Dataset for CDS BCL-2-like of organism Aotus nancymaae

[Download (right click)] [Edit] [Sequences] [Repertoires]

14 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A2K5D2I1_BCL2A1-      --------------------------------------------at--ga
A0A2K5D2I1_BCL2A1-      --------------------------------------------at--ga
A0A2K5EBP4_BCL2L1-      atgtctcagagcaaccgggagctggtggttgactttctctcctaca--ag
A0A2K5EBP4_BCL2L1-      --------------------------------------------------
A0A2K5EB04_BCL2-01      --------------------------------------------atggcg
A0A2K5CWY6_BCL2L2-      ------------------------------------catctttcat--cc
A0A2K5CWY6_BCL2L2-      atgccccttctggttctctgtccatatattcatgccagtctttcat--cc
A0A2K5F974_BCL2L10      --------------------------------------------at--gg
A0A2K5DMS4_MCL1-01      --------------------------------------------at--gt
A0A2K5EPX0_MCL1-02      --------------------------------------------ag----
A0A2K5EPX0_MCL1-01      --------------------------------------------aatgcc
A0A2K5C7L5_MCL1-01      --------------------------------------------at--gt
A0A2K5CFH3_MCL1-01      --------------------------------------------at--gt
A0A2K5CFH3_MCL1-03      --------------------------------------------at--gt
                                                                          

A0A2K5D2I1_BCL2A1-      cagactgtgaatttg----------------------------gatatat
A0A2K5D2I1_BCL2A1-      cagactgtgaatttg----------------------------gatatat
A0A2K5EBP4_BCL2L1-      ctttcccagaaaggatacagctggagtcagtttagtgatgtggaagagaa
A0A2K5EBP4_BCL2L1-      -------------------------------------atgtggaagagaa
A0A2K5EB04_BCL2-01      cacgctgggagaacagggtacgataaccgagagatagtgatgaagtacat
A0A2K5CWY6_BCL2L2-      ttgcctcttatag--ccgcccggatggcg--------------accccag
A0A2K5CWY6_BCL2L2-      ttgcctcttatag--ccgcccggatggcg--------------accccag
A0A2K5F974_BCL2L10      ctgacccgc---------tgcggcag-cg--------------caccgag
A0A2K5DMS4_MCL1-01      ttggcttccaagt--------ggtaatca--------------gactcaa
A0A2K5EPX0_MCL1-02      -------ccagagttata---ataactta--------------aagataa
A0A2K5EPX0_MCL1-01      tcatgttccagacctgcatgcttttctt----------------------
A0A2K5C7L5_MCL1-01      ttggcctccaaag--aaacgcgctaatcg--------------gactcaa
A0A2K5CFH3_MCL1-01      ttggcctccaaag--aaacgcggtaatcg--------------gactcaa
A0A2K5CFH3_MCL1-03      ttggcctccaaag--aaacgcggtaatcg--------------gactcaa
                                                                          

A0A2K5D2I1_BCL2A1-      tcacaatct-------------------------------aactcaggac
A0A2K5D2I1_BCL2A1-      tcacaatct-------------------------------aactcaggac
A0A2K5EBP4_BCL2L1-      c---------------------------------------aggactgagg
A0A2K5EBP4_BCL2L1-      c---------------------------------------aggactgagg
A0A2K5EB04_BCL2-01      ccacta----------------------------------taagctgtcg
A0A2K5CWY6_BCL2L2-      cctcgg--------------------------------------------
A0A2K5CWY6_BCL2L2-      cctcgg--------------------------------------------
A0A2K5F974_BCL2L10      cggctggt----ggcggactacctggagtactgctcccaggagcctggca
A0A2K5DMS4_MCL1-01      cctctact------------------------------gcggtgccatcc
A0A2K5EPX0_MCL1-02      ccac----------atgcatgcttcgaaaac-------------------
A0A2K5EPX0_MCL1-01      cccc----------aggcatgcttcgaaaac-------------------
A0A2K5C7L5_MCL1-01      cctctactgtgagtgggccggcttggggactggcagtggcggcaccaccc
A0A2K5CFH3_MCL1-01      cctctactgtgggggggccggcttgggggccggcagcggcggcgccaccc
A0A2K5CFH3_MCL1-03      cctctactgtgggggggccggcttgggggccggcagcggcggcgccaccc
                                                                          

A0A2K5D2I1_BCL2A1-      tatctgcggtacgtcctgcagataccacaatctggaacgggtccaagcaa
A0A2K5D2I1_BCL2A1-      tatctgcggtacgtcctgcagataccacaatctggaacgggtccaagcaa
A0A2K5EBP4_BCL2L1-      ccccagaagggactgattcggagatggagacc-----cccagtgccatca
A0A2K5EBP4_BCL2L1-      ccccagaagggactgattcggagatggagacc-----cccagtgccatca
A0A2K5EB04_BCL2-01      cagaggggctacgagt--gggatgccggagatgtgggcgccgcaccccca
A0A2K5CWY6_BCL2L2-      ccccagacacacgggctctggtggcagactttgtaggttataagctg--a
A0A2K5CWY6_BCL2L2-      ccccagacacacgggctctggtggcagactttgtaggttataagctg--a
A0A2K5F974_BCL2L10      cccccgagtcgccgc---cgtccacgg---ccgaggccgctgtgctgcgc
A0A2K5DMS4_MCL1-01      ctccaggaccgcggcttttggcgactggcgccaaggac---acaaagcca
A0A2K5EPX0_MCL1-02      ------------------tggacatcaaaaacaaagac------------
A0A2K5EPX0_MCL1-01      ------------------tggacatcaaaaacaaagac------------
A0A2K5C7L5_MCL1-01      ctccgggagggcggcttttggccacggagaaggaggcctcggcccagcga
A0A2K5CFH3_MCL1-01      ctccgggagggcggcttttggccacggagaaggaggcctcggcccagcga
A0A2K5CFH3_MCL1-03      ctccgggagggcggcttttggccacggagaaggaggcctcggcccagcga
                                                                          

A0A2K5D2I1_BCL2A1-      aacgtc--------------------------------------------
A0A2K5D2I1_BCL2A1-      aacgtc--------------------------------------------
A0A2K5EBP4_BCL2L1-      atggcaacccatcctggcacctggcggacagccccgcggtgaatggagcc
A0A2K5EBP4_BCL2L1-      at------------------------------------------------
A0A2K5EB04_BCL2-01      ggggccgcccccgcgccgggcatcttctcctcccag--------------
A0A2K5CWY6_BCL2L2-      ggcagaagggttatgtctgtggagctggc--cccgg--------------
A0A2K5CWY6_BCL2L2-      ggcagaagggttatgtctgtggagctggc--cccgg--------------
A0A2K5F974_BCL2L10      gccat---------ggccgccggtgta--------c--------------
A0A2K5DMS4_MCL1-01      atgggcaggtctgaggccgccaac--agtaaggcgc--------------
A0A2K5EPX0_MCL1-02      --------------------------------------------------
A0A2K5EPX0_MCL1-01      --------------------------------------------------
A0A2K5C7L5_MCL1-01      gaggtagggggaggggaggccggcgtggtgattggc--------------
A0A2K5CFH3_MCL1-01      gaggtagggggaggggaggccggcgcggtgattggc--------------
A0A2K5CFH3_MCL1-03      gaggtagggggaggggaggccggcgcggtgattggc--------------
                                                                          

A0A2K5D2I1_BCL2A1-      --------------------cagggtgctacaaaaggttgcatt------
A0A2K5D2I1_BCL2A1-      --------------------cagggtgctacaaaaggttgcatt------
A0A2K5EBP4_BCL2L1-      acgggccacagcagcagtttggatgcccgggaggtgatccccatggcagc
A0A2K5EBP4_BCL2L1-      --------------------------------------------------
A0A2K5EB04_BCL2-01      --------------------cctggacacacgcccggtcccgccgcgccc
A0A2K5CWY6_BCL2L2-      --------------------ggagggcccagcagctgacccgctgcacca
A0A2K5CWY6_BCL2L2-      --------------------ggagggcccagcagctgacccgctgcacca
A0A2K5F974_BCL2L10      --------------------ggaaactctaccg---gtccttcttctccg
A0A2K5DMS4_MCL1-01      --------------------tggagaccttacga----------------
A0A2K5EPX0_MCL1-02      --------------------------------------------------
A0A2K5EPX0_MCL1-01      --------------------------------------------------
A0A2K5C7L5_MCL1-01      --------------------ggaagcgccggcgctagcccctcggccgcc
A0A2K5CFH3_MCL1-01      --------------------ggaagcgccggcgctagccccccggccgcc
A0A2K5CFH3_MCL1-03      --------------------ggaagcgccggcgctagccccccggccgcc
                                                                          

A0A2K5D2I1_BCL2A1-      ctcagtccaaaaagaagtggaaaagag-----------------------
A0A2K5D2I1_BCL2A1-      ctcagtccaaaaagaagtggaaaagag-----------------------
A0A2K5EBP4_BCL2L1-      agtaaagcaagcactgagggaggcggg-----------------------
A0A2K5EBP4_BCL2L1-      --------------------------------------------------
A0A2K5EB04_BCL2-01      cgggacccggtctccagg--------------------------------
A0A2K5CWY6_BCL2L2-      agcaatgcgggcagctggagatgagtt-----------------------
A0A2K5CWY6_BCL2L2-      agcaatgcgggcagctggagatgagtt-----------------------
A0A2K5F974_BCL2L10      cctacctcggctacccggggaaccgcg-----------------------
A0A2K5DMS4_MCL1-01      ---------ggggttggggaaggcgtg-----------------------
A0A2K5EPX0_MCL1-02      ---------gatgtcaaa--------------------------------
A0A2K5EPX0_MCL1-01      ---------gatgtcaaa--------------------------------
A0A2K5C7L5_MCL1-01      ctcacgcctgacgcccgg-gggtcgtgcggccgctgc-------------
A0A2K5CFH3_MCL1-01      ctcgtgcctgacgcccggagggtcgtgcggccgccgcccattggcgccga
A0A2K5CFH3_MCL1-03      ctcgtgcctgacgcccggagggtcgtgcggccgccgcccattggcgccga
                                                                          

A0A2K5D2I1_BCL2A1-      --------------------------------------tctgaagccatg
A0A2K5D2I1_BCL2A1-      --------------------------------------tctgaagccatg
A0A2K5EBP4_BCL2L1-      ------cgacgaatttgaactgcggtaccggcgggcatttagtgacctga
A0A2K5EBP4_BCL2L1-      --------------------------------------------------
A0A2K5EB04_BCL2-01      -------------acctcgccgccgccgcccccggccgcccccgccgccg
A0A2K5CWY6_BCL2L2-      ---------------cgagacccgcttccggcgcaccttctctgatctgg
A0A2K5CWY6_BCL2L2-      ---------------cgagacccgcttccggcgcaccttctctgatctgg
A0A2K5F974_BCL2L10      -----tcgagctggtggcgaggatggcggaggccctgctctccg------
A0A2K5DMS4_MCL1-01      ---------------------------------------ccccgcaacca
A0A2K5EPX0_MCL1-02      --------------------------------------tctttgt-----
A0A2K5EPX0_MCL1-01      --------------------------------------tctttgt-----
A0A2K5C7L5_MCL1-01      ----------------------------------tggttcttcgcgccca
A0A2K5CFH3_MCL1-01      ggtccccgacgtcaccgcgaccccctcgaggctgctgttcttcgcgccca
A0A2K5CFH3_MCL1-03      ggtccccgacgtcaccgcgaccccctcgaggctgctgttcttcgcgccca
                                                                          

A0A2K5D2I1_BCL2A1-      cttggacaatgttaatattgtgtccataga----taatgccagaatgata
A0A2K5D2I1_BCL2A1-      cttggacaatgttaatattgtgtccataga----taatgccagaatgata
A0A2K5EBP4_BCL2L1-      catcccagctccacatcacc--cccgggac-------agcgtatcagagc
A0A2K5EBP4_BCL2L1-      -------gctccacatcacc--cccgggac-------agcgtatcagagc
A0A2K5EB04_BCL2-01      ccgccacggggcctgcgctcagcccggtgccacctgtggtccacctgacc
A0A2K5CWY6_BCL2L2-      cggctcagctgcatgtg----accccaggc-----tcagcccaacaacgc
A0A2K5CWY6_BCL2L2-      cggctcagctgcatgtg----accccaggc-----tcagcccaacaacgc
A0A2K5F974_BCL2L10      -------acagtcccggccccacctggggcaacgtggtgatgctcctggc
A0A2K5DMS4_MCL1-01      cgagatggccttacaaggcatgcttcggaa-----tctggacaacaaaaa
A0A2K5EPX0_MCL1-02      ----------------------ctcgag---------tgatggtccatgt
A0A2K5EPX0_MCL1-01      ----------------------ctcgag---------tgatggtccatgt
A0A2K5C7L5_MCL1-01      c----ccgccgcgcggcgc-cgcttgagga-----gatggaagccccggc
A0A2K5CFH3_MCL1-01      c----ccgccgcgcggcgc-cgcttgagga-----gatggaagccccggc
A0A2K5CFH3_MCL1-03      c----ccgccgcgcggcgc-cgcttgagga-----gatggaagccccggc
                                                              *           

A0A2K5D2I1_BCL2A1-      ttcagtcaagtgatggaaaaggaatttga------------------aga
A0A2K5D2I1_BCL2A1-      ttcagtcaagtgatggaaaaggaatttga------------------aga
A0A2K5EBP4_BCL2L1-      tttgaacaggtagtgaacgaactcttccg---------------------
A0A2K5EBP4_BCL2L1-      tttgaacaggtagtgaacgaactcttccg---------------------
A0A2K5EB04_BCL2-01      ctccgccaggccggggacgacttctcccgccgctaccgccgcgacttcgc
A0A2K5CWY6_BCL2L2-      ttcacccaggtctccgatgaacttttcca---------------------
A0A2K5CWY6_BCL2L2-      ttcacccaggtctccgatgaacttttcca---------------------
A0A2K5F974_BCL2L10      cttcgcggggacgctgctaga-----------------------------
A0A2K5DMS4_MCL1-01      cgaa-----gacaatgtcaaatctttcta---------------------
A0A2K5EPX0_MCL1-02      tttc-----agcgacggcgta-----------------------------
A0A2K5EPX0_MCL1-01      tttc-----agcgacggcgta-----------------------------
A0A2K5C7L5_MCL1-01      cgcc-----gacgccatcatgtcgcccga---------------------
A0A2K5CFH3_MCL1-01      cgcc-----gacgccatcatgtcgcctga---------------------
A0A2K5CFH3_MCL1-03      cgcc-----gacgccatcatgtcgcctga---------------------
                                                                          

A0A2K5D2I1_BCL2A1-      tggcattattaactggggaagaattg------------------------
A0A2K5D2I1_BCL2A1-      tggcattattaactggggaagaattg------------------------
A0A2K5EBP4_BCL2L1-      ggatggggtaaactggggtcgcattg------------------------
A0A2K5EBP4_BCL2L1-      ggatggggtaaactggggtcgcattg------------------------
A0A2K5EB04_BCL2-01      cgagatgtccagccagctgcacctgacgcccttcaccgcgcggggacgct
A0A2K5CWY6_BCL2L2-      agggggccctaactggggccgccttg------------------------
A0A2K5CWY6_BCL2L2-      agggggccctaactggggccgccttg------------------------
A0A2K5F974_BCL2L10      -gagggggccgctggtgaccgcccgg--------tggaagaagtggggct
A0A2K5DMS4_MCL1-01      cggcgta----------acaaactgg------------------------
A0A2K5EPX0_MCL1-02      -----------------acaaactgg------------------------
A0A2K5EPX0_MCL1-01      -----------------acaaactgg------------------------
A0A2K5C7L5_MCL1-01      agaagagctggacaggtacgagccggagcctctcgggaagcggccggctg
A0A2K5CFH3_MCL1-01      agaagagctggacgggtacgagccggagcctctcgggaagcggccggctg
A0A2K5CFH3_MCL1-03      agaagagctggacgggtacgagccggagcctctcgggaagcggccggctg
                                                                          

A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2K5EBP4_BCL2L1-      --------------------------------------------------
A0A2K5EBP4_BCL2L1-      --------------------------------------------------
A0A2K5EB04_BCL2-01      ttgccacggtggtggaggagctc-----ttcagggacggggtgaactggg
A0A2K5CWY6_BCL2L2-      --------------------------------------------------
A0A2K5CWY6_BCL2L2-      --------------------------------------------------
A0A2K5F974_BCL2L10      tccagtcgcggctgaaggagccgga-------------------------
A0A2K5DMS4_MCL1-01      --------------------------------ggta--------------
A0A2K5EPX0_MCL1-02      --------------------------------ggta--------------
A0A2K5EPX0_MCL1-01      --------------------------------ggta--------------
A0A2K5C7L5_MCL1-01      tcctgcccctgctggagttggtggaggagcctggtaatgactccagtacg
A0A2K5CFH3_MCL1-01      tcctgcccctgctggagttggtcggggagcctggtaatggctccagtacg
A0A2K5CFH3_MCL1-03      tcctgcccctgctggagttggtcggggagcctggtaatggctccagtacg
                                                                          

A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2K5EBP4_BCL2L1-      --------------------------------------------------
A0A2K5EBP4_BCL2L1-      --------------------------------------------------
A0A2K5EB04_BCL2-01      ggaggattg-----------------------------------------
A0A2K5CWY6_BCL2L2-      --------------------------------------------------
A0A2K5CWY6_BCL2L2-      --------------------------------------------------
A0A2K5F974_BCL2L10      ---gggcgacgtcgcccgggactgc-------------------------
A0A2K5DMS4_MCL1-01      ---ggattgtgactctca--------------------------------
A0A2K5EPX0_MCL1-02      ---ggatcgtgactctca--------------------------------
A0A2K5EPX0_MCL1-01      ---ggatcgtgactctca--------------------------------
A0A2K5C7L5_MCL1-01      gatgggtcactaccctcgacgccgccgaca--------------------
A0A2K5CFH3_MCL1-01      gacgggtcactaccctcgacgccgcctccagcggaggaggaggaggacga
A0A2K5CFH3_MCL1-03      gacgggtcactaccctcgacgccgcctccagcggaggaggaggaggacga
                                                                          

A0A2K5D2I1_BCL2A1-      ------------------------taaccatatttgcatttgaaggtatt
A0A2K5D2I1_BCL2A1-      ------------------------taaccatatttgcatttgaaggtatt
A0A2K5EBP4_BCL2L1-      ------------------------tggcctttttctccttcggcgg----
A0A2K5EBP4_BCL2L1-      ------------------------tggcctttttctccttcggcgg----
A0A2K5EB04_BCL2-01      ------------------------tggccttctttgagttcggtgg----
A0A2K5CWY6_BCL2L2-      ------------------------tagccttctttgtctttg--gg----
A0A2K5CWY6_BCL2L2-      ------------------------tagccttctttgtctttg--gg----
A0A2K5F974_BCL2L10      ------------------------cagcgcctggtggccttgctga----
A0A2K5DMS4_MCL1-01      ------------------------gttcttttggtgcctttg-tgg----
A0A2K5EPX0_MCL1-02      ------------------------tttcttttggtgcctttg-tgg----
A0A2K5EPX0_MCL1-01      ------------------------tttcttttggtgcctttg-tgg----
A0A2K5C7L5_MCL1-01      -------------tcactggagattatctctcggtaccttcg-gga----
A0A2K5CFH3_MCL1-01      gttgtaccggcagtcgctggagattatctctcggtaccttcg-gga----
A0A2K5CFH3_MCL1-03      gttgtaccggcagtcgctggagattatctctcggtaccttcg-gga----
                                                   *           * *  *     

A0A2K5D2I1_BCL2A1-      ctcatcaagaaacttctac-gagagcgaattgccccgg-------atgtg
A0A2K5D2I1_BCL2A1-      ctcatcaagaaacttctac-gagagcgaattgccccgg-------atgtg
A0A2K5EBP4_BCL2L1-      ----g---gcactgtgcgtggaaagcgtaga--caaggag-----atgca
A0A2K5EBP4_BCL2L1-      ----g---gcactgtgcgtggaaagcgtaga--caaggag-----atgca
A0A2K5EB04_BCL2-01      ----g---gtcatgtgtgtggagagcgtcaa--ccgggag-----atgtc
A0A2K5CWY6_BCL2L2-      ----gct-gcactgtgtgctgagagtgtcaa--caaggag-----atgga
A0A2K5CWY6_BCL2L2-      ----gct-gcactgtgtgctgagagtgtcaa--caaggag-----atgga
A0A2K5F974_BCL2L10      ----gctcgcggctcgtgg-ggcagcaccgtgcctggctggaggctcagg
A0A2K5DMS4_MCL1-01      ----ccaaacacttg-----aagaccataaa-ccaagaaagttgcatcga
A0A2K5EPX0_MCL1-02      ----ccaaacacttg-----aagaccataaa-ccaagaaagctgcattga
A0A2K5EPX0_MCL1-01      ----ccaaacacttg-----aagaccataaa-ccaagaaagctgcattga
A0A2K5C7L5_MCL1-01      ----acaggcgactggcgccaaggacacaaagccaatggacaggtccggg
A0A2K5CFH3_MCL1-01      ----gcaggcgaccggcgccaaggacacaaagccaatgggcaggtccggg
A0A2K5CFH3_MCL1-03      ----gcaggcgaccggcgccaaggacacaaagccaatgggcaggtccggg
                                                         *                

A0A2K5D2I1_BCL2A1-      gatacttacaaggagatttcgtattttgttgctga-gttcataatgaata
A0A2K5D2I1_BCL2A1-      gatacttacaaggagatttcgtattttgttgctga-gttcataatgaata
A0A2K5EBP4_BCL2L1-      ggtattggtgagtcggatcgcagcttggatggccacttacctgaatgacc
A0A2K5EBP4_BCL2L1-      ggtattggtgagtcggatcgcagcttggatggccacttacctgaatgacc
A0A2K5EB04_BCL2-01      gcccctggtggacaacatcgcgctgtggatgaccgagtacctgaaccggc
A0A2K5CWY6_BCL2L2-      accactggtgggacaagtgcaggagtggatggtggcctacctggagacgc
A0A2K5CWY6_BCL2L2-      accactggtgggacaagtgcaggagtggatggtggcctacctggagacgc
A0A2K5F974_BCL2L10      gcggctgggtgagca--tgcggagggggacacgggcctcccgagtagctg
A0A2K5DMS4_MCL1-01      accatt-----agca------gaaagtatcagatattctc----------
A0A2K5EPX0_MCL1-02      accatt-----agca------gaaagtattacagacgttct---------
A0A2K5EPX0_MCL1-01      accatt-----agca------gaaagtattacagacgttct---------
A0A2K5C7L5_MCL1-01      gccgcc-----agca-----ggaaggctctggagaccttacgacgggttg
A0A2K5CFH3_MCL1-01      gccgcc-----agca-----ggaaggcgctggagaccttacgacgggttg
A0A2K5CFH3_MCL1-03      gccgcc-----agca-----ggaaggcgctggagaccttacgacgggttg
                                                                          

A0A2K5D2I1_BCL2A1-      acacaggagaatggataagtcaaaacggag--------------------
A0A2K5D2I1_BCL2A1-      acacaggagaatggataagtcaaaacggag--------------------
A0A2K5EBP4_BCL2L1-      acctagagccttggatccaggagaacggcg--------------------
A0A2K5EBP4_BCL2L1-      acctagagccttggatccaggagaacggcg--------------------
A0A2K5EB04_BCL2-01      acctgcacacctggatccaggataacggag--------------------
A0A2K5CWY6_BCL2L2-      ggctggccgactggatccacagcagtgggg--------------------
A0A2K5CWY6_BCL2L2-      ggctggccgactggatccacagcagtgggg--------------------
A0A2K5F974_BCL2L10      ggaata--------------------------------------------
A0A2K5DMS4_MCL1-01      --------------------------------------------------
A0A2K5EPX0_MCL1-02      --------------cgtaaggacaaaacgg--------------------
A0A2K5EPX0_MCL1-01      --------------cgtaaggacaaaacgg--------------------
A0A2K5C7L5_MCL1-01      gggacggcgtgcagcgcaaccacgagacggccttccaa------------
A0A2K5CFH3_MCL1-01      gggacggcgtgcagcgcaaccacgagacggccttccaaggcatgcttcgg
A0A2K5CFH3_MCL1-03      gggacggcgtgcagcgcaaccacgagacggccttccaa------------
                                                                          

A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2K5EBP4_BCL2L1-      --------------------------------------------------
A0A2K5EBP4_BCL2L1-      --------------------------------------------------
A0A2K5EB04_BCL2-01      --------------------------------------------------
A0A2K5CWY6_BCL2L2-      --------------------------------------------------
A0A2K5CWY6_BCL2L2-      --------------------------------------------------
A0A2K5F974_BCL2L10      --------------------------------------------------
A0A2K5DMS4_MCL1-01      --------------------------------------------------
A0A2K5EPX0_MCL1-02      --------------------------------------------------
A0A2K5EPX0_MCL1-01      --------------------------------------------------
A0A2K5C7L5_MCL1-01      --------------------------------------------------
A0A2K5CFH3_MCL1-01      aaactggacatcaaaaacgaagacgatgtcaaatctttgtctcgagtgat
A0A2K5CFH3_MCL1-03      --------------------------------------------------
                                                                          

A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2K5EBP4_BCL2L1-      --------------------------------------------------
A0A2K5EBP4_BCL2L1-      --------------------------------------------------
A0A2K5EB04_BCL2-01      --------------------------------------------------
A0A2K5CWY6_BCL2L2-      --------------------------------------------------
A0A2K5CWY6_BCL2L2-      --------------------------------------------------
A0A2K5F974_BCL2L10      --------------------------------------------------
A0A2K5DMS4_MCL1-01      --------------------------------------------------
A0A2K5EPX0_MCL1-02      --------------------------------------------------
A0A2K5EPX0_MCL1-01      --------------------------------------------------
A0A2K5C7L5_MCL1-01      --------------------------------------------------
A0A2K5CFH3_MCL1-01      ggtccatgttttcagcgacggcgtaacaaactggggtaggattgtgactc
A0A2K5CFH3_MCL1-03      --------------------------------------------------
                                                                          

A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2K5EBP4_BCL2L1-      --------------------------------------------------
A0A2K5EBP4_BCL2L1-      --------------------------------------------------
A0A2K5EB04_BCL2-01      --------------------------------------------------
A0A2K5CWY6_BCL2L2-      --------------------------------------------------
A0A2K5CWY6_BCL2L2-      --------------------------------------------------
A0A2K5F974_BCL2L10      --------------------------------------------------
A0A2K5DMS4_MCL1-01      --------------------------------------------------
A0A2K5EPX0_MCL1-02      --------------------------------------------------
A0A2K5EPX0_MCL1-01      --------------------------------------------------
A0A2K5C7L5_MCL1-01      --------------------------------------------------
A0A2K5CFH3_MCL1-01      tcatttcttttggtgcctttgtggccaaacacttgaagaccataaaccaa
A0A2K5CFH3_MCL1-03      --------------------------------------------------
                                                                          

A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2K5EBP4_BCL2L1-      --------------------------------------------------
A0A2K5EBP4_BCL2L1-      --------------------------------------------------
A0A2K5EB04_BCL2-01      --------------------------------------------------
A0A2K5CWY6_BCL2L2-      --------------------------------------------------
A0A2K5CWY6_BCL2L2-      --------------------------------------------------
A0A2K5F974_BCL2L10      --------------------------------------------------
A0A2K5DMS4_MCL1-01      --------------------------------------------------
A0A2K5EPX0_MCL1-02      --------------------------------------------------
A0A2K5EPX0_MCL1-01      --------------------------------------------------
A0A2K5C7L5_MCL1-01      --------------------------------------------------
A0A2K5CFH3_MCL1-01      gaaagctgcattgaaccattagcagaaagtatcacagacgttctcgtaag
A0A2K5CFH3_MCL1-03      --------------------------------------------------
                                                                          

A0A2K5D2I1_BCL2A1-      --------------------------------gctggg-aaaatggcttt
A0A2K5D2I1_BCL2A1-      --------------------------------gctgggcgaaatggc---
A0A2K5EBP4_BCL2L1-      --------------------------------gctggg----acactttt
A0A2K5EBP4_BCL2L1-      --------------------------------gctggg----acactttt
A0A2K5EB04_BCL2-01      --------------------------------gctggg----atgccttt
A0A2K5CWY6_BCL2L2-      --------------------------------gctggg----cggagttc
A0A2K5CWY6_BCL2L2-      --------------------------------gctggg----cggagttc
A0A2K5F974_BCL2L10      ----------------------------------tagg----atggcttt
A0A2K5DMS4_MCL1-01      --------------------------------gctggg----atgggttt
A0A2K5EPX0_MCL1-02      ----------gactggctagttaaacaaagaggctggg----atgggttt
A0A2K5EPX0_MCL1-01      ----------gactggctagttaaacaaagaggctggg----atgggttt
A0A2K5C7L5_MCL1-01      --------------------------------------------------
A0A2K5CFH3_MCL1-01      gacaaaacgggactggctagttaaacaaagaggctggg----atgggttt
A0A2K5CFH3_MCL1-03      ------------------------------------gg----atgggttt
                                                                          

A0A2K5D2I1_BCL2A1-      gtaaagaagtttgaacctaaatctggctggatgacttttctagaag----
A0A2K5D2I1_BCL2A1-      -----acagtctcctgcttgtgctggtggagtcagtggcccagaag----
A0A2K5EBP4_BCL2L1-      gtggaactctatggaaacaatgcggcagccgagag---ccgaaagggcca
A0A2K5EBP4_BCL2L1-      gtggaactctatggaaacaatgcggcagccgagag---ccgaaagggcca
A0A2K5EB04_BCL2-01      gtggaactgtat--------------------ggc---cccagcatg---
A0A2K5CWY6_BCL2L2-      acagctctatacgg------------ggacggggc---cctggaggaggc
A0A2K5CWY6_BCL2L2-      acagctctatacgg------------ggacggggc---cctggaggaggc
A0A2K5F974_BCL2L10      tgttacttcttc-------------------aggacctcctcctcgc---
A0A2K5DMS4_MCL1-01      gtggagttcttccg------------tgtagagga---cttagaagg---
A0A2K5EPX0_MCL1-02      gtggagttcttcca------------tgtagagga---cctagaagg---
A0A2K5EPX0_MCL1-01      gtggagttcttcca------------tgtagagga---cctagaagg---
A0A2K5C7L5_MCL1-01      -----gttcttcca------------tgtagaaga---cctagaagg---
A0A2K5CFH3_MCL1-01      gtggagttcttcca------------tgtagagga---cctagaagg---
A0A2K5CFH3_MCL1-03      gtggagttcttcca------------tgtagagga---cctagaagg---
                                 *                                        

A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2K5D2I1_BCL2A1-      --------------------------------------------------
A0A2K5EBP4_BCL2L1-      gga--------------------gcgcttca--------accgctggttc
A0A2K5EBP4_BCL2L1-      gga--------------------gcgcttca--------accgctggttc
A0A2K5EB04_BCL2-01      -----------------------cggcctctgtttgatttctcctggctg
A0A2K5CWY6_BCL2L2-      gcggcgtctgcgggaggggaactgggcatcagtgaggacagtgctga---
A0A2K5CWY6_BCL2L2-      gcggcgtctgcgggaggggaactgggcatcagtgaggacagtgctga---
A0A2K5F974_BCL2L10      -----------------------tggcattatggagaaaactgctggtc-
A0A2K5DMS4_MCL1-01      -----------------------tggcatca-gaaatgggctgctggctt
A0A2K5EPX0_MCL1-02      -----------------------tggcatca-gaaatgtgctgctggctt
A0A2K5EPX0_MCL1-01      -----------------------tggcatca-gaaatgtgctgctggctt
A0A2K5C7L5_MCL1-01      -----------------------tggcatca-gaaatgtgctgctggctt
A0A2K5CFH3_MCL1-01      -----------------------tggcatca-gaaatgtgctgctggctt
A0A2K5CFH3_MCL1-03      -----------------------tggcatca-gaaatgtgctgctggctt
                                                                          

A0A2K5D2I1_BCL2A1-      ----------------------------ttacaggaaa------------
A0A2K5D2I1_BCL2A1-      ----------------------------gagaggaaaa------------
A0A2K5EBP4_BCL2L1-      ctgac--gggcatgactg----------tggccggcg-------------
A0A2K5EBP4_BCL2L1-      ctgac--gggcatgactg----------tggccggcg-------------
A0A2K5EB04_BCL2-01      tctctgaagactctgctcagcttggccctggtgggagc------------
A0A2K5CWY6_BCL2L2-      ---c---aggggccgtgg----------cactgggggc------------
A0A2K5CWY6_BCL2L2-      ---c---aggggccgtgg----------cactgggggc------------
A0A2K5F974_BCL2L10      ---c---aggttttcctgtcatggttgttaacagcagcattcatctactt
A0A2K5DMS4_MCL1-01      tcgc---aggtgttgctg----------gagtaggaac------------
A0A2K5EPX0_MCL1-02      ttgc---atgtgttgctg----------gagtaggagc------------
A0A2K5EPX0_MCL1-01      ttgc---atgtgttgctg----------gagtaggagc------------
A0A2K5C7L5_MCL1-01      ttgc---aggtgttgctg----------gagtaggagc------------
A0A2K5CFH3_MCL1-01      ttgc---aggtgttgctg----------gagtaggagc------------
A0A2K5CFH3_MCL1-03      ttgc---aggtgttgctg----------gagtaggagc------------
                                                         *                

A0A2K5D2I1_BCL2A1-      ----------gatctgcgaaatgctatctctcttgaagcaatactattga
A0A2K5D2I1_BCL2A1-      ----------tggctttgtaa-----------------------------
A0A2K5EBP4_BCL2L1-      ----------tggttctgctgggctcactctttagtcggaaatga-----
A0A2K5EBP4_BCL2L1-      ----------tggttctgctgggctcactctttagtcggaaatga-----
A0A2K5EB04_BCL2-01      -----ttgcatcaccctgggtg---cctatctgggccacaagtga-----
A0A2K5CWY6_BCL2L2-      -----cctggtaactgtagggg---ccttttttgctagcaagtga-----
A0A2K5CWY6_BCL2L2-      -----cctggtaactgtagggg---ccttttttgctagcaagtga-----
A0A2K5F974_BCL2L10      ctggacacgataatt----agg---agtttttaa----------------
A0A2K5DMS4_MCL1-01      ----------tgatt----tgg---catatctaataagatag--------
A0A2K5EPX0_MCL1-02      ----------tggtt----tgg---catatctaataagatag--------
A0A2K5EPX0_MCL1-01      ----------tggtt----tgg---catatctaataagatag--------
A0A2K5C7L5_MCL1-01      ----------tggtt----tgg---catatctaataagatagccttgtaa
A0A2K5CFH3_MCL1-01      ----------tggtt----tgg---cactgtctcttataca--catctag
A0A2K5CFH3_MCL1-03      ----------tggtt----tgg---c------------------------
                                                                          

© 1998-2020Legal notice