Dataset for CDS BAX-like of Organism Ictidomys tridecemlineatus

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


I3N6F3_BOK-01           ctgcctcttccagctgggctgagggccactccaggacattccttgtcctc
A0A287D718_BAK1-01      atg------gcatccgggcaagg---------------------------
A0A287D718_BAK1-02      atg------gcatccgggcaagg---------------------------
                         **       ** * ****   *                           

I3N6F3_BOK-01           cccagagcctgccagccctctgggacgtgctgacct--cttgtgtgccta
A0A287D718_BAK1-01      cccaggtcctcccag---tgaggaatgtggagagccagcctccgattctg
A0A287D718_BAK1-02      cccaggtcctcccag---tgaggaatgtggagagccagcctccgattctg
                        *****  *** ****   *  ** * ***  ** *   * *  *   ** 

I3N6F3_BOK-01           tgcaggggat-------gagctggagcagatccggcccag-tgtgtaccg
A0A287D718_BAK1-01      agcagcaggtagtccaggacacggaggaggtttttcgtagctacgtttat
A0A287D718_BAK1-02      agcagcaggtagtccaggacacggaggaggtttttcgtagctacgtttat
                         ****  * *       **   **** ** *    *  ** *  **    

I3N6F3_BOK-01           caatgtggccggccagctgcacctctccgtgcagtcggagcccgtggtga
A0A287D718_BAK1-01      taccgtcaccggcagg----------------agcaggaggctgagggag
A0A287D718_BAK1-02      taccgtcaccggcagg----------------agcaggaggctgagggag
                         *  **  *****  *                **  **** * * **   

I3N6F3_BOK-01           cagatgcattcctggctgtggcaggccacatctt---------ctctgca
A0A287D718_BAK1-01      cagctgc---ccctgctgacccagagatggtcttggccctagaacctacc
A0A287D718_BAK1-02      cagctgc---ccctgctgacccagagatggtcttggccctagaacctacc
                        *** ***   **  ****   ***      ****           ** * 

I3N6F3_BOK-01           ggcatcacgtggggcaaagtggt------gtccctgtacgcagtggctgc
A0A287D718_BAK1-01      agtacca--tggggcaggtgggtcggcagctcgctgtgattggtgacgac
A0A287D718_BAK1-02      agtacca--tggggcaggtgggtcggcagctcgctgtgattggtgacgac
                         * * **  *******    ***       ** ****     *** *  *

I3N6F3_BOK-01           ag-gactggctgtg-gactgtgtgc-----ggcaggcccagcccgccatg
A0A287D718_BAK1-01      atcaaccggcgctacgactctgagttccagagcatgcttgaacaactgca
A0A287D718_BAK1-02      atcaaccggcgctacgactctgagttccagagcatgcttgaacaactgca
                        *   ** ***  *  **** ** *       *** **     *  *    

I3N6F3_BOK-01           gtccacgccctggtg-gactgcctgggggagtttgtgcgcaagacc----
A0A287D718_BAK1-01      acctaca----gctgcgaatgcct--atgaactcttcaccaagatcgcct
A0A287D718_BAK1-02      acctaca----gctgcgaatgcct--atgaactcttcaccaagatcgcct
                          * **     * ** ** *****    **  *  *   ***** *    

I3N6F3_BOK-01           -----------------ctggcagcctggctgaggcggcgtggtggatgg
A0A287D718_BAK1-01      c--------------------cagcctgtttgaga----gtggc--atca
A0A287D718_BAK1-02      ccaggccagcagcaacacccacagcctgtttgaga----gtggc--atca
                                             *******  ****     ****   **  

I3N6F3_BOK-01           actgatgtcctcagatgcgtggtcagcacggaccctggcctccgtgcaca
A0A287D718_BAK1-01      actggggcc-------gtgtgg-------------tggctctcctgggct
A0A287D718_BAK1-02      actggggcc-------gtgtgg-------------tggctctcctgggct
                        ****  * *       * ****             ****   * **  * 

I3N6F3_BOK-01           ctggctggtggctgcgctctgcagttttggccgctt--cctga-------
A0A287D718_BAK1-01      ttggctatcgcctg-gccttacacgtctaccggcatggcctgacaggctt
A0A287D718_BAK1-02      ttggctatcgcctg-gccttacacgtctaccggcatggcctga-------
                         *****   * *** **  * **  * *  * ** *  *****       

I3N6F3_BOK-01           --------------------------------------------------
A0A287D718_BAK1-01      cctgggccaggtgacccactttgtggtcgacttcatgttgcatcgctgca
A0A287D718_BAK1-02      --------------------------------------------------
                                                                          

I3N6F3_BOK-01           --------------------------------------------------
A0A287D718_BAK1-01      ttgcccggtggatcgcacagagaggaggctgggtggccgccctggacttg
A0A287D718_BAK1-02      --------------------------------------------------
                                                                          

I3N6F3_BOK-01           -------------------------aggctgcctttttcatgctgctgcc
A0A287D718_BAK1-01      ggcaacggcccaatccggaatgtgctggtggttctggctgtggttctgct
A0A287D718_BAK1-02      --------------------------------------------------
                                                                          

I3N6F3_BOK-01           gg---------------------------agagatga
A0A287D718_BAK1-01      gggccagtttgtggtacgaagattcttcaagtcatga
A0A287D718_BAK1-02      -------------------------------------
                                                             

© 1998-2023Legal notice