Dataset for CDS BCL-2-like of organism Colobus angolensis palliatus

[Download (right click)] [Edit] [Sequences] [Repertoires]

12 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A2K5KAA3_BCL2A1-      atgacagac-----------------tgtgaatttggatatatttacag-
A0A2K5KAA3_BCL2A1-      atgacagac-----------------tgtgaatttggatatatttacag-
A0A2K5H963_BCL2L1-      ------------------atgtctcagagcaaccgggagctagtggttga
A0A2K5H963_BCL2L1-      --------------------------------------------------
A0A2K5HEJ9_BCL2L2-      atggcgacc---ccagcctcggccccagacacacgggctctggtggcaga
A0A2K5HEJ9_BCL2L2-      --------------------------------------------------
A0A2K5HEJ9_BCL2L2-      atggcgacc---ccagcctcggccccagacacacgggctctggtggcaga
A0A2K5HK49_BCL2-01      atggcgcacgctgggagaacagggtacgataaccgggagatagtgatgaa
A0A2K5K3B0_BCL2L10      atggctgac-----------------cagttgcgggagcgcaccaacgtg
A0A2K5I9I0_MCL1-02      atgtttggc-----------------c-tcaaaagaaacgcggtaatcgg
A0A2K5I9I0_MCL1-01      atgtttggc-----------------c-tcaaaagaaacgcggtaatcgg
A0A2K5I9I0_MCL1-03      atgtttggc-----------------c-tcaaaagaaacgcggtaatcgg

A0A2K5KAA3_BCL2A1-      ---------------gctagctcaggactattt-----------------
A0A2K5KAA3_BCL2A1-      ---------------gctagctcaggactattt-----------------
A0A2K5H963_BCL2L1-      ctttctctcctacaagctttcccagaaaggata--cagctggagtcagtt
A0A2K5H963_BCL2L1-      --------------------------------------------------
A0A2K5HEJ9_BCL2L2-      ctttgtaggttataagctgaggcagaagggtta--tgtctgt--------
A0A2K5HEJ9_BCL2L2-      --------------------------------------------------
A0A2K5HEJ9_BCL2L2-      ctttgtaggttataagctgaggcagaagggtta--tgtctgt--------
A0A2K5HK49_BCL2-01      gtacatccactataagctgtcgcagaggggcta--cgagtgg--------
A0A2K5K3B0_BCL2L10      gctgaccc-------gttgc-gcgagcgcaccgagcggctgc--------
A0A2K5I9I0_MCL1-02      actcaacc-------tctactgtgggggggccg---gcttgg--------
A0A2K5I9I0_MCL1-01      actcaacc-------tctactgtgggggggccg---gcttgg--------
A0A2K5I9I0_MCL1-03      actcaacc-------tctactgtgggggggccg---gcttgg--------

A0A2K5KAA3_BCL2A1-      --------------------gcagtacgtcctgcagatac----------
A0A2K5KAA3_BCL2A1-      --------------------gcagtacgtcctgcagatac----------
A0A2K5H963_BCL2L1-      tagtgatgtggaagagaacaggactgaggccccagaaggg----------
A0A2K5H963_BCL2L1-      -----atgtggaagagaacaggactgaggccccagaaggg----------
A0A2K5HEJ9_BCL2L2-      --------------------ggagctggccccggggaggg----------
A0A2K5HEJ9_BCL2L2-      --------------------------------------------------
A0A2K5HEJ9_BCL2L2-      --------------------ggagctggccccggggaggg----------
A0A2K5HK49_BCL2-01      ----gatgcgggggatgtgggagccgcgacccctggggcc----------
A0A2K5K3B0_BCL2L10      ----tggccgactatctggggtgctgcgc--ccgggaacccggc------
A0A2K5I9I0_MCL1-02      ----gggccggc-agcggcggcgccacccctccgggagggcggcttttgg
A0A2K5I9I0_MCL1-01      ----gggccggc-agcggcggcgccacccctccgggagggcggcttttgg
A0A2K5I9I0_MCL1-03      ----gggccggc-agcggcggcgccacccctccgggagggcggctttt--

A0A2K5KAA3_BCL2A1-      --------------------------------------------------
A0A2K5KAA3_BCL2A1-      --------------------------------------------------
A0A2K5H963_BCL2L1-      --------------------------------------------------
A0A2K5H963_BCL2L1-      --------------------------------------------------
A0A2K5HEJ9_BCL2L2-      --------------------------------------------------
A0A2K5HEJ9_BCL2L2-      --------------------------------------------------
A0A2K5HEJ9_BCL2L2-      --------------------------------------------------
A0A2K5HK49_BCL2-01      --------------------------------------------------
A0A2K5K3B0_BCL2L10      --------------------------------------------------
A0A2K5I9I0_MCL1-02      ctacggagaaggaggcctcggcccggcgagagatagggggaggggaggcc
A0A2K5I9I0_MCL1-01      ctacggagaaggaggcctcggcccggcgagagatagggggaggggaggcc
A0A2K5I9I0_MCL1-03      --------------------------------------------------

A0A2K5KAA3_BCL2A1-      --------------------------------------------------
A0A2K5KAA3_BCL2A1-      --------------------------------------------------
A0A2K5H963_BCL2L1-      ----------------------------------actgaat---------
A0A2K5H963_BCL2L1-      ----------------------------------actgaat---------
A0A2K5HEJ9_BCL2L2-      ----------------------------------ccc-------------
A0A2K5HEJ9_BCL2L2-      --------------------------------------------------
A0A2K5HEJ9_BCL2L2-      ----------------------------------ccc-------------
A0A2K5HK49_BCL2-01      -------------------------------gcccccgcac---------
A0A2K5K3B0_BCL2L10      -------------------------------acccccgagc---------
A0A2K5I9I0_MCL1-02      ggcacggtgattggcggaagcgccggcgcaagccccccggccgccctcac
A0A2K5I9I0_MCL1-01      ggcacggtgattggcggaagcgccggcgcaagccccccggccgccctcac
A0A2K5I9I0_MCL1-03      --------------------------------------------------

A0A2K5KAA3_BCL2A1-      ------------------------------cacaacctggatcgggtcca
A0A2K5KAA3_BCL2A1-      ------------------------------cacaacctggatcgggtcca
A0A2K5H963_BCL2L1-      --------------------cggagatggagacccccagtgcca------
A0A2K5H963_BCL2L1-      --------------------cggagatggagacccccagtgcca------
A0A2K5HEJ9_BCL2L2-      -----------------------agcagctgacccgctgcacca------
A0A2K5HEJ9_BCL2L2-      --------------------------------------------------
A0A2K5HEJ9_BCL2L2-      -----------------------agcagctgacccgctgcacca------
A0A2K5HK49_BCL2-01      --------------------cgggcatcttctcctcccagcccgggcaca
A0A2K5K3B0_BCL2L10      --------------------cgaggccgtccacgcccgaggccg---ccg
A0A2K5I9I0_MCL1-02      gccagacgcccggagggtcgcgcggccgccgcccattggcgccg---agg
A0A2K5I9I0_MCL1-01      gccagacgcccggagggtcgcgcggccgccgcccattggcgccg---agg
A0A2K5I9I0_MCL1-03      --------------------------------------------------

A0A2K5KAA3_BCL2A1-      ag--------caaaacgtccagagtgctacaaaa----------------
A0A2K5KAA3_BCL2A1-      ag--------caaaacgtccagagtgctacaaaa----------------
A0A2K5H963_BCL2L1-      ---tcaatggcaacccatcctggcacctggtggacagccccgcggtgaat
A0A2K5H963_BCL2L1-      ---tcaatggcaacccatcct-----------------------------
A0A2K5HEJ9_BCL2L2-      --------------------------------------------------
A0A2K5HEJ9_BCL2L2-      --------------------------------------------------
A0A2K5HEJ9_BCL2L2-      --------------------------------------------------
A0A2K5HK49_BCL2-01      cgccccatcccgccgcgtcccgggacccgg---------------tcgcc
A0A2K5K3B0_BCL2L10      tgctgcgctccgcggcggcccgattacggcagct-----------ccatc
A0A2K5I9I0_MCL1-02      tccccgacgtcaccgcgacccccgcgaggctgcttttctttgcgcccacc
A0A2K5I9I0_MCL1-01      tccccgacgtcaccgcgacccccgcgaggctgcttttctttgcgcccacc
A0A2K5I9I0_MCL1-03      --------------------------------------------------

A0A2K5KAA3_BCL2A1-      --------------------------------------------ggttgc
A0A2K5KAA3_BCL2A1-      --------------------------------------------ggttgc
A0A2K5H963_BCL2L1-      ggagccactggccacagcagcagtttggatgcccgggaggtgatccccat
A0A2K5H963_BCL2L1-      --------------------------------------------------
A0A2K5HEJ9_BCL2L2-      --------------------------------------------------
A0A2K5HEJ9_BCL2L2-      --------------------------------------------------
A0A2K5HEJ9_BCL2L2-      --------------------------------------------------
A0A2K5HK49_BCL2-01      aggacctcgccgctgccg------------accccggctgcccccgccgc
A0A2K5K3B0_BCL2L10      ggtccttcttctccgcct------------acctcggctaccccgggaac
A0A2K5I9I0_MCL1-02      cgccgcgcggcgccgcttgaggagatggaagccccggccgccgacgccat
A0A2K5I9I0_MCL1-01      cgccgcgcggcgccgcttgaggagatggaagccccggccgccgacgccat
A0A2K5I9I0_MCL1-03      --------------------------------------------------

A0A2K5KAA3_BCL2A1-      attctcagtccaggaagaagtgg---------------------------
A0A2K5KAA3_BCL2A1-      attctcagtccaggaagaagtgg---------------------------
A0A2K5H963_BCL2L1-      ggcagcagtaaagcaagcgctga-------------------gggaggca
A0A2K5H963_BCL2L1-      --------------------------------------------------
A0A2K5HEJ9_BCL2L2-      ---------------agccatgc-------------------gggcagct
A0A2K5HEJ9_BCL2L2-      --------------------------------------------------
A0A2K5HEJ9_BCL2L2-      ---------------agccatgc-------------------gggcagct
A0A2K5HK49_BCL2-01      cgccgc---------ggggcctg---------------------------
A0A2K5K3B0_BCL2L10      cgcgtc----------gagctgg---------------------------
A0A2K5I9I0_MCL1-02      catgtcgcccgaagaggagctggacgggtacgagccggagcctctcggga
A0A2K5I9I0_MCL1-01      catgtcgcccgaagaggagctggacgggtacgagccggagcctctcggga
A0A2K5I9I0_MCL1-03      --------------------------------------------------

A0A2K5KAA3_BCL2A1-      ---------------aaaagaatctgaagccgtgcttggacaatgttaat
A0A2K5KAA3_BCL2A1-      ---------------aaaagaatctgaagccgtgcttggacaatgttaat
A0A2K5H963_BCL2L1-      ggcgacgagtttgaactgcggtaccggcgggcgttcagtgacctgacatc
A0A2K5H963_BCL2L1-      --------------------------------------------------
A0A2K5HEJ9_BCL2L2-      ggagatgagttcgagacccgcttccggcgcaccttctctgatctggcggc
A0A2K5HEJ9_BCL2L2-      --------------------------------------------------
A0A2K5HEJ9_BCL2L2-      ggagatgagttcgagacccgcttccggcgcaccttctctgatctggcggc
A0A2K5HK49_BCL2-01      -----cgcttagcccagtgccacctgtggtccaccttaccctccgccagg
A0A2K5K3B0_BCL2L10      ---------------tggcgctgatggcggaggccgtgctctccgacagc
A0A2K5I9I0_MCL1-02      agcggccggctgtcctgcccctgctggagttggtcggggaatctaatagc
A0A2K5I9I0_MCL1-01      agcggccggctgtcctgcccctgctggagttggtcggggaatctaatagc
A0A2K5I9I0_MCL1-03      --------------------------------------------------

A0A2K5KAA3_BCL2A1-      gt------------------------------------------------
A0A2K5KAA3_BCL2A1-      gt------------------------------------------------
A0A2K5H963_BCL2L1-      ccagc---------------------------------------------
A0A2K5H963_BCL2L1-      --------------------------------------------------
A0A2K5HEJ9_BCL2L2-      tcagc---------------------------------------------
A0A2K5HEJ9_BCL2L2-      --------------------------------------------------
A0A2K5HEJ9_BCL2L2-      tcagc---------------------------------------------
A0A2K5HK49_BCL2-01      ccggt--------gacgacttctcccgccgctaccgccgc--------ga
A0A2K5K3B0_BCL2L10      cccgg-----------------------------ccccacctggggcagg
A0A2K5I9I0_MCL1-02      tccagtacggatgggtcactaccctcgacgccgccgccagcagaggagga
A0A2K5I9I0_MCL1-01      tccagtacggatgggtcactaccctcgacgccgccgccagcagaggagga
A0A2K5I9I0_MCL1-03      --------------------------------------------------

A0A2K5KAA3_BCL2A1-      ---------------------------------tgcatccatagacactg
A0A2K5KAA3_BCL2A1-      ---------------------------------tgcatccatagacactg
A0A2K5H963_BCL2L1-      ---------------------------------tccacatcaccccaggg
A0A2K5H963_BCL2L1-      -----------------------------------------------ggg
A0A2K5HEJ9_BCL2L2-      ---------------------------------tgcatgtgaccccaggc
A0A2K5HEJ9_BCL2L2-      --------------------------------------------------
A0A2K5HEJ9_BCL2L2-      ---------------------------------tgcatgtgaccccaggc
A0A2K5HK49_BCL2-01      cttcgccgagatgtccagccagc----------tgcacctgacgcccttc
A0A2K5K3B0_BCL2L10      gtgg-----------------------------tgtcgctggtgacctt-
A0A2K5I9I0_MCL1-02      ggaggacgagttgtaccggcagtcgctggaaattatctctcggtacctt-
A0A2K5I9I0_MCL1-01      ggaggacgagttgtaccggcagtcgctggaaattatctctcggtacctt-
A0A2K5I9I0_MCL1-03      --------------------------------------------------

A0A2K5KAA3_BCL2A1-      ccagaacaata----ttcaatcaagtgatggaaaaggagtttgaagatgg
A0A2K5KAA3_BCL2A1-      ccagaacaata----ttcaatcaagtgatggaaaaggagtttgaagatgg
A0A2K5H963_BCL2L1-      acagcatatcagagctttgaacaggtagtgaatgaactcttccgggatgg
A0A2K5H963_BCL2L1-      acagcatatcagagctttgaacaggtagtgaatgaactcttccgggatgg
A0A2K5HEJ9_BCL2L2-      tcagcgcagcaacgcttcacccaggtctctgatgaacttttccaaggggg
A0A2K5HEJ9_BCL2L2-      --------------------------------------------------
A0A2K5HEJ9_BCL2L2-      tcagcgcagcaacgcttcacccaggtctctgatgaacttttccaaggggg
A0A2K5HK49_BCL2-01      accgcgcggggacgctttgccacggtggtggaggagctcttcagggacgg
A0A2K5K3B0_BCL2L10      ----cgcggggacgctgc----tggagagagagccgctggtgacagcctg
A0A2K5I9I0_MCL1-02      ----cgggagcaggccac----tggcgccaaggacac-----acagccaa
A0A2K5I9I0_MCL1-01      ----cgggagcaggccac----tggcgccaaggacac-----acagccaa
A0A2K5I9I0_MCL1-03      ------------ggccac----tggcgccaaggacac-----acagccaa

A0A2K5KAA3_BCL2A1-      catcattaactggggaagaattgtaaccatatttgcatttgaaggtattc
A0A2K5KAA3_BCL2A1-      catcattaactggggaagaattgtaaccatatttgcatttgaaggtattc
A0A2K5H963_BCL2L1-      ggta---aactggggtcgcattgtggcctttttctccttcggcggggcac
A0A2K5H963_BCL2L1-      ggta---aactggggtcgcattgtggcctttttctccttcggcggggcac
A0A2K5HEJ9_BCL2L2-      cccc---aactggggccgccttgtagccttctttgtctttggggctgcac
A0A2K5HEJ9_BCL2L2-      --------------------------------------------------
A0A2K5HEJ9_BCL2L2-      cccc---aactggggccgccttgtagccttctttgtctttggggctgcac
A0A2K5HK49_BCL2-01      ggtg---aactgggggaggattgtggccttctttgagttcggtggggtca
A0A2K5K3B0_BCL2L10      -----------gtggaagaagcggagcttcc-----agccgcgg----c-
A0A2K5I9I0_MCL1-02      -----------tgggcaggtctggggccacc-----agcaggaaggctc-
A0A2K5I9I0_MCL1-01      -----------tgggcaggtctggggccacc-----agcaggaaggctc-
A0A2K5I9I0_MCL1-03      -----------tgggcaggtctggggccacc-----agcaggaaggctc-

A0A2K5KAA3_BCL2A1-      t---catcaagaaacttctacgacagcgaattgccccggatgtggatact
A0A2K5KAA3_BCL2A1-      t---catcaagaaacttctacgacagcgaattgccccggatgtggatact
A0A2K5H963_BCL2L1-      tgtgcgtggaaa----gcgtagacaaggagatgcaggtattggtga----
A0A2K5H963_BCL2L1-      tgtgcgtggaaa----gcgtagacaaggagatgcaggtattggtga----
A0A2K5HEJ9_BCL2L2-      tgtgtgctgaga----gtgtcaacaaggagatggaaccactggtgg----
A0A2K5HEJ9_BCL2L2-      --------------------------------------------------
A0A2K5HEJ9_BCL2L2-      tgtgtgctgaga----gtgtcaacaaggagatggaaccactggtgg----
A0A2K5HK49_BCL2-01      tgtgtgtggaga----gcgtcaaccgggagatgtcgcccctggtggacaa
A0A2K5K3B0_BCL2L10      ------tgaagg------agcaggagggcgacgtcgcccgggactgccag
A0A2K5I9I0_MCL1-02      ------tggagaccttacgacgggtgggggatggcgtgcag---cgcaac
A0A2K5I9I0_MCL1-01      ------tggagaccttacgacgggtgggggatggcgtgcag---cgcaac
A0A2K5I9I0_MCL1-03      ------tggagaccttacgacgggtgggggatggcgtgcag---cgcaac

A0A2K5KAA3_BCL2A1-      tataaggagatttcgtat--------------------------------
A0A2K5KAA3_BCL2A1-      tataaggagatttcgtat--------------------------------
A0A2K5H963_BCL2L1-      -gtcggatcgcaacttgg--------------------------------
A0A2K5H963_BCL2L1-      -gtcggatcgcaacttgg--------------------------------
A0A2K5HEJ9_BCL2L2-      -gacaagtgcaggagtgg--------------------------------
A0A2K5HEJ9_BCL2L2-      --------------------------------------------------
A0A2K5HEJ9_BCL2L2-      -gacaagtgcaggagtgg--------------------------------
A0A2K5HK49_BCL2-01      catc-----gccctgtgg--------------------------------
A0A2K5K3B0_BCL2L10      cgcctggtggccttgctgagctcgc-------------------------
A0A2K5I9I0_MCL1-02      cacgagacggccttccaa--------------------------------
A0A2K5I9I0_MCL1-01      cacgagacggccttccaaggcatgcttcggaaactggacatcaaaaacga
A0A2K5I9I0_MCL1-03      cacgagacggccttccaaggcatgcttcggaaactggacatcaaaaacga

A0A2K5KAA3_BCL2A1-      --------------------------------------------------
A0A2K5KAA3_BCL2A1-      --------------------------------------------------
A0A2K5H963_BCL2L1-      --------------------------------------------------
A0A2K5H963_BCL2L1-      --------------------------------------------------
A0A2K5HEJ9_BCL2L2-      --------------------------------------------------
A0A2K5HEJ9_BCL2L2-      --------------------------------------------------
A0A2K5HEJ9_BCL2L2-      --------------------------------------------------
A0A2K5HK49_BCL2-01      --------------------------------------------------
A0A2K5K3B0_BCL2L10      --------------------------------------------------
A0A2K5I9I0_MCL1-02      --------------------------------------------------
A0A2K5I9I0_MCL1-01      agacgatgtcaaatctttatctcgagtgatgatccatgttttcagcgacg
A0A2K5I9I0_MCL1-03      agacgatgtcaaatctttatctcgagtgatgatccatgttttcagcgacg

A0A2K5KAA3_BCL2A1-      --------------------------------------------------
A0A2K5KAA3_BCL2A1-      --------------------------------------------------
A0A2K5H963_BCL2L1-      --------------------------------------------------
A0A2K5H963_BCL2L1-      --------------------------------------------------
A0A2K5HEJ9_BCL2L2-      --------------------------------------------------
A0A2K5HEJ9_BCL2L2-      --------------------------------------------------
A0A2K5HEJ9_BCL2L2-      --------------------------------------------------
A0A2K5HK49_BCL2-01      --------------------------------------------------
A0A2K5K3B0_BCL2L10      --------------------------------------------------
A0A2K5I9I0_MCL1-02      --------------------------------------------------
A0A2K5I9I0_MCL1-01      gcgtaacaaactggggcaggattgtgactctcatttcttttggtgccttt
A0A2K5I9I0_MCL1-03      gcgtaacaaactggggcaggattgtgactctcatttcttttggtgccttt

A0A2K5KAA3_BCL2A1-      --------------------------------------------------
A0A2K5KAA3_BCL2A1-      --------------------------------------------------
A0A2K5H963_BCL2L1-      --------------------------------------------------
A0A2K5H963_BCL2L1-      --------------------------------------------------
A0A2K5HEJ9_BCL2L2-      --------------------------------------------------
A0A2K5HEJ9_BCL2L2-      --------------------------------------------------
A0A2K5HEJ9_BCL2L2-      --------------------------------------------------
A0A2K5HK49_BCL2-01      --------------------------------------------------
A0A2K5K3B0_BCL2L10      --------------------------------------------------
A0A2K5I9I0_MCL1-02      --------------------------------------------------
A0A2K5I9I0_MCL1-01      gtggctaaacacttgaagaccataaaccaagaaagttgcatcgaaccatt
A0A2K5I9I0_MCL1-03      gtggctaaacacttgaagaccataaaccaagaaagttgcatcgaaccatt

A0A2K5KAA3_BCL2A1-      -------tttgttgctgagttcataatgaataacacaggagaatggataa
A0A2K5KAA3_BCL2A1-      -------tttgttgctgagttcataatgaataacacaggagaatggataa
A0A2K5H963_BCL2L1-      ----------atggccacttatctgaatgaccacctagagccttggatcc
A0A2K5H963_BCL2L1-      ----------atggccacttatctgaatgaccacctagagccttggatcc
A0A2K5HEJ9_BCL2L2-      ----------atggtggcctacctggagacgcggctggctgactggatcc
A0A2K5HEJ9_BCL2L2-      --------------------------------------------------
A0A2K5HEJ9_BCL2L2-      ----------atggtggcctacctggagacgcggctggctgactggatcc
A0A2K5HK49_BCL2-01      ----------atgactgagtacctgaaccggcacctgcacacctggatcc
A0A2K5K3B0_BCL2L10      --------------------ggctcgcggggcagcaccgcgcctggcttc
A0A2K5I9I0_MCL1-02      --------------------------------------------------
A0A2K5I9I0_MCL1-01      agcagaaagtatcacagacgttctcgtaaggacaaaacgggactggctag
A0A2K5I9I0_MCL1-03      agcagaaagtatcacagacgttctcgtaaggacaaaacgggactggctag

A0A2K5KAA3_BCL2A1-      ggcaaaacggaggct-gggaaa----------------------------
A0A2K5KAA3_BCL2A1-      ggcaaaacggaggctgggggaa----------------------------
A0A2K5H963_BCL2L1-      aggagaacggcggctggg--------------------------------
A0A2K5H963_BCL2L1-      aggagaacggcggctggg--------------------------------
A0A2K5HEJ9_BCL2L2-      acagcagtgggggctgggcg------------------------------
A0A2K5HEJ9_BCL2L2-      --------------------------------------------------
A0A2K5HEJ9_BCL2L2-      acagcagtgggggctgggagctggaagctatcaaagctcgagtcagggag
A0A2K5HK49_BCL2-01      aggataacggaggctggg--------------------------------
A0A2K5K3B0_BCL2L10      aggctcagggcggttggg--------------------------------
A0A2K5I9I0_MCL1-02      ----------------gg--------------------------------
A0A2K5I9I0_MCL1-01      ttaaacaaagaggctggg--------------------------------
A0A2K5I9I0_MCL1-03      ttaaacaaagaggctggg--------------------------------

A0A2K5KAA3_BCL2A1-      --------------------------------------------------
A0A2K5KAA3_BCL2A1-      --------------------------------------------------
A0A2K5H963_BCL2L1-      --------------------------------------------------
A0A2K5H963_BCL2L1-      --------------------------------------------------
A0A2K5HEJ9_BCL2L2-      --------------------------------------------------
A0A2K5HEJ9_BCL2L2-      atggaggaagaagctgagaagctaaaggagctacagaacgaggtagagaa
A0A2K5HEJ9_BCL2L2-      atggaggaagaagctgagaagctaaaggagctacagaacgaggtagagaa
A0A2K5HK49_BCL2-01      --------------------------------------------------
A0A2K5K3B0_BCL2L10      --------------------------------------------------
A0A2K5I9I0_MCL1-02      --------------------------------------------------
A0A2K5I9I0_MCL1-01      --------------------------------------------------
A0A2K5I9I0_MCL1-03      --------------------------------------------------

A0A2K5KAA3_BCL2A1-      ------------------atggctttgtaaagaagtt-------------
A0A2K5KAA3_BCL2A1-      ------------------atggc-------acaatca-------------
A0A2K5H963_BCL2L1-      ------------------acacttttgtggaactcta-------------
A0A2K5H963_BCL2L1-      ------------------acacttttgtggaactcta-------------
A0A2K5HEJ9_BCL2L2-      ------------gagttcacagctctatacggggacgg------------
A0A2K5HEJ9_BCL2L2-      gcagatgaatatgagtccac--ctccaggcaatgctggcccagtgatcat
A0A2K5HEJ9_BCL2L2-      gcagatgaatatgagtccac--ctccaggcaatgctggcccagtgatcat
A0A2K5HK49_BCL2-01      ------------------atgcctttgtggaactgta-------------
A0A2K5K3B0_BCL2L10      ------------------atggcttctgtcacttctt-------------
A0A2K5I9I0_MCL1-02      ------------------atgggtttgtggagttctt-------------
A0A2K5I9I0_MCL1-01      ------------------atgggtttgtggagttctt-------------
A0A2K5I9I0_MCL1-03      ------------------atgggtttgtggagttctt-------------

A0A2K5KAA3_BCL2A1-      tgaacctaaatctggctggatgactt------------------------
A0A2K5KAA3_BCL2A1-      catgcctatg-ctagtagagtcagtg------------------------
A0A2K5H963_BCL2L1-      ------tgggaacaatgcagcagctg------------------------
A0A2K5H963_BCL2L1-      ------tgggaacaatgcagcagctg------------------------
A0A2K5HEJ9_BCL2L2-      ggccctggaggaggcg-cggcgtctg------------------------
A0A2K5HEJ9_BCL2L2-      gtccattgaggagaagatggaggctgatgcccgttccatctatgttggca
A0A2K5HEJ9_BCL2L2-      gtccattgaggagaagatggaggctgatgcccgttccatctatgttggca
A0A2K5HK49_BCL2-01      c--------ggc---cccagcatgtg------------------------
A0A2K5K3B0_BCL2L10      c-------aggaccccctttccgctg------------------------
A0A2K5I9I0_MCL1-02      ccatgtagagga---cctagaaggtg------------------------
A0A2K5I9I0_MCL1-01      ccatgtagagga---cctagaaggtg------------------------
A0A2K5I9I0_MCL1-03      ccatgtagagga---cctagaaggtg------------------------

A0A2K5KAA3_BCL2A1-      --------------------------------------------------
A0A2K5KAA3_BCL2A1-      --------------------------------------------------
A0A2K5H963_BCL2L1-      -------------------------agagccgaaag--------------
A0A2K5H963_BCL2L1-      -------------------------agagccgaaag--------------
A0A2K5HEJ9_BCL2L2-      ------------------cgggaggggaactgg-----------------
A0A2K5HEJ9_BCL2L2-      atgtggactatggtgcaacagcagaagagctggaagctcactttcatggc
A0A2K5HEJ9_BCL2L2-      atgtggactatggtgcaacagcagaagagctggaagctcactttcatggc
A0A2K5HK49_BCL2-01      --------------------------------------------------
A0A2K5K3B0_BCL2L10      --------------------------------------------------
A0A2K5I9I0_MCL1-02      --------------------------------------------------
A0A2K5I9I0_MCL1-01      --------------------------------------------------
A0A2K5I9I0_MCL1-03      --------------------------------------------------

A0A2K5KAA3_BCL2A1-      --------------------------------------------------
A0A2K5KAA3_BCL2A1-      --------------------------------------------------
A0A2K5H963_BCL2L1-      --------------------------------------------------
A0A2K5H963_BCL2L1-      --------------------------------------------------
A0A2K5HEJ9_BCL2L2-      --------------------------------------------------
A0A2K5HEJ9_BCL2L2-      tgtggatcagtcaaccgtgttaccatactctgtgacaaatttagtggcca
A0A2K5HEJ9_BCL2L2-      tgtggatcagtcaaccgtgttaccatactctgtgacaaatttagtggcca
A0A2K5HK49_BCL2-01      --------------------------------------------------
A0A2K5K3B0_BCL2L10      --------------------------------------------------
A0A2K5I9I0_MCL1-02      --------------------------------------------------
A0A2K5I9I0_MCL1-01      --------------------------------------------------
A0A2K5I9I0_MCL1-03      --------------------------------------------------

A0A2K5KAA3_BCL2A1-      ---------------------------------------ttctagaagtt
A0A2K5KAA3_BCL2A1-      ---------------------------------------gcccacaagaa
A0A2K5H963_BCL2L1-      ------------------------------------------ggccagga
A0A2K5H963_BCL2L1-      ------------------------------------------ggccagga
A0A2K5HEJ9_BCL2L2-      -------------------------------------gcatcagtgagga
A0A2K5HEJ9_BCL2L2-      tcccaaagggtttgcgtatatagagttctcagacaaagagtcagtgagga
A0A2K5HEJ9_BCL2L2-      tcccaaagggtttgcgtatatagagttctcagacaaagagtcagtgagga
A0A2K5HK49_BCL2-01      -------------------------------------gcctctgtttgat
A0A2K5K3B0_BCL2L10      -------------------------------------gctttttggagaa
A0A2K5I9I0_MCL1-02      -------------------------------------gcatc----agaa
A0A2K5I9I0_MCL1-01      -------------------------------------gcatc----agaa
A0A2K5I9I0_MCL1-03      -------------------------------------gcatc----agaa

A0A2K5KAA3_BCL2A1-      a-------------------------------------------------
A0A2K5KAA3_BCL2A1-      g-------------------------------------------------
A0A2K5H963_BCL2L1-      gcgcttcaacc-----------------------------------gctg
A0A2K5H963_BCL2L1-      gcgcttcaacc-----------------------------------gctg
A0A2K5HEJ9_BCL2L2-      c---------------------------------------------agtg
A0A2K5HEJ9_BCL2L2-      cgtccttggccttagatgagtccctatttagaggaaggcaaatcaaggtg
A0A2K5HEJ9_BCL2L2-      cgtccttggccttagatgagtccctatttagaggaaggcaaatcaaggtg
A0A2K5HK49_BCL2-01      t---------------------------------------------tctc
A0A2K5K3B0_BCL2L10      a---------------------------------------------actg
A0A2K5I9I0_MCL1-02      a---------------------------------------------tgtg
A0A2K5I9I0_MCL1-01      a---------------------------------------------tgtg
A0A2K5I9I0_MCL1-03      a---------------------------------------------tgtg

A0A2K5KAA3_BCL2A1-      --------------------------------------------------
A0A2K5KAA3_BCL2A1-      --------------------------------------------------
A0A2K5H963_BCL2L1-      gttc---------------------------------ctgacgggca---
A0A2K5H963_BCL2L1-      gttc---------------------------------ctgacgggca---
A0A2K5HEJ9_BCL2L2-      -------------------------------------ctgacggggg---
A0A2K5HEJ9_BCL2L2-      atcccaaaacgaaccaacagaccaggcatcagcacaacagaccggggttt
A0A2K5HEJ9_BCL2L2-      atcccaaaacgaaccaacagaccaggcatcagcacaacagaccggggttt
A0A2K5HK49_BCL2-01      -------------------------------------ctg--gctgtctc
A0A2K5K3B0_BCL2L10      -------------------------------------ctgatccaggctt
A0A2K5I9I0_MCL1-02      -------------------------------------ctg--ctggcttt
A0A2K5I9I0_MCL1-01      -------------------------------------ctg--ctggcttt
A0A2K5I9I0_MCL1-03      -------------------------------------ctg--ctggcttt

A0A2K5KAA3_BCL2A1-      --------------------------------------------------
A0A2K5KAA3_BCL2A1-      --------------------------------------------------
A0A2K5H963_BCL2L1-      --------------------------------------------------
A0A2K5H963_BCL2L1-      --------------------------------------------------
A0A2K5HEJ9_BCL2L2-      --------------------------------------------------
A0A2K5HEJ9_BCL2L2-      tccacgagcccgctaccgcgcccggaccaccaactacaacagttcccgct
A0A2K5HEJ9_BCL2L2-      tccacgagcccgctaccgcgcccggaccaccaactacaacagttcccgct
A0A2K5HK49_BCL2-01      tgaagactctgctcagtttggccctgg-----------------------
A0A2K5K3B0_BCL2L10      tcctg----------gcatgcttg--t-----------------------
A0A2K5I9I0_MCL1-02      tgcag----------gtgttgctggag-----------------------
A0A2K5I9I0_MCL1-01      tgcag----------gtgttgctggag-----------------------
A0A2K5I9I0_MCL1-03      tgcag----------gtgttgctggag-----------------------

A0A2K5KAA3_BCL2A1-      -------------------caggaaagatctgt-----gaaatgctatct
A0A2K5KAA3_BCL2A1-      -------------------aagaaaatggcttt-----gtaa--------
A0A2K5H963_BCL2L1-      -------------------tgactgtggccggc-----gtggt----tct
A0A2K5H963_BCL2L1-      -------------------tgactgtggccggc-----gtggt----tct
A0A2K5HEJ9_BCL2L2-      ----------ccgtggc----actgggggccct-----g-----gtaact
A0A2K5HEJ9_BCL2L2-      ctcgattctacagtggttttaacagcaggcccc-----ggggtcgcgtct
A0A2K5HEJ9_BCL2L2-      ctcgattctacagtggttttaacagcaggcccc-----ggggtcgcgtct
A0A2K5HK49_BCL2-01      -------------------tgggagcttgcatcaccctgg----gtgcct
A0A2K5K3B0_BCL2L10      -------------------taacaacagccttc-----gg----ttatct
A0A2K5I9I0_MCL1-02      -------------------taggagctggtttg-----gc----atatct
A0A2K5I9I0_MCL1-01      -------------------taggagctggtttg-----gc----atatct
A0A2K5I9I0_MCL1-03      -------------------taggagctggtttg-----gc----atatct

A0A2K5KAA3_BCL2A1-      ctcctgaag--------------------------caatactgttga
A0A2K5KAA3_BCL2A1-      -----------------------------------------------
A0A2K5H963_BCL2L1-      gctgggctc-------------------actcttcagtcggaaatga
A0A2K5H963_BCL2L1-      gctgggctc-------------------actcttcagtcggaaatga
A0A2K5HEJ9_BCL2L2-      gtaggggcc--------------------ttttttgctagcaagtga
A0A2K5HEJ9_BCL2L2-      acaggggccgggctagagcgacatcatggtattccccttac---taa
A0A2K5HEJ9_BCL2L2-      acaggggccgggctagagcgacatcatggtattccccttac---taa
A0A2K5HK49_BCL2-01      atctgggcc--------------------------aca----agtga
A0A2K5K3B0_BCL2L10      --ctggaca--------------------------cgattattatga
A0A2K5I9I0_MCL1-02      aatcagata--------------------------gccttactgtaa
A0A2K5I9I0_MCL1-01      aatcagata--------------------------g-----------
A0A2K5I9I0_MCL1-03      aatcagata--------------------------g-----------

© 1998-2022Legal notice