Dataset for CDS BCL2L10 of organism Nothobranchius furzeri

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A1A8VCB0_BCL2L10      atgggcggagggctaaatgcgcagaagggaagcggtgattgccccgaggt
A0A1A8VCB0_BCL2L10      --------------------------------------------------
                                                                          

A0A1A8VCB0_BCL2L10      tctccttccgccgtctggatgtggcgagagctgtcacctaccgctgggag
A0A1A8VCB0_BCL2L10      ------------------atgtggcgagagctgtcacctaccgctgggag
                                          ********************************

A0A1A8VCB0_BCL2L10      gagaacatgggaccagtgatcgggccagcatgtctacgtccggaccatgg
A0A1A8VCB0_BCL2L10      g-------------------------------------------------
                        *                                                 

A0A1A8VCB0_BCL2L10      gtccctaccaggggcgtggctagcctctcttacagcaaaatgtcctgtgg
A0A1A8VCB0_BCL2L10      ------------------------------------aaaatgtcctgtgg
                                                            **************

A0A1A8VCB0_BCL2L10      gctgtggaatgatactctggctgtggccgaggattacctgtccacgtgct
A0A1A8VCB0_BCL2L10      gctgtggaatgatactctggctgtggccgaggattacctgtccacgtgct
                        **************************************************

A0A1A8VCB0_BCL2L10      gctgcggcccaaatccagcccctccacctcccagcgagacagccgctgcc
A0A1A8VCB0_BCL2L10      gctgcggcccaaatccagcccctccacctcccagcgagacagccgctgcc
                        **************************************************

A0A1A8VCB0_BCL2L10      atgaggcgtctggcccaggatatggagacccagcaccagacccgtttcca
A0A1A8VCB0_BCL2L10      atgaggcgtctggcccaggatatggagacccagcaccagacccgtttcca
                        **************************************************

A0A1A8VCB0_BCL2L10      ctctctggctcagaacttcctgaagcgctgcgggccagacatctgctcta
A0A1A8VCB0_BCL2L10      ctctctggctcagaacttcctgaagcgctgcgggccagacatctgctcta
                        **************************************************

A0A1A8VCB0_BCL2L10      gcctcaggaaggtgatggacgagatggctggagacggacactttaactgg
A0A1A8VCB0_BCL2L10      gcctcaggaaggtgatggacgagatggctggagacggacactttaactgg
                        **************************************************

A0A1A8VCB0_BCL2L10      gggcgggttgtgtccctctttgcttttactggggtgctgatcagacagct
A0A1A8VCB0_BCL2L10      gggcgggttgtgtccctctttgcttttactggggtgctgatcagacagct
                        **************************************************

A0A1A8VCB0_BCL2L10      gcaggagcagaggacctccagaccggggctggaccctgggcaagagctgg
A0A1A8VCB0_BCL2L10      gcaggagcagaggacctccagaccggggctggaccctgggcaagagctgg
                        **************************************************

A0A1A8VCB0_BCL2L10      aaccgaagctcatcagctgtcggttgctggcggagaccatagctgattac
A0A1A8VCB0_BCL2L10      aaccgaagctcatcagctgtcggttgctggcggagaccatagctgattac
                        **************************************************

A0A1A8VCB0_BCL2L10      ctggtgaagcacaagaaaggctggctgttggagaatgaaggatgggaagg
A0A1A8VCB0_BCL2L10      ctggtgaagcacaagaaaggctggctgttggagaatgaaggatgggaagg
                        **************************************************

A0A1A8VCB0_BCL2L10      cttcagccagtactcccacaacaccagaccagtaagtctggactcctcca
A0A1A8VCB0_BCL2L10      cttcagccagtactcccacaacaccagaccagtaagtctggactcctcca
                        **************************************************

A0A1A8VCB0_BCL2L10      tgaagacagcgctggttgctgttgctggagttggcctggctgggctaacc
A0A1A8VCB0_BCL2L10      tgaagacagcgctggttgctgttgctggagttggcctggctgggctaacc
                        **************************************************

A0A1A8VCB0_BCL2L10      tttctcctggtgcgctag
A0A1A8VCB0_BCL2L10      tttctcctggtgcgctag
                        ******************

© 1998-2021Legal notice