Dataset for CDS BCL2A1 of organism Sus scrofa

[Download (right click)] [Edit] [Sequences] [Repertoires]

6 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A4X1UP21_BCL2A1-      atggc-ggcggcg-------------------------------------
A0A4X1UP21_BCL2A1-      atggc-ggcggcg-------------------------------------
A0A4X1UP21_BCL2A1-      atgactgacgacgagtttggatatattcacatgctggcccaggactatct
A0A4X1UP21_BCL2A1-      atgactgacgacgagtttggatatattcacatgctggcccaggactatct
A0A4X1UP21_BCL2A1-      atgactgacgacgagtttggatatattcacatgctggcccaggactatct
C7F841_BCL2A1-01        atgactgacgacgagtttggatatattcacatgctggcccaggactatct
                        *** * * ** **                                     

A0A4X1UP21_BCL2A1-      ------------------------gccgtgagcggcgctaagcggagc--
A0A4X1UP21_BCL2A1-      ------------------------gccgtgagcggcgctaagcggagc--
A0A4X1UP21_BCL2A1-      gaagtatgtcctgcagataccacaacctggatctggtccaagcaaaacat
A0A4X1UP21_BCL2A1-      gaagtatgtcctgcagataccacaacctggatctggtccaagcaaaacat
A0A4X1UP21_BCL2A1-      gaagtatgtcctgcagataccacaacctggatctggtccaagcaaaacat
C7F841_BCL2A1-01        gaagtatgtcctgcagataccacaacctggatctggtccaagcaaaacat
                                                 **  ** * *  * ****  * *  

A0A4X1UP21_BCL2A1-      --------ctgcgggccg----------------------agctgaa---
A0A4X1UP21_BCL2A1-      --------ctgcgggccg----------------------agctgaa---
A0A4X1UP21_BCL2A1-      ctagagtgttacgagacgtggctttctccgtccaaaacgaagttgaaaag
A0A4X1UP21_BCL2A1-      ctagagtgttacgagacgtggctttctccgtccaaaacgaagttgaaaag
A0A4X1UP21_BCL2A1-      ctagagtgttacgagacgtggctttctccgtccaaaacgaagttgaaaag
C7F841_BCL2A1-01        ctagagtgttacgagacgtggctttctccgtccaaaacgaagttgaaaag
                                 * ** * **                      ** ****   

A0A4X1UP21_BCL2A1-      ------------------------------gcagcgtctgcgggcggtg-
A0A4X1UP21_BCL2A1-      ------------------------------gcagcgtctgcgggcggtg-
A0A4X1UP21_BCL2A1-      aatttgaaaccatgcttggacaattttgatgttgtgtccatagacactgc
A0A4X1UP21_BCL2A1-      aatttgaaaccatgcttggacaattttgatgttgtgtccatagacactgc
A0A4X1UP21_BCL2A1-      aatttgaaaccatgcttggacaattttgatgttgtgtccatagacactgc
C7F841_BCL2A1-01        aatttgaaaccatgcttggacaattttgatgttgtgtccatagacactgc
                                                      *  * ***    * *  ** 

A0A4X1UP21_BCL2A1-      ------------------agcg----------------------------
A0A4X1UP21_BCL2A1-      ------------------agcg----------------------------
A0A4X1UP21_BCL2A1-      cagaataatattcaatcaagtgatggaaaaggaatttgaagatggcatca
A0A4X1UP21_BCL2A1-      cagaataatattcaatcaagtgatggaaaaggaatttgaagatggcatca
A0A4X1UP21_BCL2A1-      cagaataatattcaatcaagtgatggaaaaggaatttgaagatggcatca
C7F841_BCL2A1-01        cagaataatattcaatcaagtgatggaaaaggaatttgaagatggcatca
                                          ** *                            

A0A4X1UP21_BCL2A1-      ----ccgaggagcggctgcg-ccagtcccgcctcttaa------------
A0A4X1UP21_BCL2A1-      ----ccgaggagcggctgcg-ccagtcccgcctcttaa------------
A0A4X1UP21_BCL2A1-      ttaactggggaaggattgtgaccatatttgcatttgaaggtattctcatg
A0A4X1UP21_BCL2A1-      ttaactggggaaggattgtgaccatatttgcatttgaaggtattctcatg
A0A4X1UP21_BCL2A1-      ttaactggggaaggattgtgaccatatttgcatttgaaggtattctcatg
C7F841_BCL2A1-01        ttaactggggaaggattgtgaccatatttgcatttgaaggtattctcatg
                            * * ***  *  ** * ***     ** * * **            

A0A4X1UP21_BCL2A1-      --------------------------cccag--------------aaggt
A0A4X1UP21_BCL2A1-      --------------------------cccag--------------aaggt
A0A4X1UP21_BCL2A1-      aagaaacttctgcgaaagcgaattgccccagatgtggacacgtacaagga
A0A4X1UP21_BCL2A1-      aagaaacttctgcgaaagcgaattgccccagatgtggacacgtacaagga
A0A4X1UP21_BCL2A1-      aagaaacttctgcgaaagcgaattgccccagatgtggacacgtacaagga
C7F841_BCL2A1-01        aagaaacttctgcgaaagcgaattgccccagatgtggacacgtacaagga
                                                  *****              **** 

A0A4X1UP21_BCL2A1-      gattgcccac----------------------------------------
A0A4X1UP21_BCL2A1-      gattgcccac----------------------------------------
A0A4X1UP21_BCL2A1-      gatttcttactttgtcgccgagttcatcaccaaaaacacaggacagtgga
A0A4X1UP21_BCL2A1-      gatttcttactttgtcgccgagttcatcaccaaaaacacaggacagtgga
A0A4X1UP21_BCL2A1-      gatttcttactttgtcgccgagttcatcaccaaaaacacaggacagtgga
C7F841_BCL2A1-01        gatttcttactttgtcgccgagttcatcaccaaaaacacaggacagtgga
                        **** *  **                                        

A0A4X1UP21_BCL2A1-      --------------------------------agtcagtatctaaagtcc
A0A4X1UP21_BCL2A1-      --------------------------------agtcagtatctaaagtcc
A0A4X1UP21_BCL2A1-      taaggcaaaacggaggctgggtgattgcccacagtcagtatctaaagtcc
A0A4X1UP21_BCL2A1-      taaggcaaaacggaggctgg------------------------------
A0A4X1UP21_BCL2A1-      taaggcaaaacggaggctgg------------------------------
C7F841_BCL2A1-01        taaggcaaaacggaggctgg------------------------------

A0A4X1UP21_BCL2A1-      aaaagaatttccatctttctgagcatgccagatgaaatcgagacggaaga
A0A4X1UP21_BCL2A1-      aaaagaatttccatctttctgagcatgccagatgaaatcgagacggaaga
A0A4X1UP21_BCL2A1-      aaaagaatttccatctttctgagcatgccagatgaaatcgagacggaaga
A0A4X1UP21_BCL2A1-      --------------------------------------------------
A0A4X1UP21_BCL2A1-      --------------------------------------------------
C7F841_BCL2A1-01        --------------------------------------------------

A0A4X1UP21_BCL2A1-      gatcatcagggacattttccaacaaggcaagacctgttttatcccacggt
A0A4X1UP21_BCL2A1-      gatcatcagggacattttccaacaaggcaagacctgttttatcccacggt
A0A4X1UP21_BCL2A1-      gatcatcagggacattttccaacaaggcaagacctgttttatcccacggt
A0A4X1UP21_BCL2A1-      --------------------------------------------------
A0A4X1UP21_BCL2A1-      --------------------------------------------------
C7F841_BCL2A1-01        --------------------------------------------------

A0A4X1UP21_BCL2A1-      atcagttccagagcaatcacatggatatggtgaaattagcatcgcctgag
A0A4X1UP21_BCL2A1-      atcagttccagagcaatcacatggatatggtgaaattagcatcgcctgag
A0A4X1UP21_BCL2A1-      atcagttccagagcaatcacatggatatggtgaaattagcatcgcctgag
A0A4X1UP21_BCL2A1-      -------------------------------gaaaatggctttg--taaa
A0A4X1UP21_BCL2A1-      -------------------------------gaaaatggctttg--taaa
C7F841_BCL2A1-01        -------------------------------gaaaatggctttg--taaa
                                                       **** * ** * *  * * 

A0A4X1UP21_BCL2A1-      gaaatttcttcccttcccaaaacatcctggaatattcatcagcccgggga
A0A4X1UP21_BCL2A1-      gaaatttcttcccttcccaaaacatcctggaatattcatcagcccgggga
A0A4X1UP21_BCL2A1-      gaaatttcttcccttcccaaaacatcctggaatattcatcagcccgggga
A0A4X1UP21_BCL2A1-      gaagttt-------------------------------------------
A0A4X1UP21_BCL2A1-      gaagttt-------------------------------------------
C7F841_BCL2A1-01        gaagttt-------------------------------------------
                        *** ***                                           

A0A4X1UP21_BCL2A1-      gaatgagattcgagaggaggccttgtcaacagggggacttgatctcatct
A0A4X1UP21_BCL2A1-      gaatgagattcgagaggaggccttgtcaacagggggacttgatctcatct
A0A4X1UP21_BCL2A1-      gaatgagattcgagaggaggccttgtcaacagggggacttgatctcatct
A0A4X1UP21_BCL2A1-      ----------------------------------gaacccaa----atct
A0A4X1UP21_BCL2A1-      ----------------------------------gaacccaa----atct
C7F841_BCL2A1-01        ----------------------------------gaacccaa----atct
                                                          * **   *    ****

A0A4X1UP21_BCL2A1-      tcatgcctggtcttgggtttgacaactgtggcaaccgtctggggcggggc
A0A4X1UP21_BCL2A1-      tcatgcctggtcttgggtttgacaactgtggcaaccgtctggggcggggc
A0A4X1UP21_BCL2A1-      tcatgcctggtcttgggtttgacaactgtggcaaccgtctggggcggggc
A0A4X1UP21_BCL2A1-      ggctggctgacctt------------tgtggaag----------------
A0A4X1UP21_BCL2A1-      ggctggctgacctt------------tgtggaag----------------
C7F841_BCL2A1-01        ggctggctgacctt------------tgtggaag----------------
                           ** ***  ***            ***** *                 

A0A4X1UP21_BCL2A1-      aagggctactacgacgcctacctgaagcgctgtctgcagtcccaggatgt
A0A4X1UP21_BCL2A1-      aagggctactacgacgcctacctgaagcgctgtctgcagtcccaggatgt
A0A4X1UP21_BCL2A1-      aagggctactacgacgcctacctgaagcgctgtctgcagtcccaggatgt
A0A4X1UP21_BCL2A1-      --------------------------------------------------
A0A4X1UP21_BCL2A1-      --------------------------------------------------
C7F841_BCL2A1-01        --------------------------------------------------

A0A4X1UP21_BCL2A1-      gaagccctacaccctggccttggctttcaaagaacagatttgcctccagg
A0A4X1UP21_BCL2A1-      gaagccctacaccctggccttggctttcaaagaacagatttgcctccagg
A0A4X1UP21_BCL2A1-      gaagccctacaccctggccttggctttcaaagaacagatttgcctccagg
A0A4X1UP21_BCL2A1-      --------------------------ttacaggaaagatctg--------
A0A4X1UP21_BCL2A1-      --------------------------ttacaggaaagatctg--------
C7F841_BCL2A1-01        --------------------------ttacaggaaagatctg--------
                                                  * * ** * **** **        

A0A4X1UP21_BCL2A1-      tccccatggatgaacatgacatgaag---------gtcatct------gc
A0A4X1UP21_BCL2A1-      tccccatggatgaacatgacatgaaggtagatgaagtcctttatgaagac
A0A4X1UP21_BCL2A1-      tccccatggatgaacatgacatgaag---------gtcatct------gc
A0A4X1UP21_BCL2A1-      ----------------tga----aat---------gttatgt------ct
A0A4X1UP21_BCL2A1-      ----------------tga----aat---------gttatgt------ct
C7F841_BCL2A1-01        ----------------tga----aat---------gttatgt------ct
                                        ***    **          **  * *        

A0A4X1UP21_BCL2A1-      tttccaacactgcaagtgaacctgtag
A0A4X1UP21_BCL2A1-      tccccagcgtcctaa------------
A0A4X1UP21_BCL2A1-      tttccaacactgcaagtgaacctgtag
A0A4X1UP21_BCL2A1-      cctgaagcaatactattga--------
A0A4X1UP21_BCL2A1-      cctgaagcaatactattga--------
C7F841_BCL2A1-01        cctgaagcaatactattga--------
                             * *      *            

© 1998-2021Legal notice