Dataset for CDS Unclassified of organism Gadus morhua

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A8C5CAK2_uncBCL2-01 Putative B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Gadus morhua (length=750 residues).
atgaccaacacggctgaggtctacgacagtcgtgacattgtggagagatttctccacgaaaaactcgaggataaaggcat
cacctgggagttccacttaccgagtcagcatagcgggagaacacttccatcatctccttcatccacaacatcagcaccat
catcgtcacacgctggaagcgtcaacccacgcaggagggtttcggcgtcctctagcggtgaagaggggggatccccagaa
gactcccccgtggcctggcggccgcagtacggggccccgtcctggggccggaggagccggccccgcctgcaggcggtgct
gcagcaccggggctcggagctccgccgcatctatcagcaggacctgtcccaggtgtcggctcacctgctccgcctctcgg
ccggcgcggcgagggcaagcctgcgcgccatcagcggcgagctgttcgggaacggggtgaactggggccgcgtgctgacc
atgctggagttcggagccaccctgtgcgtggacggggccctggagggggccagctggagcgctgatgacgtggctgcctg
gttggtggagagcctcgacggccccgtgctccgggactggatccaagacaacggaggatgggatgcctttgtggagcagt
acgaccccgccaggcctccagagggctgctggtccgtgaggaaggtggtgggcctggtggtcctgggagctgctgggatc
acactaggggccctcttcacccagaaataa
© 1998-2022Legal notice