Dataset for CDS BCL2L1 of organism Amphiprion percula

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A3P8TL99_BCL2L1-      atgtctca---gaacagagaactggtggttttctacataaagtataaact
A0A3P8TL99_BCL2L1-      atgtctca---gaacagagaactggtggttttctacataaagtataaact
A0A3P8U812_BCL2L1-      atgtcgtacagtaacagagagctggtggagttctttgtaagctacaagct
                        *****  *    ******** *******  ****   ***  ** ** **

A0A3P8TL99_BCL2L1-      ctcccagagaaactatcc----cctc------aaccacatggtgctgaat
A0A3P8TL99_BCL2L1-      ctcccagagaaactatcc----cctc------aaccacatggtgctgaat
A0A3P8U812_BCL2L1-      gtctcaaaggaactatccgacgtctctgctgaggccagaggatgctgaag
                         ** ** ** ********     ***        *** * * ******* 

A0A3P8TL99_BCL2L1-      gaggctcccagcaggactgacgggggggaggcccggctgggagaggaaca
A0A3P8TL99_BCL2L1-      gaggctcccagcaggactgacgggggggaggcccggctgggagaggaaca
A0A3P8U812_BCL2L1-      ga----------aggactgatggggacaagg-ccaact----------ca
                        **          ******** ****   *** **  **          **

A0A3P8TL99_BCL2L1-      gcggacagagacacacgccaacgggacttttaacggcacgagtcccggga
A0A3P8TL99_BCL2L1-      gcggacagagacacacgccaacgggacttttaacggcacgagtcccggga
A0A3P8U812_BCL2L1-      gcttccag----------------------taacggcttgc---------
                        **   ***                      *******  *          

A0A3P8TL99_BCL2L1-      cccccccgccgtccccgcggcggctggcgtcgacggcgaccatggacgcg
A0A3P8TL99_BCL2L1-      cccccccgccgtccccgcggcggctggcgtcgacggcgaccatggacgcg
A0A3P8U812_BCL2L1-      -----------------tggtgaacagcagaggtgg----catagaggct
                                          ** *    **   *  **    *** ** ** 

A0A3P8TL99_BCL2L1-      gtgaaggaggccctccgggacacggccaacgagttcgagctgcggtacgc
A0A3P8TL99_BCL2L1-      gtgaaggaggccctccgggacacggccaacgagttcgagctgcggtacgc
A0A3P8U812_BCL2L1-      gtaaaatccgcacttaaggacgcggcagatgagtttgaacttctcttcac
                        ** **    ** **   **** ****  * ***** ** ** *  * * *

A0A3P8TL99_BCL2L1-      ccgtgccttcagcgacctgcacagccagctgcacatcacgcccgccaccg
A0A3P8TL99_BCL2L1-      ccgtgccttcagcgacctgcacagccagctgcacatcacgcccgccaccg
A0A3P8U812_BCL2L1-      gcaggcttttagtgatctgtcttcacagcttgacatcacccctgaaacag
                         *  ** ** ** ** ***      *****  ******* ** *  ** *

A0A3P8TL99_BCL2L1-      cctaccagagcttcgagaacgtgatggatgaggtgttccgggacggcgtc
A0A3P8TL99_BCL2L1-      cctaccagagcttcgagaacgtgatggatgaggtgttccgggacggcgtc
A0A3P8U812_BCL2L1-      cctaccacagctttaagagtgtgatggacgaggtgttcaaggatggggtc
                        ******* *****  ***  ******** *********  *** ** ***

A0A3P8TL99_BCL2L1-      aactggggccgcatcgtggggctgttcgcgttcggcggggcgctgtgtgt
A0A3P8TL99_BCL2L1-      aactggggccgcatcgtggggctgttcgcgttcggcggggcgctgtgtgt
A0A3P8U812_BCL2L1-      aactggggacgtatagtgggcctgttttgctttggcggtgtactgtgtgt
                        ******** ** ** ***** *****    ** ***** *  ********

A0A3P8TL99_BCL2L1-      cgagtgcgtggagaaggagatgagccccctggtgggcaggatcgtagagt
A0A3P8TL99_BCL2L1-      cgagtgcgtggagaaggagatgagccccctggtgggcaggatcgtagagt
A0A3P8U812_BCL2L1-      ggaatgcgtagataagaatatgagtgagctggttccccgcatcgctgact
                         ** ***** ** *** * *****    *****   * * ****  ** *

A0A3P8TL99_BCL2L1-      ggatgaccgtctacctggacaaccacattcaggactggatccagagccaa
A0A3P8TL99_BCL2L1-      ggatgaccgtctacctggacaaccacattcaggactggatccagagccaa
A0A3P8U812_BCL2L1-      ggatgaccatgtacctggatgagcacatcagtccgtggatccaaagccaa
                        ******** * ********  * *****       ******** ******

A0A3P8TL99_BCL2L1-      ggaggatgggagcgttttgctgaaatcttcggtcaggacgcggcggccga
A0A3P8TL99_BCL2L1-      ggaggatgggagcgttttgctgaaatcttcggtcaggacgcggcggccga
A0A3P8U812_BCL2L1-      ggaggatgggagtgctttgctgagatttttgggcagaacgccgctgcaga
                        ************ * ******** ** ** ** *** **** ** ** **

A0A3P8TL99_BCL2L1-      gagcaggaagtctcaggagagcttcaagaagtggctgctggtggggatga
A0A3P8TL99_BCL2L1-      gagcaggaagtctcaggagagcttcaagaagtggctgctggtggggatga
A0A3P8U812_BCL2L1-      agcacgaaggtctcgggatactctgaagagatggctgctagtcggagggg
                             * * ***** *** *   * ****  ******** ** **   * 

A0A3P8TL99_BCL2L1-      cggtggtgacgggggtggtggtgggatcactcatcgcccagaaacgcctg
A0A3P8TL99_BCL2L1-      cggtggtgacgggggtggtggtgggatcactcatcgcccagaaacgcctg
A0A3P8U812_BCL2L1-      tgctgctaatgggagttctggctggtgtgctcattgctaagaaaca---g
                         * ** * * *** **  ***  **    ***** **  ******    *

A0A3P8TL99_BCL2L1-      tga
A0A3P8TL99_BCL2L1-      tga
A0A3P8U812_BCL2L1-      tga

© 1998-2022Legal notice