---gcttggggg------------
A0A2K5I9I0_MCL1-03      actcaacctctactgtgggggggccg---gcttggggg------------
                                                                          

A0A2K5KAA3_BCL2A1-      -----tacgtc--ctgcagataccacaa--cctgga--------------
A0A2K5KAA3_BCL2A1-      -----tacgtc--ctgcagataccacaa--cctgga--------------
A0A2K5HK49_BCL2-01      -----tgcgggggatgtgggagccgcgacccctggggccgcccccgcacc
A0A2K5H963_BCL2L1-      ----atgtggaagagaacaggactgaggccccagaa--------------
A0A2K5H963_BCL2L1-      agtgatgtggaagagaacaggactgaggccccagaa--------------
A0A2K5HEJ9_BCL2L2-      -----tgtgga----------gct--ggccccgggg--------------
A0A2K5HEJ9_BCL2L2-      -----tgtgga----------gct--ggccccgggg--------------
A0A2K5K3B0_BCL2L10      ------ccgactatctggggtgctgcgc--ccggga--------------
A0A2K5I9I0_MCL1-02      ------ccggc-agcggcggcgccacccctccggga--------------
A0A2K5I9I0_MCL1-03      ------ccggc-agcggcggcgccacccctccggga--------------
                                *             *       ** *                

A0A2K5KAA3_BCL2A1-      ------------------------------------------------tc
A0A2K5KAA3_BCL2A1-      ------------------------------------------------tc
A0A2K5HK49_BCL2-01      gggcatcttctcctcccagcccgggcacacgccccatcccgccgcgtccc
A0A2K5H963_BCL2L1-      --------------------------------------------------
A0A2K5H963_BCL2L1-      --------------------------------------------------
A0A2K5HEJ9_BCL2L2-      --------------------------------------------------
A0A2K5HEJ9_BCL2L2-      --------------------------------------------------
A0A2K5K3B0_BCL2L10      -------------acccggc-------------------acccccgagcc
A0A2K5I9I0_MCL1-02      -------------gggcggcttttggctacggagaaggaggcctcggccc
A0A2K5I9I0_MCL1-03      -------------gggcggcttttggccactg-------------gcgcc
                                                                          

A0A2K5KAA3_BCL2A1-      gggtccaag-------------------------------caaaacgtcc
A0A2K5KAA3_BCL2A1-      gggtccaag-------------------------------caaaacgtcc
A0A2K5HK49_BCL2-01      gggacccg---gtcgc------------------------caggacctcg
A0A2K5H963_BCL2L1-      gggactgaatcggaga------------------------tggagacccc
A0A2K5H963_BCL2L1-      gggactgaatcggaga------------------------tggagacccc
A0A2K5HEJ9_BCL2L2-      agggccca---gcagc------------------------t---gacccg
A0A2K5HEJ9_BCL2L2-      agggccca---gcagc------------------------t---gacccg
A0A2K5K3B0_BCL2L10      gaggcc-----------gtccacgcc--------------cgaggccgcc
A0A2K5I9I0_MCL1-02      ggcgagagatagggggaggggaggccggcacggtgattggcggaagcgcc
A0A2K5I9I0_MCL1-03      aaggacacacagccaatgggcaggtc--------------tggggccacc
                                                                        * 

A0A2K5KAA3_BCL2A1-      agagtgctacaaaaggttgcattctcagtccaggaaga------------
A0A2K5KAA3_BCL2A1-      agagtgctacaaaaggttgcattctcagtccaggaaga------------
A0A2K5HK49_BCL2-01      ccgctgccgaccccggctgcccccgccgccgccgcggggcctgcgcttag
A0A2K5H963_BCL2L1-      cagt-gccatcaatggcaacccatcct-----------------------
A0A2K5H963_BCL2L1-      cagt-gccatcaatggcaacccatcctggcacctggtggacagccccgcg
A0A2K5HEJ9_BCL2L2-      ctgc-ac---------caagccatgcgggca-------------------
A0A2K5HEJ9_BCL2L2-      ctgc-ac---------caagccatgcgggca-------------------
A0A2K5K3B0_BCL2L10      gtgctgcgctccgcggcggccc----------------------------
A0A2K5I9I0_MCL1-02      ggcgcaagccccccggccgccctcacgccagacgcccg------------
A0A2K5I9I0_MCL1-03      agcaggaaggctctgg-agaccttac----gacgggtg------------
                                                                          

A0A2K5KAA3_BCL2A1-      --------------------------------------------------
A0A2K5KAA3_BCL2A1-      --------------------------------------------------
A0A2K5HK49_BCL2-01      cccagtgccacctgtggtc-------------------------------
A0A2K5H963_BCL2L1-      --------------------------------------------------
A0A2K5H963_BCL2L1-      gtgaatggagccactggccacagcagcagtttggatgcccgggaggtgat
A0A2K5HEJ9_BCL2L2-      --------------------------------------------------
A0A2K5HEJ9_BCL2L2-      --------------------------------------------------
A0A2K5K3B0_BCL2L10      --------------------------------------------------
A0A2K5I9I0_MCL1-02      --------------------------------------------------
A0A2K5I9I0_MCL1-03      --------------------------------------------------
                                                                          

A0A2K5KAA3_BCL2A1-      ----------------------------------agtggaaaagaatctg
A0A2K5KAA3_BCL2A1-      ----------------------------------agtggaaaagaatctg
A0A2K5HK49_BCL2-01      ----------------caccttaccctccgccaggccggtgacgacttct
A0A2K5H963_BCL2L1-      --------------------------------------------------
A0A2K5H963_BCL2L1-      ccccatggcagcagtaaagcaagcgctgagggaggcaggcgacgagtttg
A0A2K5HEJ9_BCL2L2-      ----------------------------------gctggagatgagttcg
A0A2K5HEJ9_BCL2L2-      ----------------------------------gctggagatgagttcg
A0A2K5K3B0_BCL2L10      -------------------------------------gattacg------
A0A2K5I9I0_MCL1-02      ----------------------------------gagggtcgcgcggccg
A0A2K5I9I0_MCL1-03      ----------------------------------ggggatggcgtg----
                                                                          

A0A2K5KAA3_BCL2A1-      aagccg-----------------------tgcttggacaatgttaatgtt
A0A2K5KAA3_BCL2A1-      aagccg-----------------------tgcttggacaatgttaatgtt
A0A2K5HK49_BCL2-01      cccgccgctac------------------cgccgcgacttcgccgagatg
A0A2K5H963_BCL2L1-      --------------------------------------------------
A0A2K5H963_BCL2L1-      aactgcggtac------------------cggcgggcgttcagtgacctg
A0A2K5HEJ9_BCL2L2-      agacccgcttc------------------cggcgcaccttctctgatctg
A0A2K5HEJ9_BCL2L2-      agacccgcttc------------------cggcgcaccttctctgatctg
A0A2K5K3B0_BCL2L10      ---------------------------------gcagctccatcggtcct
A0A2K5I9I0_MCL1-02      ccgcccattggcgccgaggtccccgacgtcaccgcgacccccgcgaggct
A0A2K5I9I0_MCL1-03      -----------------------------cagcgcaa---ccacgagacg
                                                                          

A0A2K5KAA3_BCL2A1-      gc---------------atccatagacactgccagaacaatattc-----
A0A2K5KAA3_BCL2A1-      gc---------------atccatagacactgccagaacaatattc-----
A0A2K5HK49_BCL2-01      tccagccagctgcacctgacgcccttcaccgcgcggggacgcttt-----
A0A2K5H963_BCL2L1-      ------------------------gggacagcatatcagagcttt-----
A0A2K5H963_BCL2L1-      acatcccagctccacatcaccccagggacagcatatcagagcttt-----
A0A2K5HEJ9_BCL2L2-      gcggctcagctgcatgtgaccccaggctcagcgcagcaacgcttc-----
A0A2K5HEJ9_BCL2L2-      gcggctcagctgcatgtgaccccaggctcagcgcagcaacgcttc-----
A0A2K5K3B0_BCL2L10      tcttctccgc-------ctacctcggctaccccgggaaccgcgtc--gag
A0A2K5I9I0_MCL1-02      gcttttcttt-------gcgcccacccgccgcgcggcgccgcttgaggag
A0A2K5I9I0_MCL1-03      gccttccaag-------gca-------------------tgcttcggaaa
                                                                   *      

A0A2K5KAA3_BCL2A1-      ------aatcaagtgatggaaaa---------------------------
A0A2K5KAA3_BCL2A1-      ------aatcaagtgatggaaaa---------------------------
A0A2K5HK49_BCL2-01      ------gccacggtggtggagga---------------------------
A0A2K5H963_BCL2L1-      ------gaacaggtagtgaatga---------------------------
A0A2K5H963_BCL2L1-      ------gaacaggtagtgaatga---------------------------
A0A2K5HEJ9_BCL2L2-      ------acccaggtctctgatga---------------------------
A0A2K5HEJ9_BCL2L2-      ------acccaggtctctgatga---------------------------
A0A2K5K3B0_BCL2L10      ctggtggcgctgatggcggaggccgt------------------------
A0A2K5I9I0_MCL1-02      atggaagccccggccgccgacgccatcatgtcgcccgaagaggagctgga
A0A2K5I9I0_MCL1-03      ctggacatcaaaaacgaagacgatgtca----------------------
                                           *                              

A0A2K5KAA3_BCL2A1-      ----------------ggagtttgaagat------------ggcatcatt
A0A2K5KAA3_BCL2A1-      ----------------ggagtttgaagat------------ggcatcatt
A0A2K5HK49_BCL2-01      ----------------gctcttcagggac------------ggggtg---
A0A2K5H963_BCL2L1-      ----------------actcttccgggat------------ggggta---
A0A2K5H963_BCL2L1-      ----------------actcttccgggat------------ggggta---
A0A2K5HEJ9_BCL2L2-      ----------------acttttccaaggg------------ggcccc---
A0A2K5HEJ9_BCL2L2-      ----------------acttttccaaggg------------ggcccc---
A0A2K5K3B0_BCL2L10      ----------------gctctccgacagc---------cccggcccc---
A0A2K5I9I0_MCL1-02      cgggtacgagccggagcctctcgggaagcggccggctgtcctgcccc---
A0A2K5I9I0_MCL1-03      --------------------------------------------------
                                                                          

A0A2K5KAA3_BCL2A1-      aactggggaagaattgtaaccatatttgcatttgaaggtattctc---at
A0A2K5KAA3_BCL2A1-      aactggggaagaattgtaaccatatttgcatttgaaggtattctc---at
A0A2K5HK49_BCL2-01      aactgggggaggattgtggccttctttgagttcggtggggtcatgtg-tg
A0A2K5H963_BCL2L1-      aactggggtcgcattgtggcctttttctccttcggcggggcactgtg-cg
A0A2K5H963_BCL2L1-      aactggggtcgcattgtggcctttttctccttcggcggggcactgtg-cg
A0A2K5HEJ9_BCL2L2-      aactggggccgccttgtagccttctttgtctttggggctgcactgtg-tg
A0A2K5HEJ9_BCL2L2-      aactggggccgccttgtagccttctttgtctttggggctgcactgtg-tg
A0A2K5K3B0_BCL2L10      acctggggcagggtggtgtcgctggtgaccttcgcggggacg--ctgctg
A0A2K5I9I0_MCL1-02      tgctggagttggtcggggaatctaatagctccagtacggatgggtcacta
A0A2K5I9I0_MCL1-03      ------------------aatct-ttatctcgagt---gatgatcca-tg
                                              *  *       *                

A0A2K5KAA3_BCL2A1-      caagaaacttctacgacagcgaattgccccggatgtggatacttataagg
A0A2K5KAA3_BCL2A1-      caagaaacttctacgacagcgaattgccccggatgtggatacttataagg
A0A2K5HK49_BCL2-01      tggagagcgtcaaccgggagatgtcgcccctggtg-------------ga
A0A2K5H963_BCL2L1-      tggaaagcgtagacaaggagatgcaggtattggtg-------------ag
A0A2K5H963_BCL2L1-      tggaaagcgtagacaaggagatgcaggtattggtg-------------ag
A0A2K5HEJ9_BCL2L2-      ctgagagtgtcaacaaggagatggaaccactggtg-------------gg
A0A2K5HEJ9_BCL2L2-      ctgagagtgtcaacaaggagatggaaccactggtg-------------gg
A0A2K5K3B0_BCL2L10      gagagagagccgctggtgacag------cctggtg-------------ga
A0A2K5I9I0_MCL1-02      ccctcgacgccgccgccagcag------a--ggag-------------ga
A0A2K5I9I0_MCL1-03      ttttcagcgacggcg-taacaa------actgggg-------------ca
                                                       *  *               

A0A2K5KAA3_BCL2A1-      agatttcgtattttg--------------------ttgctgagttcataa
A0A2K5KAA3_BCL2A1-      agatttcgtattttg--------------------ttgctgagttcataa
A0A2K5HK49_BCL2-01      caacatcgccctgtg------------------gatgactgagtacctga
A0A2K5H963_BCL2L1-      tcggatcgcaacttg------------------gatggccacttatctga
A0A2K5H963_BCL2L1-      tcggatcgcaacttg------------------gatggccacttatctga
A0A2K5HEJ9_BCL2L2-      acaagtgcaggagtg------------------gatggtggcctacctgg
A0A2K5HEJ9_BCL2L2-      acaagtgcaggagtg------------------gatggtggcctacctgg
A0A2K5K3B0_BCL2L10      agaagcggag-----------------------cttccagccgcggctga
A0A2K5I9I0_MCL1-02      ggaggacgagttgtaccggcagtcgctggaaattatctctcggtaccttc
A0A2K5I9I0_MCL1-03      ggattgtgactctca------------------tttcttttggtgccttt
                                                           *           *  

A0A2K5KAA3_BCL2A1-      tgaataacacaggagaatggataaggcaaaacg-----------------
A0A2K5KAA3_BCL2A1-      tgaataacacaggagaatggataaggcaaaacg-----------------
A0A2K5HK49_BCL2-01      accggcacctgcacacctggatccaggataacg-----------------
A0A2K5H963_BCL2L1-      atgaccacctagagccttggatccaggagaacg-----------------
A0A2K5H963_BCL2L1-      atgaccacctagagccttggatccaggagaacg-----------------
A0A2K5HEJ9_BCL2L2-      agacgcggctggctgactggatccacagcagtg-----------------
A0A2K5HEJ9_BCL2L2-      agacgcggctggctgactggatccacagcagtg-----------------
A0A2K5K3B0_BCL2L10      aggagca----gg-----------agggcgacg------------tcgcc
A0A2K5I9I0_MCL1-02      gggagca----ggccactggcgccaaggacacacagccaatgggcaggtc
A0A2K5I9I0_MCL1-03      gtggcta----aacacttg-----aagaccata-aaccaagaaagttgca
                                                                          

A0A2K5KAA3_BCL2A1-      -gaggctggggg--aaatggc-------acaatcacatgccta-------
A0A2K5KAA3_BCL2A1-      -gaggct-ggga--aaatggctttgtaaagaagtttgaaccta-------
A0A2K5HK49_BCL2-01      -gaggctgggat------gcctttgtggaactgtacggcccca-------
A0A2K5H963_BCL2L1-      -gcggctgggac------acttttgtggaactctatgggaacaatgc---
A0A2K5H963_BCL2L1-      -gcggctgggac------acttttgtggaactctatgggaacaatgc---
A0A2K5HEJ9_BCL2L2-      -ggggctgggcg------gagttcacagctctatacggggacggggccct
A0A2K5HEJ9_BCL2L2-      -ggggctgggagctggaagctatcaaagctcgagtcagggagatgga---
A0A2K5K3B0_BCL2L10      cgggactgccagcg-------cctggtggccttgctgagctcgcggctcg
A0A2K5I9I0_MCL1-02      tggggccaccagcaggaaggctctggagacctt-----------------
A0A2K5I9I0_MCL1-03      tcgaaccattagcagaaagtatc-acagacgtt-------------ctcg
                             *                                            

A0A2K5KAA3_BCL2A1-      -------------tg-ctagtagagtcagtggcccacaagaagaaga---
A0A2K5KAA3_BCL2A1-      -------------aatctggctggatgacttttctagaagttacagg---
A0A2K5HK49_BCL2-01      ------------------------------------------gcatg---
A0A2K5H963_BCL2L1-      ---agcagctgagagccgaaagggcc--------------aggagcg---
A0A2K5H963_BCL2L1-      ---agcagctgagagccgaaagggcc--------------aggagcg---
A0A2K5HEJ9_BCL2L2-      ggaggaggcgcggcgtctgcgggag---------------gggaact---
A0A2K5HEJ9_BCL2L2-      ggaagaagctgagaagctaaaggagctacagaacgaggtagagaagc---
A0A2K5K3B0_BCL2L10      cggggcagcaccgcgcct----ggcttcaggct---cagggcggttg---
A0A2K5I9I0_MCL1-02      --acgacgggtgggggat----ggcgtgcagcgcaaccacgagacggcct
A0A2K5I9I0_MCL1-03      taaggacaaaacgggact----ggc---tagttaaacaaagaggctg---
                                                                          

A0A2K5KAA3_BCL2A1-      -----aaatggctttgtaa-------------------------------
A0A2K5KAA3_BCL2A1-      -----aaagatctgtgaaatgctatct-----------------------
A0A2K5HK49_BCL2-01      -----tggcctctgtttg-atttctcc--------tggctgtctc-----
A0A2K5H963_BCL2L1-      -----cttcaaccgctgg-----ttcc--------tgacgggcatgac--
A0A2K5H963_BCL2L1-      -----cttcaaccgctgg-----ttcc--------tgacgggcatgac--
A0A2K5HEJ9_BCL2L2-      -----gggcatcagtgag------------------gacagtgctgac--
A0A2K5HEJ9_BCL2L2-      -----agatgaatatgagtccacctcc--------aggcaatgctggccc
A0A2K5K3B0_BCL2L10      -----ggatggcttctgtcacttcttc-------aggaccccctttccgc
A0A2K5I9I0_MCL1-02      tccaaggatgggtttgtggagttcttccatgtagagga---cctagaagg
A0A2K5I9I0_MCL1-03      -----ggatgggtttgtggagttcttccatgtagagga---cctagaagg
                                                                          

A0A2K5KAA3_BCL2A1-      --------------------------------------------------
A0A2K5KAA3_BCL2A1-      ------------------------------------------------ct
A0A2K5HK49_BCL2-01      ---------------------------tgaagactctgctcagtt-----
A0A2K5H963_BCL2L1-      ---------------------------tgtggccggcg------------
A0A2K5H963_BCL2L1-      ---------------------------tgtggccggcg------------
A0A2K5HEJ9_BCL2L2-      ---------------------------gggggccg---------------
A0A2K5HEJ9_BCL2L2-      agtgatcatgtccattgaggagaagatggaggctgatgcccgttccatct
A0A2K5K3B0_BCL2L10      tggcttttt------------------ggagaaaactgctgatccaggct
A0A2K5I9I0_MCL1-02      tggcatc----------------------agaaatgtgctg--ctggctt
A0A2K5I9I0_MCL1-03      tggcatc----------------------agaaatgtgctg--ctggctt
                                                                          

A0A2K5KAA3_BCL2A1-      --------------------------------------------------
A0A2K5KAA3_BCL2A1-      cctgaagcaatactgt----------------------------------
A0A2K5HK49_BCL2-01      ----tggccctggtgggagcttgca-------------------------
A0A2K5H963_BCL2L1-      ----tggttctgctgg--gctcact-------------------------
A0A2K5H963_BCL2L1-      ----tggttctgctgg--gctcact-------------------------
A0A2K5HEJ9_BCL2L2-      ----tggcactggggg--ccctggt-------------------------
A0A2K5HEJ9_BCL2L2-      atgttggcaatgtgga--ctatggtgcaacagcagaagagctggaagctc
A0A2K5K3B0_BCL2L10      ttcctggcatgcttg-----------------------------------
A0A2K5I9I0_MCL1-02      ttgcaggtgttgctgg----------------------------------
A0A2K5I9I0_MCL1-03      ttgcaggtgttgctgg----------------------------------
                                                                          

A0A2K5KAA3_BCL2A1-      --------------------------------------------------
A0A2K5KAA3_BCL2A1-      --------------------------------------------------
A0A2K5HK49_BCL2-01      ----------------------------------------------tcac
A0A2K5H963_BCL2L1-      --------------------------------------------------
A0A2K5H963_BCL2L1-      --------------------------------------------------
A0A2K5HEJ9_BCL2L2-      -----------------------------------------------aac
A0A2K5HEJ9_BCL2L2-      actttcatggctgtggatcagtcaaccgtgttaccatactctgtgacaaa
A0A2K5K3B0_BCL2L10      ------------------------------------------ttaacaac
A0A2K5I9I0_MCL1-02      -----------------------------------------agtaggagc
A0A2K5I9I0_MCL1-03      -----------------------------------------agtaggagc
                                                                          

A0A2K5KAA3_BCL2A1-      --------------------------------------------------
A0A2K5KAA3_BCL2A1-      --------------------------------------------------
A0A2K5HK49_BCL2-01      cctgggtgccta--------------------------------------
A0A2K5H963_BCL2L1-      --------------------------------------------------
A0A2K5H963_BCL2L1-      --------------------------------------------------
A0A2K5HEJ9_BCL2L2-      tgtaggggcctt--------------------------------------
A0A2K5HEJ9_BCL2L2-      tttagtggccatcccaaagggtttgcgtatatagagttctcagacaaaga
A0A2K5K3B0_BCL2L10      agccttcggtta--------------------------------------
A0A2K5I9I0_MCL1-02      tggtttggcata--------------------------------------
A0A2K5I9I0_MCL1-03      tggtttggcata--------------------------------------
                                                                          

A0A2K5KAA3_BCL2A1-      --------------------------------------------------
A0A2K5KAA3_BCL2A1-      --------------------------------------------------
A0A2K5HK49_BCL2-01      --------------------------------------------------
A0A2K5H963_BCL2L1-      --------------------------------------------------
A0A2K5H963_BCL2L1-      --------------------------------------------------
A0A2K5HEJ9_BCL2L2-      --------------------------------------------------
A0A2K5HEJ9_BCL2L2-      gtcagtgaggacgtccttggccttagatgagtccctatttagaggaaggc
A0A2K5K3B0_BCL2L10      --------------------------------------------------
A0A2K5I9I0_MCL1-02      --------------------------------------------------
A0A2K5I9I0_MCL1-03      --------------------------------------------------
                                                                          

A0A2K5KAA3_BCL2A1-      --------------------------------------------------
A0A2K5KAA3_BCL2A1-      --------------------------------------------------
A0A2K5HK49_BCL2-01      --------------------------------------------------
A0A2K5H963_BCL2L1-      --------------------------------------------------
A0A2K5H963_BCL2L1-      --------------------------------------------------
A0A2K5HEJ9_BCL2L2-      --------------------------------------------------
A0A2K5HEJ9_BCL2L2-      aaatcaaggtgatcccaaaacgaaccaacagaccaggcatcagcacaaca
A0A2K5K3B0_BCL2L10      --------------------------------------------------
A0A2K5I9I0_MCL1-02      --------------------------------------------------
A0A2K5I9I0_MCL1-03      --------------------------------------------------
                                                                          

A0A2K5KAA3_BCL2A1-      --------------------------------------------------
A0A2K5KAA3_BCL2A1-      --------------------------------------------------
A0A2K5HK49_BCL2-01      --------------------------------------------------
A0A2K5H963_BCL2L1-      --------------------------------------------------
A0A2K5H963_BCL2L1-      --------------------------------------------------
A0A2K5HEJ9_BCL2L2-      --------------------------------------------------
A0A2K5HEJ9_BCL2L2-      gaccggggttttccacgagcccgctaccgcgcccggaccaccaactacaa
A0A2K5K3B0_BCL2L10      --------------------------------------------------
A0A2K5I9I0_MCL1-02      --------------------------------------------------
A0A2K5I9I0_MCL1-03      --------------------------------------------------
                                                                          

A0A2K5KAA3_BCL2A1-      --------------------------------------------------
A0A2K5KAA3_BCL2A1-      --------------------------------------------------
A0A2K5HK49_BCL2-01      ---------------------------tctgggccacaag----------
A0A2K5H963_BCL2L1-      ---------------------------cttcagtcggaaa----------
A0A2K5H963_BCL2L1-      ---------------------------cttcagtcggaaa----------
A0A2K5HEJ9_BCL2L2-      ---------------------------ttttgctagcaag----------
A0A2K5HEJ9_BCL2L2-      cagttcccgctctcgattctacagtggttttaacagcaggccccggggtc
A0A2K5K3B0_BCL2L10      ---------------------------tct--ctggacacgattatta--
A0A2K5I9I0_MCL1-02      ---------------------------tctaatcagatagccttactg--
A0A2K5I9I0_MCL1-03      ---------------------------tctaatcagatag----------
                                                                          

A0A2K5KAA3_BCL2A1-      --------------------------------------------------
A0A2K5KAA3_BCL2A1-      -----------------------------------------------tga
A0A2K5HK49_BCL2-01      -----------------------------------------------tga
A0A2K5H963_BCL2L1-      -----------------------------------------------tga
A0A2K5H963_BCL2L1-      -----------------------------------------------tga
A0A2K5HEJ9_BCL2L2-      -----------------------------------------------tga
A0A2K5HEJ9_BCL2L2-      gcgtctacaggggccgggctagagcgacatcatggtattccccttactaa
A0A2K5K3B0_BCL2L10      -----------------------------------------------tga
A0A2K5I9I0_MCL1-02      -----------------------------------------------taa
A0A2K5I9I0_MCL1-03      --------------------------------------------------
                                                                          

© 1998-2020Legal notice