Dataset for CDS BCL-2-like of organism Aotus nancymaae

[Download (right click)] [Edit] [Sequences] [Repertoires]

17 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A2K5D2I1_BCL2A1-      atgacagactgtgaatttggatatattc----------------------
A0A2K5D2I1_BCL2A1-      atgacagactgtgaatttggatatattc----------------------
A0A2K5EBP4_BCL2L1-      atgtctcagagcaaccgggagctggtggttgactttctctcctacaagct
A0A2K5EBP4_BCL2L1-      --------------------------------------------------
A0A2K5CWY6_BCL2L2-      --------------------------------------------------
A0A2K5CWY6_BCL2L2-      --------------------------------------------------
A0A2K5CWY6_BCL2L2-      ------------------------------------catctttcatcctt
A0A2K5CWY6_BCL2L2-      atgccccttctggttctctgtccatatattcatgccagtctttcatcctt
A0A2K5EB04_BCL2-01      atggc--gcacgctgggagaacagggtacgataaccgagagatagtgatg
A0A2K5F974_BCL2L10      atggctgacccgctgcggcagcgcaccg----------------------
A0A2K5DMS4_MCL1-01      atgtttggctt-ccaa------gtggta----------------------
A0A2K5EPX0_MCL1-01      --------------------------------------------------
A0A2K5EPX0_MCL1-02      --------------------------------------------------
A0A2K5C7L5_MCL1-01      atgtttggcct-ccaaagaaacgcgcta----------------------
A0A2K5CFB8_MCL1-03      atgtttggcct-ccaaagaaacgcggta----------------------
A0A2K5CFB8_MCL1-01      atgtttggcct-ccaaagaaacgcggta----------------------
A0A2K5CFB8_MCL1-02      atgtttggcct-ccaaagaaacgcggta----------------------
                                                                          

A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2K5EBP4_BCL2L1-      ttcccagaaaggatacagctggagtcagtttagtgatgtggaagagaaca
A0A2K5EBP4_BCL2L1-      -----------------------------------atgtggaagagaaca
A0A2K5CWY6_BCL2L2-      -----------------------------------atg-----gcggcgg
A0A2K5CWY6_BCL2L2-      -----------------------------------atg-----gcgaccc
A0A2K5CWY6_BCL2L2-      gcctcttatagccgcccgg----------------atg-----gcgaccc
A0A2K5CWY6_BCL2L2-      gcctcttatagccgcccgg----------------atg-----gcgaccc
A0A2K5EB04_BCL2-01      aagtacatccactataagctgtcgcagaggggctacgagtgggatgccgg
A0A2K5F974_BCL2L10      ------agcggct-------------------------------------
A0A2K5DMS4_MCL1-01      ------atcagactcaacctctact-------------------------
A0A2K5EPX0_MCL1-01      --------------------------------------------------
A0A2K5EPX0_MCL1-02      --------------------------------------------------
A0A2K5C7L5_MCL1-01      ------atcggactcaacctctactgtgagtgggccggcttggggactgg
A0A2K5CFB8_MCL1-03      ------atcggactcaacctctactgtgggggggccggcttgggggccgg
A0A2K5CFB8_MCL1-01      ------atcggactcaacctctactgtgggggggccggcttgggggccgg
A0A2K5CFB8_MCL1-02      ------atcggactcaacctctactgtgggggggccggcttgggggccgg
                                                                          

A0A2K5D2I1_BCL2A1-      -------acaatctaactcaggactatctgcggtacgtcctgc-------
A0A2K5D2I1_BCL2A1-      -------acaatctaactcaggactatctgcggtacgtcctgc-------
A0A2K5EBP4_BCL2L1-      ggactgaggccccagaagggactgattcggagatggagacccc-------
A0A2K5EBP4_BCL2L1-      ggactgaggccccagaagggactgattcggagatggagacccc-------
A0A2K5CWY6_BCL2L2-      cggcggcggcggcagcagcagcgggggctgcgg-gcggtc----------
A0A2K5CWY6_BCL2L2-      cagcctcggccccagacaca-cgggctctggtg-gcagacttt-------
A0A2K5CWY6_BCL2L2-      cagcctcggccccagacaca-cgggctctggtg-gcagacttt-------
A0A2K5CWY6_BCL2L2-      cagcctcggccccagacaca-cgggctctggtg-gcagacttt-------
A0A2K5EB04_BCL2-01      agatgtgggcgccg-------cacccccagggg--ccgccccc-------
A0A2K5F974_BCL2L10      -------ggtggcg-------gactacctggagtactgctccc-------
A0A2K5DMS4_MCL1-01      -----gcggtgcca-------tccctccaggaccgcggctttt-------
A0A2K5EPX0_MCL1-01      -------aatgcct-------catgttccagac-----------------
A0A2K5EPX0_MCL1-02      -------ag------------------ccagag-----------------
A0A2K5C7L5_MCL1-01      cagtggcggcacca-------cccctccgggagggcggcttttggccacg
A0A2K5CFB8_MCL1-03      cagcggcggcgcca-------cccctccgggagggcggcttttggccacg
A0A2K5CFB8_MCL1-01      cagcggcggcgcca-------cccctccgggagggcggcttttggccacg
A0A2K5CFB8_MCL1-02      cagcggcggcgcca-------cccctccgggagggcggctttt-------
                                                   *                      

A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2K5EBP4_BCL2L1-      --------------------------------------------------
A0A2K5EBP4_BCL2L1-      --------------------------------------------------
A0A2K5CWY6_BCL2L2-      --------------------------------------------------
A0A2K5CWY6_BCL2L2-      --------------------------------------------------
A0A2K5CWY6_BCL2L2-      --------------------------------------------------
A0A2K5CWY6_BCL2L2-      --------------------------------------------------
A0A2K5EB04_BCL2-01      --------------------------------------------------
A0A2K5F974_BCL2L10      --------------------------------------------------
A0A2K5DMS4_MCL1-01      --------------------------------------------------
A0A2K5EPX0_MCL1-01      --------------------------------------------------
A0A2K5EPX0_MCL1-02      --------------------------------------------------
A0A2K5C7L5_MCL1-01      gagaaggaggcctcggcccagcgagaggtagggggaggggaggccggcgt
A0A2K5CFB8_MCL1-03      gagaaggaggcctcggcccagcgagaggtagggggaggggaggccggcgc
A0A2K5CFB8_MCL1-01      gagaaggaggcctcggcccagcgagaggtagggggaggggaggccggcgc
A0A2K5CFB8_MCL1-02      --------------------------------------------------
                                                                          

A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2K5EBP4_BCL2L1-      --------------------------------------------------
A0A2K5EBP4_BCL2L1-      --------------------------------------------------
A0A2K5CWY6_BCL2L2-      --------------------------------------------------
A0A2K5CWY6_BCL2L2-      --------------------------------------------------
A0A2K5CWY6_BCL2L2-      --------------------------------------------------
A0A2K5CWY6_BCL2L2-      --------------------------------------------------
A0A2K5EB04_BCL2-01      --------------gcgccgggcatcttctcctcccagcc----------
A0A2K5F974_BCL2L10      --------------------------------------------------
A0A2K5DMS4_MCL1-01      --------------------------------------------------
A0A2K5EPX0_MCL1-01      --------------------------------------------------
A0A2K5EPX0_MCL1-02      --------------------------------------------------
A0A2K5C7L5_MCL1-01      ggtgattggcggaagcgccggcgctagcccctcggccgccctcacgcctg
A0A2K5CFB8_MCL1-03      ggtgattggcggaagcgccggcgctagccccccggccgccctcgtgcctg
A0A2K5CFB8_MCL1-01      ggtgattggcggaagcgccggcgctagccccccggccgccctcgtgcctg
A0A2K5CFB8_MCL1-02      --------------------------------------------------
                                                                          

A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2K5EBP4_BCL2L1-      --------------------------------------------------
A0A2K5EBP4_BCL2L1-      --------------------------------------------------
A0A2K5CWY6_BCL2L2-      --------------------------------------------------
A0A2K5CWY6_BCL2L2-      --------------------------------------------------
A0A2K5CWY6_BCL2L2-      --------------------------------------------------
A0A2K5CWY6_BCL2L2-      --------------------------------------------------
A0A2K5EB04_BCL2-01      --------------------------------------------------
A0A2K5F974_BCL2L10      --------------------------------------------------
A0A2K5DMS4_MCL1-01      --------------------------------------------------
A0A2K5EPX0_MCL1-01      --------------------------------------------------
A0A2K5EPX0_MCL1-02      --------------------------------------------------
A0A2K5C7L5_MCL1-01      acgcccgg-gggtcgtgcggccgctgc-----------------------
A0A2K5CFB8_MCL1-03      acgcccggagggtcgtgcggccgccgcccattggcgccgaggtccccgac
A0A2K5CFB8_MCL1-01      acgcccggagggtcgtgcggccgccgcccattggcgccgaggtccccgac
A0A2K5CFB8_MCL1-02      --------------------------------------------------
                                                                          

A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2K5EBP4_BCL2L1-      --------------------------------------------------
A0A2K5EBP4_BCL2L1-      --------------------------------------------------
A0A2K5CWY6_BCL2L2-      --------------------------------------------------
A0A2K5CWY6_BCL2L2-      --------------------------------------------------
A0A2K5CWY6_BCL2L2-      --------------------------------------------------
A0A2K5CWY6_BCL2L2-      --------------------------------------------------
A0A2K5EB04_BCL2-01      ------------------------tggacacacgcccggtcccgccgcgc
A0A2K5F974_BCL2L10      --------------------------------------------------
A0A2K5DMS4_MCL1-01      --------------------------------------------------
A0A2K5EPX0_MCL1-01      --------------------------------------------------
A0A2K5EPX0_MCL1-02      --------------------------------------------------
A0A2K5C7L5_MCL1-01      ------------------------tggttcttcgcgcccacccgccgcgc
A0A2K5CFB8_MCL1-03      gtcaccgcgaccccctcgaggctgctgttcttcgcgcccacccgccgcgc
A0A2K5CFB8_MCL1-01      gtcaccgcgaccccctcgaggctgctgttcttcgcgcccacccgccgcgc
A0A2K5CFB8_MCL1-02      --------------------------------------------------
                                                                          

A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2K5EBP4_BCL2L1-      --------------------------------------------------
A0A2K5EBP4_BCL2L1-      --------------------------------------------------
A0A2K5CWY6_BCL2L2-      --------------------------------------------------
A0A2K5CWY6_BCL2L2-      --------------------------------------------------
A0A2K5CWY6_BCL2L2-      --------------------------------------------------
A0A2K5CWY6_BCL2L2-      --------------------------------------------------
A0A2K5EB04_BCL2-01      cccgggacccggtctccaggacctcgccgccgccgcccccggc-------
A0A2K5F974_BCL2L10      --------------------------------------------------
A0A2K5DMS4_MCL1-01      --------------------------------------------------
A0A2K5EPX0_MCL1-01      --------------------------------------------------
A0A2K5EPX0_MCL1-02      --------------------------------------------------
A0A2K5C7L5_MCL1-01      ggcgccgcttgaggagatggaagccccggccgccgacgccatcatgtcgc
A0A2K5CFB8_MCL1-03      ggcgccgcttgaggagatggaagccccggccgccgacgccatcatgtcgc
A0A2K5CFB8_MCL1-01      ggcgccgcttgaggagatggaagccccggccgccgacgccatcatgtcgc
A0A2K5CFB8_MCL1-02      --------------------------------------------------
                                                                          

A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2K5EBP4_BCL2L1-      --------------------------------------------------
A0A2K5EBP4_BCL2L1-      --------------------------------------------------
A0A2K5CWY6_BCL2L2-      --------------------------------------------------
A0A2K5CWY6_BCL2L2-      --------------------------------------------------
A0A2K5CWY6_BCL2L2-      --------------------------------------------------
A0A2K5CWY6_BCL2L2-      --------------------------------------------------
A0A2K5EB04_BCL2-01      --------------------------------------------------
A0A2K5F974_BCL2L10      --------------------------------------------------
A0A2K5DMS4_MCL1-01      --------------------------------------------------
A0A2K5EPX0_MCL1-01      --------------------------------------------------
A0A2K5EPX0_MCL1-02      --------------------------------------------------
A0A2K5C7L5_MCL1-01      ccgaagaagagctggacaggtacgagccggagcctctcgggaagcggccg
A0A2K5CFB8_MCL1-03      ctgaagaagagctggacgggtacgagccggagcctctcgggaagcggccg
A0A2K5CFB8_MCL1-01      ctgaagaagagctggacgggtacgagccggagcctctcgggaagcggccg
A0A2K5CFB8_MCL1-02      --------------------------------------------------
                                                                          

A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2K5EBP4_BCL2L1-      --------------------------------------------------
A0A2K5EBP4_BCL2L1-      --------------------------------------------------
A0A2K5CWY6_BCL2L2-      --------------------------------------------------
A0A2K5CWY6_BCL2L2-      --------------------------------------------------
A0A2K5CWY6_BCL2L2-      --------------------------------------------------
A0A2K5CWY6_BCL2L2-      --------------------------------------------------
A0A2K5EB04_BCL2-01      --------------------------------------------------
A0A2K5F974_BCL2L10      --------------------------------------------------
A0A2K5DMS4_MCL1-01      --------------------------------------------------
A0A2K5EPX0_MCL1-01      --------------------------------------------------
A0A2K5EPX0_MCL1-02      --------------------------------------------------
A0A2K5C7L5_MCL1-01      gctgtcctgcccctgctggagttggtggaggagcctggtaatgactccag
A0A2K5CFB8_MCL1-03      gctgtcctgcccctgctggagttggtcggggagcctggtaatggctccag
A0A2K5CFB8_MCL1-01      gctgtcctgcccctgctggagttggtcggggagcctggtaatggctccag
A0A2K5CFB8_MCL1-02      --------------------------------------------------
                                                                          

A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2K5EBP4_BCL2L1-      --------------------------------------------------
A0A2K5EBP4_BCL2L1-      --------------------------------------------------
A0A2K5CWY6_BCL2L2-      --------------------------------------------------
A0A2K5CWY6_BCL2L2-      --------------------------------------------------
A0A2K5CWY6_BCL2L2-      --------------------------------------------------
A0A2K5CWY6_BCL2L2-      --------------------------------------------------
A0A2K5EB04_BCL2-01      --------------------------------------------------
A0A2K5F974_BCL2L10      --------------------------------------------------
A0A2K5DMS4_MCL1-01      --------------------------------------------------
A0A2K5EPX0_MCL1-01      --------------------------------------------------
A0A2K5EPX0_MCL1-02      --------------------------------------------------
A0A2K5C7L5_MCL1-01      tacggatgggtcactaccctcgacgccgccgaca----------------
A0A2K5CFB8_MCL1-03      tacggacgggtcactaccctcgacgccgcctccagcggaggaggaggagg
A0A2K5CFB8_MCL1-01      tacggacgggtcactaccctcgacgccgcctccagcggaggaggaggagg
A0A2K5CFB8_MCL1-02      --------------------------------------------------
                                                                          

A0A2K5D2I1_BCL2A1-      -------------------------------------------------a
A0A2K5D2I1_BCL2A1-      -------------------------------------------------a
A0A2K5EBP4_BCL2L1-      -------------------------------------------------c
A0A2K5EBP4_BCL2L1-      -------------------------------------------------c
A0A2K5CWY6_BCL2L2-      --------------------------------------------------
A0A2K5CWY6_BCL2L2-      -------------------------------------------------g
A0A2K5CWY6_BCL2L2-      -------------------------------------------------g
A0A2K5CWY6_BCL2L2-      -------------------------------------------------g
A0A2K5EB04_BCL2-01      --------------------------------------------------
A0A2K5F974_BCL2L10      --------------------------------------------------
A0A2K5DMS4_MCL1-01      --------------------------------------------------
A0A2K5EPX0_MCL1-01      --------------------------------------------------
A0A2K5EPX0_MCL1-02      --------------------------------------------------
A0A2K5C7L5_MCL1-01      -----------------tcactggagattatctctcggtaccttcgggaa
A0A2K5CFB8_MCL1-03      acgagttgtaccggcagtcgctggagattatctctcggtaccttcgggag
A0A2K5CFB8_MCL1-01      acgagttgtaccggcagtcgctggagattatctctcggtaccttcgggag
A0A2K5CFB8_MCL1-02      --------------------------------------------------
                                                                          

A0A2K5D2I1_BCL2A1-      gataccacaatc--------------------------------------
A0A2K5D2I1_BCL2A1-      gataccacaatc--------------------------------------
A0A2K5EBP4_BCL2L1-      agtgccatcaatggcaacccatcctggcacctggcggacagccccgcggt
A0A2K5EBP4_BCL2L1-      agtgccatcaat--------------------------------------
A0A2K5CWY6_BCL2L2-      ggggctccgggccg------------------------------------
A0A2K5CWY6_BCL2L2-      taggttataagctg------------------------------------
A0A2K5CWY6_BCL2L2-      taggttataagctg------------------------------------
A0A2K5CWY6_BCL2L2-      taggttataagctg------------------------------------
A0A2K5EB04_BCL2-01      --cgcccccgcc--------------------------------------
A0A2K5F974_BCL2L10      -aggagcctggc--------------------------------------
A0A2K5DMS4_MCL1-01      --ggcgactggc--------------------------------------
A0A2K5EPX0_MCL1-01      --------------------------------------------------
A0A2K5EPX0_MCL1-02      --------------------------------------------------
A0A2K5C7L5_MCL1-01      caggcgactggc--------------------------------------
A0A2K5CFB8_MCL1-03      caggcgaccggc--------------------------------------
A0A2K5CFB8_MCL1-01      caggcgaccggc--------------------------------------
A0A2K5CFB8_MCL1-02      --ggcgaccggc--------------------------------------
                                                                          

A0A2K5D2I1_BCL2A1-      -----------tggaacgggtccaagcaaaacgtccaggg----------
A0A2K5D2I1_BCL2A1-      -----------tggaacgggtccaagcaaaacgtccaggg----------
A0A2K5EBP4_BCL2L1-      gaatggagccacgggccacagcagcagtttggatgcccgggaggtgatcc
A0A2K5EBP4_BCL2L1-      --------------------------------------------------
A0A2K5CWY6_BCL2L2-      ----gggcggcggcgccatct-tgtg--------cccgggg---------
A0A2K5CWY6_BCL2L2-      ----aggcagaagggttatgtctgtggagctggccccggggagggcccag
A0A2K5CWY6_BCL2L2-      ----aggcagaagggttatgtctgtggagctggccccggggagggcccag
A0A2K5CWY6_BCL2L2-      ----aggcagaagggttatgtctgtggagctggccccggggagggcccag
A0A2K5EB04_BCL2-01      ------gccgccgccacggggcctgcgctca-gcccggtg-------cca
A0A2K5F974_BCL2L10      ------acccccgagtc---gccgccgtccacggccgagg-------ccg
A0A2K5DMS4_MCL1-01      ------gccaaggacacaaagccaatgggcaggtctgagg-------ccg
A0A2K5EPX0_MCL1-01      --------------------------------------------------
A0A2K5EPX0_MCL1-02      --------------------------------------------------
A0A2K5C7L5_MCL1-01      ------gccaaggacacaaagccaatggacaggtccgggg-------ccg
A0A2K5CFB8_MCL1-03      ------gccaaggacacaaagccaatgggcaggtccgggg-------ccg
A0A2K5CFB8_MCL1-01      ------gccaaggacacaaagccaatgggcaggtccgggg-------ccg
A0A2K5CFB8_MCL1-02      ------gccaaggacacaaagccaatgggcaggtccgggg-------ccg
                                                                          

A0A2K5D2I1_BCL2A1-      ---------tgctacaaaaggttgcattctcagtccaaaaagaagtggaa
A0A2K5D2I1_BCL2A1-      ---------tgctacaaaaggttgcattctcagtccaaaaagaagtggaa
A0A2K5EBP4_BCL2L1-      ccatggcagcagtaaagcaagcactgagggaggcgggcgacgaatttgaa
A0A2K5EBP4_BCL2L1-      --------------------------------------------------
A0A2K5CWY6_BCL2L2-      --------ccggtg-------------gggaggccggggagg-----ggg
A0A2K5CWY6_BCL2L2-      cagctgacccgctgcaccaagcaatgcgggcagctggagatgagttcgag
A0A2K5CWY6_BCL2L2-      cagctgacccgctgcaccaagcaatgcgggcagctggagatgagttcgag
A0A2K5CWY6_BCL2L2-      cagctgacccgctgcaccaagcaatgcgggcagctggagatgagttcgag
A0A2K5EB04_BCL2-01      cc-----tgtggtccacctgaccctccgccaggccggggacgacttctcc
A0A2K5F974_BCL2L10      ct---------gtgctgcgcgcc---------atggccgccggtgtacgg
A0A2K5DMS4_MCL1-01      ccaacagtaaggcgctggagaccttacgaggggttggggaaggcgtgccc
A0A2K5EPX0_MCL1-01      --------------ctgcatgcttttc------tt--------c------
A0A2K5EPX0_MCL1-02      --------------ttata---ataac------ttaaagataac------
A0A2K5C7L5_MCL1-01      ccagcaggaaggctctggagaccttacgacgggttggggacggcgtgcag
A0A2K5CFB8_MCL1-03      ccagcaggaaggcgctggagaccttacgacgggttggggacggcgtgcag
A0A2K5CFB8_MCL1-01      ccagcaggaaggcgctggagaccttacgacgggttggggacggcgtgcag
A0A2K5CFB8_MCL1-02      ccagcaggaaggcgctggagaccttacgacgggttggggacggcgtgcag
                                                                          

A0A2K5D2I1_BCL2A1-      aagagtctgaagccatgcttggacaatgttaatat---------tgtgtc
A0A2K5D2I1_BCL2A1-      aagagtctgaagccatgcttggacaatgttaatat---------tgtgtc
A0A2K5EBP4_BCL2L1-      ctgcggtaccggcgggcatttagtgacctgacatcccagctccacatcac
A0A2K5EBP4_BCL2L1-      --------------------------------------gctccacatcac
A0A2K5CWY6_BCL2L2-      ccccg------------------------gggggc------gcaggggac
A0A2K5CWY6_BCL2L2-      acccgcttccggcgcaccttctctgatctggcggctcagctgcatgtgac
A0A2K5CWY6_BCL2L2-      acccgcttccggcgcaccttctctgatctggcggctcagctgcatgtgac
A0A2K5CWY6_BCL2L2-      acccgcttccggcgcaccttctctgatctggcggctcagctgcatgtgac
A0A2K5EB04_BCL2-01      cgccgctaccgccgcgacttcgccgagatgtccagccagctgcacctgac
A0A2K5F974_BCL2L10      aaactctaccggtccttcttctccgcctacctcggctacccgggga----
A0A2K5DMS4_MCL1-01      cgcaaccacgagatggccttacaaggcatgcttcggaatctggacaacaa
A0A2K5EPX0_MCL1-01      cccaggcatg-------cttcgaa-------------aactggacatcaa
A0A2K5EPX0_MCL1-02      cacatgcatg-------cttcgaa-------------aactggacatcaa
A0A2K5C7L5_MCL1-01      cgcaaccacgagacggccttccaa--------------------------
A0A2K5CFB8_MCL1-03      cgcaaccacgagacggccttccaa--------------------------
A0A2K5CFB8_MCL1-01      cgcaaccacgagacggccttccaaggcatgcttcggaaactggacatcaa
A0A2K5CFB8_MCL1-02      cgcaaccacgagacggccttccaaggcatgcttcggaaactggacatcaa
                                                                          

A0A2K5D2I1_BCL2A1-      catagataatgccagaatgatattcagtcaagtgatggaaaaggaatttg
A0A2K5D2I1_BCL2A1-      catagataatgccagaatgatattcagtcaagtgatggaaaaggaatttg
A0A2K5EBP4_BCL2L1-      ccccgggacagcgtatcagagctttgaacaggtagtgaacgaactcttcc
A0A2K5EBP4_BCL2L1-      ccccgggacagcgtatcagagctttgaacaggtagtgaacgaactcttcc
A0A2K5CWY6_BCL2L2-      tacgggaacggcct----------------ggagtctgaggaact-----
A0A2K5CWY6_BCL2L2-      cccaggctcagcccaacaacgcttcacccaggtctccgatgaacttttcc
A0A2K5CWY6_BCL2L2-      cccaggctcagcccaacaacgcttcacccaggtctccgatgaacttttcc
A0A2K5CWY6_BCL2L2-      cccaggctcagcccaacaacgcttcacccaggtctccgatgaacttttcc
A0A2K5EB04_BCL2-01      gcccttcaccgcgcggggacgctttgccacggtggtggaggagctcttca
A0A2K5F974_BCL2L10      --------accgcgtcgagctggtggcgaggatggcggaggccctgctct
A0A2K5DMS4_MCL1-01      aaacgaagacaatgtcaaatcttt--------------------------
A0A2K5EPX0_MCL1-01      aaacaaagacgatgtcaaatctttgtctcgagtgatggtccatgttttca
A0A2K5EPX0_MCL1-02      aaacaaagacgatgtcaaatctttgtctcgagtgatggtccatgttttca
A0A2K5C7L5_MCL1-01      --------------------------------------------------
A0A2K5CFB8_MCL1-03      --------------------------------------------------
A0A2K5CFB8_MCL1-01      aaacgaagacgatgtcaaatctttgtctcgagtgatggtccatgttttca
A0A2K5CFB8_MCL1-02      aaacgaagacgatgtcaaatctttgtctcgagtgatggtccatgttttca
                                                                          

A0A2K5D2I1_BCL2A1-      aagatgg---cattattaactggggaagaa-ttgtaaccatatttgcatt
A0A2K5D2I1_BCL2A1-      aagatgg---cattattaactggggaagaa-ttgtaaccatatttgcatt
A0A2K5EBP4_BCL2L1-      gggatgg------ggtaaactggggtcgca-ttgtggcctttttctcctt
A0A2K5EBP4_BCL2L1-      gggatgg------ggtaaactggggtcgca-ttgtggcctttttctcctt
A0A2K5CWY6_BCL2L2-      ---ggag------cctga---ggagctgctgctggagccc----------
A0A2K5CWY6_BCL2L2-      aaggggg------ccctaactggggccgcc-ttgtagccttctttgtctt
A0A2K5CWY6_BCL2L2-      aaggggg------ccctaactggggccgcc-ttgtagccttctttgtctt
A0A2K5CWY6_BCL2L2-      aaggggg------ccctaactggggccgcc-ttgtagccttctttgtctt
A0A2K5EB04_BCL2-01      gggacgg------ggtgaactgggggagga-ttgtggccttctttgagtt
A0A2K5F974_BCL2L10      ccgacagtcccggccccacctggggcaacg-tggtgatgctcctggcctt
A0A2K5DMS4_MCL1-01      -ctacgg---cgtaacaaactggggtagga-ttgtgactctcagttcttt
A0A2K5EPX0_MCL1-01      gcgacgg---cgtaacaaactggggtagga-tcgtgactctcatttcttt
A0A2K5EPX0_MCL1-02      gcgacgg---cgtaacaaactggggtagga-tcgtgactctcatttcttt
A0A2K5C7L5_MCL1-01      --------------------------------------------------
A0A2K5CFB8_MCL1-03      --------------------------------------------------
A0A2K5CFB8_MCL1-01      gcgacgg---cgtaacaaactggggtagga-ttgtgactctcatttcttt
A0A2K5CFB8_MCL1-02      gcgacgg---cgtaacaaactggggtagga-ttgtgactctcatttcttt
                                                                          

A0A2K5D2I1_BCL2A1-      t------------------------------gaaggtattctcatcaaga
A0A2K5D2I1_BCL2A1-      t------------------------------gaaggtattctcatcaaga
A0A2K5EBP4_BCL2L1-      c---------------------gg------cggggcactgtgcgtggaaa
A0A2K5EBP4_BCL2L1-      c---------------------gg------cggggcactgtgcgtggaaa
A0A2K5CWY6_BCL2L2-      --------------------------------------------------
A0A2K5CWY6_BCL2L2-      t---------------------gg------ggctgcactgtgtgctgaga
A0A2K5CWY6_BCL2L2-      t---------------------gg------ggctgcactgtgtgctgaga
A0A2K5CWY6_BCL2L2-      t---------------------gg------ggctgcactgtgtgctgaga
A0A2K5EB04_BCL2-01      c---------------------gg------tggggtcatgtgtgtggaga
A0A2K5F974_BCL2L10      cgcggggacgctgctagagagggggccgctggtgaccgcccggtggaaga
A0A2K5DMS4_MCL1-01      t---------------------ggtgcctttgtggccaaacacttgaaga
A0A2K5EPX0_MCL1-01      t---------------------ggtgcctttgtggccaaacacttgaaga
A0A2K5EPX0_MCL1-02      t---------------------ggtgcctttgtggccaaacacttgaaga
A0A2K5C7L5_MCL1-01      --------------------------------------------------
A0A2K5CFB8_MCL1-03      --------------------------------------------------
A0A2K5CFB8_MCL1-01      t---------------------ggtgcctttgtggccaaacacttgaaga
A0A2K5CFB8_MCL1-02      t---------------------ggtgcctttgtggccaaacacttgaaga
                                                                          

A0A2K5D2I1_BCL2A1-      ------aacttctacgagagcgaattgccccgga------tgtggatact
A0A2K5D2I1_BCL2A1-      ------aacttctacgagagcgaattgccccgga------tgtggatact
A0A2K5EBP4_BCL2L1-      ---------------------gcgtagacaaggaga----tgcaggtatt
A0A2K5EBP4_BCL2L1-      ---------------------gcgtagacaaggaga----tgcaggtatt
A0A2K5CWY6_BCL2L2-      --------------------------------gagc----cggagcccga
A0A2K5CWY6_BCL2L2-      ---------------------gtgtcaacaaggaga----tggaaccact
A0A2K5CWY6_BCL2L2-      ---------------------gtgtcaacaaggaga----tggaaccact
A0A2K5CWY6_BCL2L2-      ---------------------gtgtcaacaaggaga----tggaaccact
A0A2K5EB04_BCL2-01      ---------------------gcgtcaaccgggaga----tgtcgcccct
A0A2K5F974_BCL2L10      agtggggcttccagtcgcggctgaaggagccggagggcgacgtcgcccgg
A0A2K5DMS4_MCL1-01      ---------------------ccataaaccaagaaagttgcatcga----
A0A2K5EPX0_MCL1-01      ---------------------ccataaaccaagaaagctgcattga----
A0A2K5EPX0_MCL1-02      ---------------------ccataaaccaagaaagctgcattga----
A0A2K5C7L5_MCL1-01      --------------------------------------------------
A0A2K5CFB8_MCL1-03      --------------------------------------------------
A0A2K5CFB8_MCL1-01      ---------------------ccataaaccaagaaagctgcattga----
A0A2K5CFB8_MCL1-02      ---------------------ccataaaccaagaaagctgcattga----
                                                                          

A0A2K5D2I1_BCL2A1-      tacaaggag-atttcgtattttgttgctgagttc----ataatgaataac
A0A2K5D2I1_BCL2A1-      tacaaggag-atttcgtattttgttgctgagttc----ataatgaataac
A0A2K5EBP4_BCL2L1-      ggtgagtcggatcgcagcttggatggccacttac----ctgaatgaccac
A0A2K5EBP4_BCL2L1-      ggtgagtcggatcgcagcttggatggccacttac----ctgaatgaccac
A0A2K5CWY6_BCL2L2-      gcctgaagaggagccgggattggtcgagggtgac----ccgg--------
A0A2K5CWY6_BCL2L2-      ggtgggacaagtgcaggagtggatggtggcctac----ctggagacgcgg
A0A2K5CWY6_BCL2L2-      ggtgggacaagtgcaggagtggatggtggcctac----ctggagacgcgg
A0A2K5CWY6_BCL2L2-      ggtgggacaagtgcaggagtggatggtggcctac----ctggagacgcgg
A0A2K5EB04_BCL2-01      ggtggacaacatcgcgctgtggatgaccgagtac----ctgaaccggcac
A0A2K5F974_BCL2L10      gactgccagcgcctggtggc--cttgctgagctcgcggctcgtggggcag
A0A2K5DMS4_MCL1-01      ----accattagcagaaagt--at--cagatatt----ctc---------
A0A2K5EPX0_MCL1-01      ----accattagcagaaagt--attacagacgtt----ctcgtaaggaca
A0A2K5EPX0_MCL1-02      ----accattagcagaaagt--attacagacgtt----ctcgtaaggaca
A0A2K5C7L5_MCL1-01      --------------------------------------------------
A0A2K5CFB8_MCL1-03      --------------------------------------------------
A0A2K5CFB8_MCL1-01      ----accattagcagaaagt--atcacagacgtt----ctcgtaaggaca
A0A2K5CFB8_MCL1-02      ----accattagcagaaagt--atcacagacgtt----ctcgtaaggaca
                                                                          

A0A2K5D2I1_BCL2A1-      acaggagaatggataagtcaaaacggaggctggg-a--------------
A0A2K5D2I1_BCL2A1-      acaggagaatggataagtcaaaacggaggctgggcg--------------
A0A2K5EBP4_BCL2L1-      ctagagccttggatccaggagaacggcggctgggac------acttttgt
A0A2K5EBP4_BCL2L1-      ctagagccttggatccaggagaacggcggctgggac------acttttgt
A0A2K5CWY6_BCL2L2-      ----------gggacggcgccattgaggacccggagctggaagctatcaa
A0A2K5CWY6_BCL2L2-      ctggccgactggatccacagcagtgggggctgggagctggaagctatcaa
A0A2K5CWY6_BCL2L2-      ctggccgactggatccacagcagtgggggctgggcg------gagttcac
A0A2K5CWY6_BCL2L2-      ctggccgactggatccacagcagtgggggctgggcg------gagttcac
A0A2K5EB04_BCL2-01      ctgcacacctggatccaggataacggaggctgggat------gcctttgt
A0A2K5F974_BCL2L10      caccgtgcctggctggaggctcagggcggctggg-t------gagcatgc
A0A2K5DMS4_MCL1-01      ----------------------------gctgggat------gggtttgt
A0A2K5EPX0_MCL1-01      aaacgggactggctagttaaacaaagaggctgggat------gggtttgt
A0A2K5EPX0_MCL1-02      aaacgggactggctagttaaacaaagaggctgggat------gggtttgt
A0A2K5C7L5_MCL1-01      --------------------------------------------------
A0A2K5CFB8_MCL1-03      --------------------------------ggat------gggtttgt
A0A2K5CFB8_MCL1-01      aaacgggactggctagttaaacaaagaggctgggat------gggtttgt
A0A2K5CFB8_MCL1-02      aaacgggactggctagttaaacaaagaggctgggat------gggtttgt
                                                                          

A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2K5EBP4_BCL2L1-      ggaact--------------------------------------------
A0A2K5EBP4_BCL2L1-      ggaact--------------------------------------------
A0A2K5CWY6_BCL2L2-      agctcgagtcagggagatggaggaagaagctgagaagctaaaagaactac
A0A2K5CWY6_BCL2L2-      agctcgagtcagggagatggaggaagaagctgagaagctaaaagaactac
A0A2K5CWY6_BCL2L2-      agctctatacgggg------------------------------------
A0A2K5CWY6_BCL2L2-      agctctatacgggg------------------------------------
A0A2K5EB04_BCL2-01      gga-----------------------------------------------
A0A2K5F974_BCL2L10      ggagggggacacgggcctc-------------------------------
A0A2K5DMS4_MCL1-01      gga----------gttctt-------------------------------
A0A2K5EPX0_MCL1-01      gga----------gttctt-------------------------------
A0A2K5EPX0_MCL1-02      gga----------gttctt-------------------------------
A0A2K5C7L5_MCL1-01      -------------gttctt-------------------------------
A0A2K5CFB8_MCL1-03      gga----------gttctt-------------------------------
A0A2K5CFB8_MCL1-01      gga----------gttctt-------------------------------
A0A2K5CFB8_MCL1-02      gga----------gttctt-------------------------------
                                                                          

A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2K5EBP4_BCL2L1-      --------------------------------------------------
A0A2K5EBP4_BCL2L1-      --------------------------------------------------
A0A2K5CWY6_BCL2L2-      agaacgaggtagagaagcagatgaatatgagtccacctccaggcaatgct
A0A2K5CWY6_BCL2L2-      agaacgaggtagagaagcagatgaatatgagtccacctccaggcaatgct
A0A2K5CWY6_BCL2L2-      ---acgggg-----------------------------------------
A0A2K5CWY6_BCL2L2-      ---acgggg-----------------------------------------
A0A2K5EB04_BCL2-01      --------------------------------------------------
A0A2K5F974_BCL2L10      --------------------------------------------------
A0A2K5DMS4_MCL1-01      --------------------------------------------------
A0A2K5EPX0_MCL1-01      --------------------------------------------------
A0A2K5EPX0_MCL1-02      --------------------------------------------------
A0A2K5C7L5_MCL1-01      --------------------------------------------------
A0A2K5CFB8_MCL1-03      --------------------------------------------------
A0A2K5CFB8_MCL1-01      --------------------------------------------------
A0A2K5CFB8_MCL1-02      --------------------------------------------------
                                                                          

A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2K5EBP4_BCL2L1-      ----------------ctatggaaacaatg-cggcagccg----------
A0A2K5EBP4_BCL2L1-      ----------------ctatggaaacaatg-cggcagccg----------
A0A2K5CWY6_BCL2L2-      ggcccagtgatcatgtccattgaggagaagatggaggctgatgcccgttc
A0A2K5CWY6_BCL2L2-      ggcccagtgatcatgtccattgaggagaagatggaggctgatgcccgttc
A0A2K5CWY6_BCL2L2-      ----------------ccctggaggaggcg-cggcgtctg----------
A0A2K5CWY6_BCL2L2-      ----------------ccctggaggaggcg-cggcgtctg----------
A0A2K5EB04_BCL2-01      -----------------actgta----tggccccagcatg----------
A0A2K5F974_BCL2L10      ----------------ccgagtagctgggaatataggatg---gcttttg
A0A2K5DMS4_MCL1-01      ----------------ccgtgta---gaggacttagaagg----------
A0A2K5EPX0_MCL1-01      ----------------ccatgta---gaggacctagaagg----------
A0A2K5EPX0_MCL1-02      ----------------ccatgta---gaggacctagaagg----------
A0A2K5C7L5_MCL1-01      ----------------ccatgta---gaagacctagaagg----------
A0A2K5CFB8_MCL1-03      ----------------ccatgta---gaggacctagaagg----------
A0A2K5CFB8_MCL1-01      ----------------ccatgta---gaggacctagaagg----------
A0A2K5CFB8_MCL1-02      ----------------ccatgta---gaggacctagaagg----------
                                                                          

A0A2K5D2I1_BCL2A1-      -----------------------aaatggctttgtaaagaagtttgaacc
A0A2K5D2I1_BCL2A1-      -----------------------aaatggc--------acagtctcctgc
A0A2K5EBP4_BCL2L1-      ---------------------------------------agagccgaaag
A0A2K5EBP4_BCL2L1-      ---------------------------------------agagccgaaag
A0A2K5CWY6_BCL2L2-      catctatgttggcaatgtggactatggtgcaacagcagaagagctggaag
A0A2K5CWY6_BCL2L2-      catctatgttggcaatgtggactatggtgcaacagcagaagagctggaag
A0A2K5CWY6_BCL2L2-      --------------------------------cgggaggggaactgg---
A0A2K5CWY6_BCL2L2-      --------------------------------cgggaggggaactgg---
A0A2K5EB04_BCL2-01      --------------------------cggcctctgtttgatttct-----
A0A2K5F974_BCL2L10      ttacttcttcaggacctcctcctcgctggcattatggagaaaact-----
A0A2K5DMS4_MCL1-01      --------------------------tggcatca-gaaatgggct-----
A0A2K5EPX0_MCL1-01      --------------------------tggcatca-gaaatgtgct-----
A0A2K5EPX0_MCL1-02      --------------------------tggcatca-gaaatgtgct-----
A0A2K5C7L5_MCL1-01      --------------------------tggcatca-gaaatgtgct-----
A0A2K5CFB8_MCL1-03      --------------------------tggcatca-gaaatgtgct-----
A0A2K5CFB8_MCL1-01      --------------------------tggcatca-gaaatgtgct-----
A0A2K5CFB8_MCL1-02      --------------------------tggcatca-gaaatgtgct-----
                                                                          

A0A2K5D2I1_BCL2A1-      taaa----------------------------------------------
A0A2K5D2I1_BCL2A1-      ttgt----------------------------------------------
A0A2K5EBP4_BCL2L1-      --------------------------------------------------
A0A2K5EBP4_BCL2L1-      --------------------------------------------------
A0A2K5CWY6_BCL2L2-      ctcactttcatggctgtggttcagtcaaccgtgttaccatactctgtgac
A0A2K5CWY6_BCL2L2-      ctcactttcatggctgtggttcagtcaaccgtgttaccatactctgtgac
A0A2K5CWY6_BCL2L2-      --------------------------------------------------
A0A2K5CWY6_BCL2L2-      --------------------------------------------------
A0A2K5EB04_BCL2-01      --------------------------------------------------
A0A2K5F974_BCL2L10      --------------------------------------------------
A0A2K5DMS4_MCL1-01      --------------------------------------------------
A0A2K5EPX0_MCL1-01      --------------------------------------------------
A0A2K5EPX0_MCL1-02      --------------------------------------------------
A0A2K5C7L5_MCL1-01      --------------------------------------------------
A0A2K5CFB8_MCL1-03      --------------------------------------------------
A0A2K5CFB8_MCL1-01      --------------------------------------------------
A0A2K5CFB8_MCL1-02      --------------------------------------------------
                                                                          

A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2K5EBP4_BCL2L1-      --------------------------------------------------
A0A2K5EBP4_BCL2L1-      --------------------------------------------------
A0A2K5CWY6_BCL2L2-      aaatttagtggccatcccaaagggtttgcatatatagagttctcagacaa
A0A2K5CWY6_BCL2L2-      aaatttagtggccatcccaaagggtttgcatatatagagttctcagacaa
A0A2K5CWY6_BCL2L2-      --------------------------------------------------
A0A2K5CWY6_BCL2L2-      --------------------------------------------------
A0A2K5EB04_BCL2-01      --------------------------------------------------
A0A2K5F974_BCL2L10      --------------------------------------------------
A0A2K5DMS4_MCL1-01      --------------------------------------------------
A0A2K5EPX0_MCL1-01      --------------------------------------------------
A0A2K5EPX0_MCL1-02      --------------------------------------------------
A0A2K5C7L5_MCL1-01      --------------------------------------------------
A0A2K5CFB8_MCL1-03      --------------------------------------------------
A0A2K5CFB8_MCL1-01      --------------------------------------------------
A0A2K5CFB8_MCL1-02      --------------------------------------------------
                                                                          

A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2K5EBP4_BCL2L1-      ------ggccaggagcgcttcaacc-------------------------
A0A2K5EBP4_BCL2L1-      ------ggccaggagcgcttcaacc-------------------------
A0A2K5CWY6_BCL2L2-      agagtcagtgaggacttccttggccttagatgagtccctatttagaggaa
A0A2K5CWY6_BCL2L2-      agagtcagtgaggacttccttggccttagatgagtccctatttagaggaa
A0A2K5CWY6_BCL2L2-      -gcatcagtgaggac-----------------------------------
A0A2K5CWY6_BCL2L2-      -gcatcagtgaggac-----------------------------------
A0A2K5EB04_BCL2-01      --------------------------------------------------
A0A2K5F974_BCL2L10      --------------------------------------------------
A0A2K5DMS4_MCL1-01      --------------------------------------------------
A0A2K5EPX0_MCL1-01      --------------------------------------------------
A0A2K5EPX0_MCL1-02      --------------------------------------------------
A0A2K5C7L5_MCL1-01      --------------------------------------------------
A0A2K5CFB8_MCL1-03      --------------------------------------------------
A0A2K5CFB8_MCL1-01      --------------------------------------------------
A0A2K5CFB8_MCL1-02      --------------------------------------------------
                                                                          

A0A2K5D2I1_BCL2A1-      -------------------------------------------------t
A0A2K5D2I1_BCL2A1-      -------------------------------------------------g
A0A2K5EBP4_BCL2L1-      -------------------------------------------------g
A0A2K5EBP4_BCL2L1-      -------------------------------------------------g
A0A2K5CWY6_BCL2L2-      ggcaaatcaa---------------------------------------g
A0A2K5CWY6_BCL2L2-      ggcaaatcaaggttgactttaaggctttcatttattcatctctgactcag
A0A2K5CWY6_BCL2L2-      -------------------------------------------------a
A0A2K5CWY6_BCL2L2-      -------------------------------------------------a
A0A2K5EB04_BCL2-01      -------------------------------------------------c
A0A2K5F974_BCL2L10      -------------------------------------------------g
A0A2K5DMS4_MCL1-01      -------------------------------------------------g
A0A2K5EPX0_MCL1-01      -------------------------------------------------g
A0A2K5EPX0_MCL1-02      -------------------------------------------------g
A0A2K5C7L5_MCL1-01      -------------------------------------------------g
A0A2K5CFB8_MCL1-03      -------------------------------------------------g
A0A2K5CFB8_MCL1-01      -------------------------------------------------g
A0A2K5CFB8_MCL1-02      -------------------------------------------------g
                                                                          

A0A2K5D2I1_BCL2A1-      ctggct--------------------------------------------
A0A2K5D2I1_BCL2A1-      ctggtg--------------------------------------------
A0A2K5EBP4_BCL2L1-      ctggttc---------------------------------ctgacgg---
A0A2K5EBP4_BCL2L1-      ctggttc---------------------------------ctgacgg---
A0A2K5CWY6_BCL2L2-      gtgatcccgaaacgaaccaacagaccaggcatcagcacaacagaccg---
A0A2K5CWY6_BCL2L2-      gtgatcccgaaacgaaccaacagaccaggcatcagcacaacagaccg---
A0A2K5CWY6_BCL2L2-      gtg-------------------------------------ctgacag---
A0A2K5CWY6_BCL2L2-      gtg-------------------------------------ctgacag---
A0A2K5EB04_BCL2-01      ctggct----------------------------------gtctctgaag
A0A2K5F974_BCL2L10      ctggtc--------------------------------------cag---
A0A2K5DMS4_MCL1-01      ctggct----------------------------------ttcgcag---
A0A2K5EPX0_MCL1-01      ctggct----------------------------------tttgcat---
A0A2K5EPX0_MCL1-02      ctggct----------------------------------tttgcat---
A0A2K5C7L5_MCL1-01      ctggct----------------------------------tttgcag---
A0A2K5CFB8_MCL1-03      ctggct----------------------------------tttgcag---
A0A2K5CFB8_MCL1-01      ctggct----------------------------------tttgcag---
A0A2K5CFB8_MCL1-02      ctggct----------------------------------tttgcag---
                         **                                               

A0A2K5D2I1_BCL2A1-      ----------gga-------------------------------------
A0A2K5D2I1_BCL2A1-      ----------gag-------------------------------------
A0A2K5EBP4_BCL2L1-      ----------gca-------------------------------------
A0A2K5EBP4_BCL2L1-      ----------gca-------------------------------------
A0A2K5CWY6_BCL2L2-      ----------gggttttccacgagcccgctaccgcgcacggaccaccaac
A0A2K5CWY6_BCL2L2-      ----------gggttttccacgagcccgctaccgcgcacggaccaccaac
A0A2K5CWY6_BCL2L2-      ----------ggg-------------------------------------
A0A2K5CWY6_BCL2L2-      ----------ggg-------------------------------------
A0A2K5EB04_BCL2-01      actctgctcagct-------------------------------------
A0A2K5F974_BCL2L10      ----------gtt-------------------------------------
A0A2K5DMS4_MCL1-01      ----------gtg-------------------------------------
A0A2K5EPX0_MCL1-01      ----------gtg-------------------------------------
A0A2K5EPX0_MCL1-02      ----------gtg-------------------------------------
A0A2K5C7L5_MCL1-01      ----------gtg-------------------------------------
A0A2K5CFB8_MCL1-03      ----------gtg-------------------------------------
A0A2K5CFB8_MCL1-01      ----------gtg-------------------------------------
A0A2K5CFB8_MCL1-02      ----------gtg-------------------------------------
                                  *                                       

A0A2K5D2I1_BCL2A1-      -----------------------------tgacttttctagaagttacag
A0A2K5D2I1_BCL2A1-      -----------------------------tcagtggcccagaaggagagg
A0A2K5EBP4_BCL2L1-      -----------------------------------tgactgtggccggcg
A0A2K5EBP4_BCL2L1-      -----------------------------------tgactgtggccggcg
A0A2K5CWY6_BCL2L2-      tacaacagttcccgctctcgattctacagtggttttaacagcaggccccg
A0A2K5CWY6_BCL2L2-      tacaacagttcccgctctcgattctacagtggttttaacagcaggccccg
A0A2K5CWY6_BCL2L2-      --------------------------ccgtggc----actgggggccctg
A0A2K5CWY6_BCL2L2-      --------------------------ccgtggc----actgggggccctg
A0A2K5EB04_BCL2-01      -----------------------------tggccctggtgggagcttgca
A0A2K5F974_BCL2L10      -----------------------------ttcctgtcatggttgttaa--
A0A2K5DMS4_MCL1-01      -----------------------------ttgctggagtaggaactgatt
A0A2K5EPX0_MCL1-01      -----------------------------ttgctggagtaggagctggtt
A0A2K5EPX0_MCL1-02      -----------------------------ttgctggagtaggagctggtt
A0A2K5C7L5_MCL1-01      -----------------------------ttgctggagtaggagctggtt
A0A2K5CFB8_MCL1-03      -----------------------------ttgctggagtaggagctggtt
A0A2K5CFB8_MCL1-01      -----------------------------ttgctggagtaggagctggtt
A0A2K5CFB8_MCL1-02      -----------------------------ttgctggagtaggagctggtt
                                                                *         

A0A2K5D2I1_BCL2A1-      ga------aagatctgcgaaatgctatctctcttgaagcaatactat---
A0A2K5D2I1_BCL2A1-      aa------aatggctttgtaa-----------------------------
A0A2K5EBP4_BCL2L1-      tggt--------tctgctgggctc-------------------actcttt
A0A2K5EBP4_BCL2L1-      tggt--------tctgctgggctc-------------------actcttt
A0A2K5CWY6_BCL2L2-      gggt----cgcgtctacaggggccgggctagagcgacatcatggtattcc
A0A2K5CWY6_BCL2L2-      gggt----cgcgtctacaggggccgggctagagcgacatcatggtattcc
A0A2K5CWY6_BCL2L2-      ---------gtaactgtaggggcc--------------------tttttt
A0A2K5CWY6_BCL2L2-      ---------gtaactgtaggggcc--------------------tttttt
A0A2K5EB04_BCL2-01      tcaccctgggtgcctatctgggcc---acaagtga---------------
A0A2K5F974_BCL2L10      cagc----agcattcatctacttctggacacgataattaggagtttt---
A0A2K5DMS4_MCL1-01      tggc----a-tatcta-----------ataagatag--------------
A0A2K5EPX0_MCL1-01      tggc----a-tatcta-----------ataagatag--------------
A0A2K5EPX0_MCL1-02      tggc----a-tatcta-----------ataagatag--------------
A0A2K5C7L5_MCL1-01      tggc----a-tatcta-----------ataagatagcct------tg---
A0A2K5CFB8_MCL1-03      tggc----------------------------------------------
A0A2K5CFB8_MCL1-01      tggc----actgtctc-----------tt---atacaca------tc---
A0A2K5CFB8_MCL1-02      tggc----actgtctc-----------tt---atacaca------tc---
                                                                          

A0A2K5D2I1_BCL2A1-      ---------tga
A0A2K5D2I1_BCL2A1-      ------------
A0A2K5EBP4_BCL2L1-      agtcggaaatga
A0A2K5EBP4_BCL2L1-      agtcggaaatga
A0A2K5CWY6_BCL2L2-      ccttac---taa
A0A2K5CWY6_BCL2L2-      ccttac---taa
A0A2K5CWY6_BCL2L2-      gctagcaagtga
A0A2K5CWY6_BCL2L2-      gctagcaagtga
A0A2K5EB04_BCL2-01      ------------
A0A2K5F974_BCL2L10      ---------taa
A0A2K5DMS4_MCL1-01      ------------
A0A2K5EPX0_MCL1-01      ------------
A0A2K5EPX0_MCL1-02      ------------
A0A2K5C7L5_MCL1-01      ---------taa
A0A2K5CFB8_MCL1-03      ------------
A0A2K5CFB8_MCL1-01      ---------tag
A0A2K5CFB8_MCL1-02      ---------tag
                                    

© 1998-2022Legal notice