Dataset for CDS BCL-2-like of organism Amphiprion ocellaris

[Download (right click)] [Edit] [Sequences] [Repertoires]

8 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A3Q1B8C3_BCL2-01      atg--------gcgaacgagtgtaatcgcaatattgtagaaaag------
A0A3Q1D2L0_BCL2L10      atg--------tcctgtgggctatg------------gaaagagaccttg
A0A3Q1DHJ3_BCL2L1-      atg--------tctca---gaacag------------agaactggtggtt
A0A3Q1DHJ3_BCL2L1-      atg--------tctca---gaacag------------agaactggtggtt
A0A3Q1DHJ3_BCL2L1-      atg--------tctca---gaacag------------agaactggtggtt
A0A3Q1BQA0_BCL2L1-      atg--------tcgtacagtaacag------------agagctggtggag
A0A3Q1BKL8_MCL1-01      atgaatatgattccgacgacgacga------------agag--gacggcg
A0A3Q1BKL8_MCL1-02      atgaatatgattccgacgacgacga------------agag--gacggcg
                        ***         *                          *   *      

A0A3Q1B8C3_BCL2-01      ----------------tatatctgccataaactctccaaacggggct--a
A0A3Q1D2L0_BCL2L10      gtc-------------ctggcagaggactacctgtccctg----------
A0A3Q1DHJ3_BCL2L1-      ttc-------------tacataaagtataaactctcccagagaaact---
A0A3Q1DHJ3_BCL2L1-      ttc-------------tacataaagtataaactctcccagagaaact---
A0A3Q1DHJ3_BCL2L1-      ttc-------------tacataaagtataaactctcccagagaaact---
A0A3Q1BQA0_BCL2L1-      ttc-------------tttgtaagcgacaagctgtctcaaaggaact---
A0A3Q1BKL8_MCL1-01      ttcatgaactacttaatttttcctcaaaatggagtcgtggagggaccgat
A0A3Q1BKL8_MCL1-02      ttcatgaactacttaatttttcctcaaaatggagtcgtggagggaccgat
                                                  *       **              

A0A3Q1B8C3_BCL2-01      cgtgtgggggtttgatgatgtccgggatgaagatgctg------------
A0A3Q1D2L0_BCL2L10      ---------------------------------tgctgtg----------
A0A3Q1DHJ3_BCL2L1-      ---------atcc------cctcaaccacatggtgctgaa----------
A0A3Q1DHJ3_BCL2L1-      ---------atcc------cctcaaccacatggtgctgaa----------
A0A3Q1DHJ3_BCL2L1-      ---------atcc------cctcaaccacatggtgctgaa----------
A0A3Q1BQA0_BCL2L1-      ---------atccgacgtctc------------tgctgaggcc-------
A0A3Q1BKL8_MCL1-01      gcactatggatccggagattcctccccgcagattgccgtggcctcctcca
A0A3Q1BKL8_MCL1-02      gcactatggatccggagattcctccccgcagattgccgtggcctcctcca
                                                         *** *            

A0A3Q1B8C3_BCL2-01      ------ctaataacgggtcagtag--------tggaccctccgccgactt
A0A3Q1D2L0_BCL2L10      --------------------------------------------------
A0A3Q1DHJ3_BCL2L1-      -tgaggctcccagcaggactgacg-----ggggggaggcccggctgggag
A0A3Q1DHJ3_BCL2L1-      -tgaggctcccagcaggactgacg-----ggggggaggcccggctgggag
A0A3Q1DHJ3_BCL2L1-      -tgaggctcccagcaggactgacg-----ggggggaggcccggctgggag
A0A3Q1BQA0_BCL2L1-      -------------agaggatgctg-------------------------g
A0A3Q1BKL8_MCL1-01      tagactctcacaacgggaatgttggctccaatgaaaccccaaaacggccg
A0A3Q1BKL8_MCL1-02      tagactctcacaacgggaatgttggctccaatgaaaccccaaaacggccg

A0A3Q1B8C3_BCL2-01      tggtccgtcggtgccatgaagccagcaccgggcccgacaacgagagcgac
A0A3Q1D2L0_BCL2L10      ----------------------------c-------------aagcccac
A0A3Q1DHJ3_BCL2L1-      aggaacagcggacaga---gacacacgcc-------------aacgggac
A0A3Q1DHJ3_BCL2L1-      aggaacagcggacaga---gacacacgcc-------------aacgggac
A0A3Q1DHJ3_BCL2L1-      aggaacagcggacaga---gacacacgcc-------------aacgggac
A0A3Q1BQA0_BCL2L1-      aggaa----ggactgatggggacaaggcc-------------aactcagc
A0A3Q1BKL8_MCL1-01      aagaacctgggagtgaatgggtatgcgtc-------------aaaaaacc
A0A3Q1BKL8_MCL1-02      aagaacctgggagtgaatgggtatgcgtc-------------aaaaaacc
                                                    *             *      *

A0A3Q1B8C3_BCL2-01      ccc-------------cacctctgcagacggctcccccagtccgacccgc
A0A3Q1D2L0_BCL2L10      atc------------------------aagcccctccacc---tcccagc
A0A3Q1DHJ3_BCL2L1-      ttt-------taacggcacgagtcccgggacccccccgccgtccccgcgg
A0A3Q1DHJ3_BCL2L1-      ttt-------taacggcacgagtcccgggacccccccgccgtccccgcgg
A0A3Q1DHJ3_BCL2L1-      ttt-------taacggcacgagtcccgggacccccccgccgtccccgcgg
A0A3Q1BQA0_BCL2L1-      ttc-------------cagta------atggcttgctg--gtgaacagca
A0A3Q1BKL8_MCL1-01      ttcgacaagacagcgacagtatggaggagggctctttaccgtgcaccccg
A0A3Q1BKL8_MCL1-02      ttcgacaagacagcgacagtatggaggagggctctttaccgtgcaccccg
                                                       *             *    

A0A3Q1B8C3_BCL2-01      acgctgccatccacagagtcctgcgggaggctggagatgaacttgaaaga
A0A3Q1D2L0_BCL2L10      gagtcagcg---------------gctgccatgaggcgtctggcccagga
A0A3Q1DHJ3_BCL2L1-      cggctggcgtcgacggcgaccatggacgcggtgaaggaggccctccggga
A0A3Q1DHJ3_BCL2L1-      cggctggcgtcgacggcgaccatggacgcggtgaaggaggccctccggga
A0A3Q1DHJ3_BCL2L1-      cggctggcgtcgacggcgaccatggacgcggtgaaggaggccctccggga
A0A3Q1BQA0_BCL2L1-      gaggtggcata-------------gaggctgtaaaatccgcacttaagga
A0A3Q1BKL8_MCL1-01      gagctgcagtc-------------g-gacagtgaaaccgacgtctccagt
A0A3Q1BKL8_MCL1-02      gagctgcagtc-------------g-gacagtgaaaccgacgtctccagt
                          *                     *      *                * 

A0A3Q1B8C3_BCL2-01      c----------tgtaccagcc-----------------------------
A0A3Q1D2L0_BCL2L10      catggagaagcagcaccaggc-----------------------------
A0A3Q1DHJ3_BCL2L1-      c-----acggcca-acgagtt---------cg---------agctgcg--
A0A3Q1DHJ3_BCL2L1-      c-----acggcca-acgagtt---------cg---------agctgcg--
A0A3Q1DHJ3_BCL2L1-      c-----acggcca-acgagtt---------cg---------agctgcg--
A0A3Q1BQA0_BCL2L1-      c-----gcggcag-atgagtt---------tg---------aacttct--
A0A3Q1BKL8_MCL1-01      tgtccagcaggag-acgagttgctggagaatgacacgaggcaactccttc
A0A3Q1BKL8_MCL1-02      tgtccagcaggag-acgagttgctggagaatgacacgaggcaactccttc
                                      *  **                               

A0A3Q1B8C3_BCL2-01      -------------ggacttcacggagatgt------ccaggc------ag
A0A3Q1D2L0_BCL2L10      ----tcgcttccactccctcactcagacct---tcctgaggcagtgcggg
A0A3Q1DHJ3_BCL2L1-      ----gtacgcccgcgccttcagc--gacctg----cacagcc------ag
A0A3Q1DHJ3_BCL2L1-      ----gtacgcccgcgccttcagc--gacctg----cacagcc------ag
A0A3Q1DHJ3_BCL2L1-      ----gtacgcccgcgccttcagc--gacctg----cacagcc------ag
A0A3Q1BQA0_BCL2L1-      ----cttcacgcaggcttttagt--gatctgtcttcacagct--------
A0A3Q1BKL8_MCL1-01      gccgtttcttaagagactttact--ggact---ttcaaagccccggtgga
A0A3Q1BKL8_MCL1-02      gccgtttcttaagagactttact--ggact---ttcaaagccccggtgga
                                          * *    *   *        **          

A0A3Q1B8C3_BCL2-01      ctgta----------tctcacctccacca-------------------cg
A0A3Q1D2L0_BCL2L10      ccgga----------cct--------------------------------
A0A3Q1DHJ3_BCL2L1-      ctgca----------catcacgcccgcca-------------------cc
A0A3Q1DHJ3_BCL2L1-      ctgca----------catcacgcccgcca-------------------cc
A0A3Q1DHJ3_BCL2L1-      ctgca----------catcacgcccgcca-------------------cc
A0A3Q1BQA0_BCL2L1-      -tga-----------catcacccctgaaa-------------------cg
A0A3Q1BKL8_MCL1-01      atgaaagcaaagcattatcaacaatgaaaagagttgtggatgacgttttg
A0A3Q1BKL8_MCL1-02      atgaaagcaaagcattatcaacaatgaaaagagttgtggatgacgttttg
                          *              *                                

A0A3Q1B8C3_BCL2-01      gcgcagaggag------attcgccgaggtgatagacgaactgttccggga
A0A3Q1D2L0_BCL2L10      --ctgctccag------cctcaggaaggtgatggaggagctggtgggaga
A0A3Q1DHJ3_BCL2L1-      gcctaccagag------cttcgagaacgtgatggacgaggtgttccggga
A0A3Q1DHJ3_BCL2L1-      gcctaccagag------cttcgagaacgtgatggacgaggtgttccggga
A0A3Q1DHJ3_BCL2L1-      gcctaccagag------cttcgagaacgtgatggacgaggtgttccggga
A0A3Q1BQA0_BCL2L1-      gcctaccacag------ctttaagagtgtgatggacgaggtgttcaagga
A0A3Q1BKL8_MCL1-01      gacaaacacagatacgcatacaatggtatgatcaacaaactgtcgctgga
A0A3Q1BKL8_MCL1-02      gacaaacacagatacgcatacaatggtatgatcaacaaactgtcgctgga
                                 **                 ****  *  *  **      **

A0A3Q1B8C3_BCL2-01      cgg-----------------------------------------------
A0A3Q1D2L0_BCL2L10      tgg-----------------------------------------------
A0A3Q1DHJ3_BCL2L1-      cgg-----------------------------------------------
A0A3Q1DHJ3_BCL2L1-      cgg-----------------------------------------------
A0A3Q1DHJ3_BCL2L1-      cgg-----------------------------------------------
A0A3Q1BQA0_BCL2L1-      tgg-----------------------------------------------
A0A3Q1BKL8_MCL1-01      tgacagaggggatgatgtgtcgtttgtcagtgcagtagctaagagcctct
A0A3Q1BKL8_MCL1-02      tgacagaggggatgatgtgtcgtttgtcagtgcagtagctaagagcctct

A0A3Q1B8C3_BCL2-01      -------------ggtgaactggggccggattatcgctttcttcgagttc
A0A3Q1D2L0_BCL2L10      ----------acacttgaactgggggagggttgtttcccttttcaccttt
A0A3Q1DHJ3_BCL2L1-      -------------cgtcaactggggccgcatcgtggggctgttcgcgttc
A0A3Q1DHJ3_BCL2L1-      -------------cgtcaactggggccgcatcgtggggctgttcgcgttc
A0A3Q1DHJ3_BCL2L1-      -------------cgtcaactggggccgcatcgtggggctgttcgcgttc
A0A3Q1BQA0_BCL2L1-      -------------ggtcaactggggacgtatagtgggcctgttttgcttt
A0A3Q1BKL8_MCL1-01      ttgcagacaggacgaccaactggggtcgtattacgagcctggtggccttt
A0A3Q1BKL8_MCL1-02      ttgcagacaggacgaccaactggggtcgtattacgagcctggtggccttt
                                         ********  *  *        *  *    ** 

A0A3Q1B8C3_BCL2-01      ggggggacggtgtgcgtcgagtgcgcggccaaagaggagatgacatcgca
A0A3Q1D2L0_BCL2L10      actggggtgctggccagacagctgctgg---agcagaaggacacaaagct
A0A3Q1DHJ3_BCL2L1-      ggcggggcgctgtgtgtcgagtgcgtgg---agaaggagatgagccccct
A0A3Q1DHJ3_BCL2L1-      ggcggggcgctgtgtgtcgagtgcgtgg---agaaggagatgagccccct
A0A3Q1DHJ3_BCL2L1-      ggcggggcgctgtgtgtcgagtgcgtgg---agaaggagatgagccccct
A0A3Q1BQA0_BCL2L1-      ggcggtgtactgtgtgtggaatgcgtag---agaagaatatgagtgagct
A0A3Q1BKL8_MCL1-01      ggggcggtggtatgtcagtacctgaagg---agaggggca-gggagaact
A0A3Q1BKL8_MCL1-02      ggggcggtggtatgtcagtacctgaagg---agaggggca-gggagaact
                           *      *        *       *   *   *            * 

A0A3Q1B8C3_BCL2-01      g-gtggacaacatc------------------------------------
A0A3Q1D2L0_BCL2L10      g---gggctggaccccgggaagcagcaggaactgggacaggggcccgtaa
A0A3Q1DHJ3_BCL2L1-      g-gtgggcaggatc------------------------------------
A0A3Q1DHJ3_BCL2L1-      g-gtgggcaggatc------------------------------------
A0A3Q1DHJ3_BCL2L1-      g-gtgggcaggatc------------------------------------
A0A3Q1BQA0_BCL2L1-      g-gttccccgcatc------------------------------------
A0A3Q1BKL8_MCL1-01      gcgtggacctggtc------------------------------------
A0A3Q1BKL8_MCL1-02      gcgtggacctggtc------------------------------------
                        *      *     *                                    

A0A3Q1B8C3_BCL2-01      --------------gcggagtggatgacggagtattta---aatggacct
A0A3Q1D2L0_BCL2L10      actgcagagaactggcagagaccatagctgattacctgggagaggagaag
A0A3Q1DHJ3_BCL2L1-      --------------gtagagtggatgaccgtctacctg---gacaaccac
A0A3Q1DHJ3_BCL2L1-      --------------gtagagtggatgaccgtctacctg---gacaaccac
A0A3Q1DHJ3_BCL2L1-      --------------gtagagtggatgaccgtctacctg---gacaaccac
A0A3Q1BQA0_BCL2L1-      --------------gctgactggatgaccatgtacctg---gatgagcac
A0A3Q1BKL8_MCL1-01      --------------agccaggagatttccacatacctgctttctgaacag
A0A3Q1BKL8_MCL1-02      --------------agccaggagatttccacatacctgctttctgaacag
                                          *    **  *    **  *             

A0A3Q1B8C3_BCL2-01      cttaacagctggatacaagataacgggggatgggatgcctttgtggagct
A0A3Q1D2L0_BCL2L10      aaagactggctgttggagaatga---tggatgggaaggcttctgtaaatt
A0A3Q1DHJ3_BCL2L1-      attcaggactggatccagagccaaggaggatgggagcgttttgctgaaat
A0A3Q1DHJ3_BCL2L1-      attcaggactggatccagagccaaggaggatgggagcgttttgctgaaat
A0A3Q1DHJ3_BCL2L1-      attcaggactggatccagagccaaggaggatgggagcgttttgctgaaat
A0A3Q1BQA0_BCL2L1-      atcagtccgtggatccaaagccaaggaggatgggagtgctttgctgagat
A0A3Q1BKL8_MCL1-01      cgagactggctggtcaaaaacaa---ctcatgggatggttttgtggagtt
A0A3Q1BKL8_MCL1-02      cgagactggctggtcaaaaacaa---ctcatgggatggttttgtggagtt
                                   * *  *     *      ******    **     *  *

A0A3Q1B8C3_BCL2-01      gtat--------------------gacagacagagggactcagtcttcag
A0A3Q1D2L0_BCL2L10      ctcc------------------------ctcagtgccagagag------g
A0A3Q1DHJ3_BCL2L1-      cttc-ggtcaggacgc--------ggcggctgagagcagg-aa------g
A0A3Q1DHJ3_BCL2L1-      cttc-ggtcaggacgc--------ggcggctgagagcagg-aa------g
A0A3Q1DHJ3_BCL2L1-      cttc-ggtcaggacgc--------ggcggctgagagcagg-aa------g
A0A3Q1BQA0_BCL2L1-      tttt-gggcagaacgcc----gctg-----cagaagcacgaag------g
A0A3Q1BKL8_MCL1-01      ttttcgagtagcagaccctgagttgacggtcaggaacaca----------
A0A3Q1BKL8_MCL1-02      ttttcgagtagcagaccctgagttgacggtcaggaacaca----------
                         *                                   *            

A0A3Q1B8C3_BCL2-01      ttgctcctggccctccatcaagacggtcttcggtctggcagcac---tcg
A0A3Q1D2L0_BCL2L10      tgagtcaggacttgtccatgaagacagcgctgtttgc----------tgc
A0A3Q1DHJ3_BCL2L1-      t--ctcaggagagcttcaagaagtggctgctggtggg-----gatgacgg
A0A3Q1DHJ3_BCL2L1-      t--ctcaggagagcttcaagaagtggctgctggtggg-----gatgacgg
A0A3Q1DHJ3_BCL2L1-      t--ctcaggagagcttcaagaagtggctgctggtggg-----gatgacgg
A0A3Q1BQA0_BCL2L1-      t--ctcgggatactctgaagagatggctgctagtcgg-----aggggtgc
A0A3Q1BKL8_MCL1-01      ---ctcatggc-ctttgctggatttgctggtattggggcaacactggccc
A0A3Q1BKL8_MCL1-02      ---ctcatggc-ctttgctggatttgctggtattggggcaacactggccc
                            **  *                        *                

A0A3Q1B8C3_BCL2-01      gggcagcgagcctcaccatcggagc----------------------gta
A0A3Q1D2L0_BCL2L10      tgcgggtgtcggccttgctgggctc-----------------------ac
A0A3Q1DHJ3_BCL2L1-      tggtgacgggggtggtggtgggatc----------------------act
A0A3Q1DHJ3_BCL2L1-      tggtgacgggggtggtggtgggatc----------------------act
A0A3Q1DHJ3_BCL2L1-      tggtgacgggggtggtggtgggatc----------------------act
A0A3Q1BQA0_BCL2L1-      tgctaatgggagttctggctggtgt----------------------gct
A0A3Q1BKL8_MCL1-01      tgctgatcag----------------------------------------
A0A3Q1BKL8_MCL1-02      tgctgatcagtggtcttgctgctgtaggactaacacagagcactgaaaac

A0A3Q1B8C3_BCL2-01      ccttacacaaaa-------------gt----ga
A0A3Q1D2L0_BCL2L10      cttcctcctggtgcg----------ct----aa
A0A3Q1DHJ3_BCL2L1-      catcgcccagaaacgcct-------gt----ga
A0A3Q1DHJ3_BCL2L1-      catcgcccagaaacgcct-------gt----ga
A0A3Q1DHJ3_BCL2L1-      catcgcccagaaacgcct-------gt----ga
A0A3Q1BQA0_BCL2L1-      cattgctaagaaaca----------gt----ga
A0A3Q1BKL8_MCL1-01      -------------------------gt----ga
A0A3Q1BKL8_MCL1-02      tcttgcaaggatgcacacataagttgttgcaga
                                                  *     *

© 1998-2022Legal notice