Dataset for CDS BCL-2-like of organism Catagonus wagneri

[Download (right click)] [Edit] [Sequences] [Repertoires]

7 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C3WEA1_BCL2A1-      atg-----------------------------------------------
A0A8C3WJH5_BCL2L1-      atg-----------------------------tctca-------------
A0A8C3WCN0_BCL2-01      atg----------------gcgc--------------------acgctgg
A0A8C3X592_BCL2L2-      atg-------------gcgaccc------cggcctcagcccc--------
A0A8C3W949_MCL1-01      atgtttggcttcaagagaaacgcagtaatcgggctcaacctctactgtgg
A0A8C3W949_MCL1-02      atgtttggcttcaagagaaacgcagtaatcgggctcaacctctactgtgg
A0A8C3W949_MCL1-03      atgtttggcttcaagagaaacgcagtaatcgggctcaacctctactgtgg
                        ***                                               

A0A8C3WEA1_BCL2A1-      -----------------acggacaacgaatttggatat------------
A0A8C3WJH5_BCL2L1-      --gagca----------accgggag---ctggtggttg----actttctc
A0A8C3WCN0_BCL2-01      gagaacagggtatgataaccgggaa---atagtgatga-agtacatcca-
A0A8C3X592_BCL2L2-      --agac-----------actcgggct--ctagtggcag----------ac
A0A8C3W949_MCL1-01      gggggccgg--------actggggccgggtagcggcagcagtgcctccgc
A0A8C3W949_MCL1-02      gggggccgg--------actggggccgggtagcggcagcagtgcctccgc
A0A8C3W949_MCL1-03      gggggccgg--------actggggccgggtagcggcagcagtgcctccgc
                                         **          *   *                

A0A8C3WEA1_BCL2A1-      -----------attcacatgctggcccagga-------------------
A0A8C3WJH5_BCL2L1-      tc-----------ctacaagctttcccagaaagg----------------
A0A8C3WCN0_BCL2-01      -------------ctataagctgtcgcagagggg----------------
A0A8C3X592_BCL2L2-      tttgtggg-----ctataagctgaggcagaaggg----------------
A0A8C3W949_MCL1-01      tccgggagggcgcctcttggctgcgggaaaagaggccacggcccagagag
A0A8C3W949_MCL1-02      tccgggagggcgcctcttggctgcgggaaaagaggccacggcccagagag
A0A8C3W949_MCL1-03      tccgggagggcgcctctt--------------------------------
                                                                          

A0A8C3WEA1_BCL2A1-      --------------------------------------------------
A0A8C3WJH5_BCL2L1-      --------------------------------------------------
A0A8C3WCN0_BCL2-01      --------------------------------------------------
A0A8C3X592_BCL2L2-      --------------------------------------------------
A0A8C3W949_MCL1-01      aggtagggggaggggaagccggcgcggtgattggcggaagcgccggcgcg
A0A8C3W949_MCL1-02      aggtagggggaggggaagccggcgcggtgattggcggaagcgccggcgcg
A0A8C3W949_MCL1-03      --------------------------------------------------
                                                                          

A0A8C3WEA1_BCL2A1-      --------------------------------------------------
A0A8C3WJH5_BCL2L1-      --------------------------------------------------
A0A8C3WCN0_BCL2-01      --------------------------------------------------
A0A8C3X592_BCL2L2-      --------------------------------------------------
A0A8C3W949_MCL1-01      agccccccgtccactcctgcgccagatgcccggagggtcgcgcggccctc
A0A8C3W949_MCL1-02      agccccccgtccactcctgcgccagatgcccggagggtcgcgcggccctc
A0A8C3W949_MCL1-03      --------------------------------------------------
                                                                          

A0A8C3WEA1_BCL2A1-      --------------------------------------------------
A0A8C3WJH5_BCL2L1-      --------------------------------------------------
A0A8C3WCN0_BCL2-01      --------------------------------------------------
A0A8C3X592_BCL2L2-      --------------------------------------------------
A0A8C3W949_MCL1-01      gcccattggcgccgagggcccagacgtcaccgcgacccccgccagactgg
A0A8C3W949_MCL1-02      gcccattggcgccgagggcccagacgtcaccgcgacccccgccagactgg
A0A8C3W949_MCL1-03      --------------------------------------------------
                                                                          

A0A8C3WEA1_BCL2A1-      --------------------------------------------------
A0A8C3WJH5_BCL2L1-      --------------------------------------------------
A0A8C3WCN0_BCL2-01      --------------------------------------------------
A0A8C3X592_BCL2L2-      --------------------------------------------------
A0A8C3W949_MCL1-01      tgttcttcgcgcccacccgcctcgcgtcgccgcccgaagagatggactcc
A0A8C3W949_MCL1-02      tgttcttcgcgcccacccgcctcgcgtcgccgcccgaagagatggactcc
A0A8C3W949_MCL1-03      --------------------------------------------------
                                                                          

A0A8C3WEA1_BCL2A1-      ----------------------ctatctgaactatgtt------------
A0A8C3WJH5_BCL2L1-      ----------atacagctggagtcagtttagtgatgtggaagagaacaga
A0A8C3WCN0_BCL2-01      ----------------ctacgagt------gggatgctggagacgcgggc
A0A8C3X592_BCL2L2-      ----------------ttatgtct------gtggagctgg----------
A0A8C3W949_MCL1-01      ccggcctccgacgccatcatgtctcccgaagaggagctggacggctacga
A0A8C3W949_MCL1-02      ccggcctccgacgccatcatgtctcccgaagaggagctggacggctacga
A0A8C3W949_MCL1-03      --------------------------------------------------
                                                                          

A0A8C3WEA1_BCL2A1-      ---------cttcagataccacag-----------------cctggatct
A0A8C3WJH5_BCL2L1-      actgagg--ccccagaagggactgaatcagaagcggaaacccctagtgcc
A0A8C3WCN0_BCL2-01      gccgcgt--ccccgggggccgctcccgcacc--gggcatcttctcctccc
A0A8C3X592_BCL2L2-      ---------ccccggggagggccc--------------------------
A0A8C3W949_MCL1-01      gccggagcccctcgggaagaggccggccgtc--ctgcccttgctggggtt
A0A8C3W949_MCL1-02      gccggagcccctcgggaagaggccggccgtc--ctgcccttgctggggtt
A0A8C3W949_MCL1-03      --------------------------------------------------
                                                                          

A0A8C3WEA1_BCL2A1-      ggtccaagcaaaacgtccagagtgctacaagac-----------------
A0A8C3WJH5_BCL2L1-      atcaatggcaacccatcctggcacctggcggacagccccgc---------
A0A8C3WCN0_BCL2-01      agcccgggcga-----------acccccgcgcccgccaggacctcgccgc
A0A8C3X592_BCL2L2-      --------------------------------------------------
A0A8C3W949_MCL1-01      ggtcgaggaggccagtagtggccccggcacggacggctcactcccctcga
A0A8C3W949_MCL1-02      ggtcgaggaggccagtagtggccccggcacggacggctcactcccctcga
A0A8C3W949_MCL1-03      --------------------------------------------------
                                                                          

A0A8C3WEA1_BCL2A1-      --------------------------------------------------
A0A8C3WJH5_BCL2L1-      --------------------------------------------------
A0A8C3WCN0_BCL2-01      caccgccccc----------------------------------------
A0A8C3X592_BCL2L2-      --------------------------------------------------
A0A8C3W949_MCL1-01      cgccgcccccggcagaggaggaggacgacgagttgtaccggcagtcccta
A0A8C3W949_MCL1-02      cgccgcccccggcagaggaggaggacgacgagttgtaccggcagtcccta
A0A8C3W949_MCL1-03      --------------------------------------------------
                                                                          

A0A8C3WEA1_BCL2A1-      ------------------------------gttgctttctccgtc----c
A0A8C3WJH5_BCL2L1-      -----------------------------ggtgaatggagccactggc-c
A0A8C3WCN0_BCL2-01      -----------------------------gaccgcccccgccgccgccgc
A0A8C3X592_BCL2L2-      -------------------------agcagctgacccgctgca------c
A0A8C3W949_MCL1-01      gagattatctctcggtaccttcgggagcaggcaaccggcgccaaggacgc
A0A8C3W949_MCL1-02      gagattatctctcggtaccttcgggagcaggcaaccggcgccaaggacgc
A0A8C3W949_MCL1-03      -----------------------------ggcaaccggcgccaaggacgc
                                                                 *       *

A0A8C3WEA1_BCL2A1-      aaaaccaa------------------------------gttgaa-aagaa
A0A8C3WJH5_BCL2L1-      acagcagcagcttggatgcccgggaggtgatccccatggctgcggtgaag
A0A8C3WCN0_BCL2-01      ggggcctgcgctcagcccc-------gtg----cca--cctgtggtccac
A0A8C3X592_BCL2L2-      caagcca---------tgc-------ggg-----ca--gctggagatgag
A0A8C3W949_MCL1-01      gaagccaatgggcgggtgc-------ggggccgcca--gccgga-aggcg
A0A8C3W949_MCL1-02      gaagccaatgggcgggtgc-------ggggccgcca--gccgga-aggcg
A0A8C3W949_MCL1-03      gaagccaatgggcgggtgc-------ggggccgcca--gccgga-aggcg
                            *                                    *        

A0A8C3WEA1_BCL2A1-      tttgaaaccttgctt--------ggacaattttgatgttggg--------
A0A8C3WJH5_BCL2L1-      c---aagcgctgagggaggcgggtgatgagtttgaactgaggtaccggcg
A0A8C3WCN0_BCL2-01      ct---gaccctgcgccaggccggcgacgacttctctcgtcgctaccgccg
A0A8C3X592_BCL2L2-      tttgagaccc------------------gctt------------ccggcg
A0A8C3W949_MCL1-01      ttagagaccctgcgacgggtcggggacggggt------------gcagcg
A0A8C3W949_MCL1-02      ttagagaccctgcgacgggtcggggacggggt------------gcagcg
A0A8C3W949_MCL1-03      ttagagaccctgcgacgggtcggggacggggt------------gcagcg
                               *                       *                  

A0A8C3WEA1_BCL2A1-      ----tccatagacacggc--------------------------caggat
A0A8C3WJH5_BCL2L1-      ggcattcagtgacctgacatcccagctccacatcaccccagggacagcat
A0A8C3WCN0_BCL2-01      agactttgccgagatgtccagccagctgcacctgacacc-----cttcac
A0A8C3X592_BCL2L2-      taccttctcagatctggcgtctcagttgcatgtaaccccagggtcggccc
A0A8C3W949_MCL1-01      caaccac---gagacggctttccaa-ggcatg---cttcggaaactggac
A0A8C3W949_MCL1-02      caaccac---gagacggctttccaa-ggcatg---cttcggaaactggac
A0A8C3W949_MCL1-03      caaccac---gagacggctttccaa-ggcatg---cttcggaaactggac
                                  **   * *                          *     

A0A8C3WEA1_BCL2A1-      aata----------------ttcaatcaggtgatggaaaa------ggaa
A0A8C3WJH5_BCL2L1-      atca------------gagctttgagcaggtagtgaacga------actc
A0A8C3WCN0_BCL2-01      cgcg-------aggggacgctttgccacggtggtggagga------gctc
A0A8C3X592_BCL2L2-      agca------------acgcttcacccaggtctctgatga------actc
A0A8C3W949_MCL1-01      atcaaaaacgaagacgatgtcaaatctttgtctcgagtgatggtccacgt
A0A8C3W949_MCL1-02      atcaaaaacgaagacgatgtcaaatctttgtctcgagtgatggtccacgt
A0A8C3W949_MCL1-03      atcaaaaacgaagacgatgtcaaatctttgtctcgagtgatggtccacgt
                                                     **        *          

A0A8C3WEA1_BCL2A1-      tttgaa-gacggcatcatcaactggggaaggattgtgactgtatttgcat
A0A8C3WJH5_BCL2L1-      ttccgg-gatggggt---gaactggggtcgcattgtggcctttttctcct
A0A8C3WCN0_BCL2-01      tt-cagggatggggt---gaactgggggaggattgtggccttctttgagt
A0A8C3X592_BCL2L2-      ttccaa----gggggccccaactggggccgccttgtggccttctttgtct
A0A8C3W949_MCL1-01      tttcagtgacggagtaacaaactggggcaggattgtgactcttatttctt
A0A8C3W949_MCL1-02      tttcagtgacggagtaacaaactggggcaggattgtgactcttatttctt
A0A8C3W949_MCL1-03      tttcagtgacggagtaacaaactggggcaggattgtgactcttatttctt
                        **        **       ********  *  ***** *  *  *    *

A0A8C3WEA1_BCL2A1-      ttgaaggtattctca-------------tgaagaaacttctgcgaaagca
A0A8C3WJH5_BCL2L1-      tcggtggggcactgtgcg----------tggaga-------gcgtagaca
A0A8C3WCN0_BCL2-01      tcggtggggtcatgtgtg----------tggaga-------gcgtcaacc
A0A8C3X592_BCL2L2-      tcggagctgcgctgtgtg----------ctgaga-------gtgtcaaca
A0A8C3W949_MCL1-01      ttggtgc----ctttgtggccaaacacttgaaga-------gtataaatc
A0A8C3W949_MCL1-02      ttggtgc----ctttgtggccaaacacttgaaga-------gtataaatc
A0A8C3W949_MCL1-03      ttggtgc----ctttgtggccaaacacttgaaga-------gtataaatc
                        * *  *      *                  ***       *        

A0A8C3WEA1_BCL2A1-      aattgcctcagatgtggacacttacaaggagattccttactttgtcg-cg
A0A8C3WJH5_BCL2L1-      aggag------atgcaggtattggtgagtcggatcgcaacgtggatggcc
A0A8C3WCN0_BCL2-01      gggag------atgtcgcccctggtggacaacatagccctgtggatgact
A0A8C3X592_BCL2L2-      aggag------atggagccacttgtgggacaagtgcaggagtggatggtg
A0A8C3W949_MCL1-01      aagaaagctgcatcgaaccattagcaga--------aagcatcacagatg
A0A8C3W949_MCL1-02      aagaaagctgcatcgaaccattagcaga--------aagcatcacagatg
A0A8C3W949_MCL1-03      aagaaagctgcatcgaaccattagcaga--------aagcatcacagatg
                                   **        *                   *    *   

A0A8C3WEA1_BCL2A1-      gagttcatcaccaaaaacacaggacagtggataaggcaaaacggaggctg
A0A8C3WJH5_BCL2L1-      acttacctgaatgaccacctagagccttggatccaggagaacggcggctg
A0A8C3WCN0_BCL2-01      gagtacctgaaccggcacctgcacacttggatccaggataacggaggctg
A0A8C3X592_BCL2L2-      acctacctggagacgcggctagccgactggatccacagcagtgggggctg
A0A8C3W949_MCL1-01      ttct-cgtaaggacaaaacga---gactggctagtcaaacaaagaggctg
A0A8C3W949_MCL1-02      ttct-cgtaaggacaaaacga---gactggctagtcaaacaaagaggctg
A0A8C3W949_MCL1-03      ttct-cgtaaggacaaaacga---gactggctagtcaaacaaagaggctg
                           * * *                   *** *           * *****

A0A8C3WEA1_BCL2A1-      ggaaaatggctttgtaaa----gaagttt-------------gaacccaa
A0A8C3WJH5_BCL2L1-      gg---acacttttgtg------gaactct----------acggaaacaat
A0A8C3WCN0_BCL2-01      gg---acgcctttgtg------gagctgt------------atggcccca
A0A8C3X592_BCL2L2-      gg---cggagttca--------cagctct--atacggggacggggccctg
A0A8C3W949_MCL1-01      gg---tgtggtcctttaaaaacaagttctacagctatgttttggagcaga
A0A8C3W949_MCL1-02      gg---atgggtttgtg------gagttct---tccatgtagagga-ccta
A0A8C3W949_MCL1-03      gg---atgggtttgtg------gagttct---tccatgtagagga-ccta
                        **        *            *  * *                 *   

A0A8C3WEA1_BCL2A1-      -------------------------------atctggctggctgaccctt
A0A8C3WJH5_BCL2L1-      gcagcagctgagagtcggaagggccaggagcgcttcaaccgctggttcct
A0A8C3WCN0_BCL2-01      gcat-------------gcggcctctgtttgatttctcctggctgtctct
A0A8C3X592_BCL2L2-      gaggaggcgcggcgtctgcggg----aggggaactgggc--ctcagtgag
A0A8C3W949_MCL1-01      ggag-------------acgca----acaggacttctgtggctgggcaga
A0A8C3W949_MCL1-02      gaag-------------gcggc----atcagaaatgtgctgctggctttt
A0A8C3W949_MCL1-03      gaag-------------gcggc----atcagaaatgtgctgctggctttt
                                                          *               

A0A8C3WEA1_BCL2A1-      ctggaagtt------actggaa------------------------agat
A0A8C3WJH5_BCL2L1-      gacg-----------------------------ggcatgacactagctgg
A0A8C3WCN0_BCL2-01      gaaggcgct------gctcagt--------ctggccctgg---tgggagc
A0A8C3X592_BCL2L2-      gacagtgct------gacgggg-----------gccgtggcactgggggc
A0A8C3W949_MCL1-01      gtgagaattcaaccagatggaagaaatcccagggacttagacttaggtac
A0A8C3W949_MCL1-02      gcaggtgtt------gctggag---------------------taggagc
A0A8C3W949_MCL1-03      gcaggtgtt------gctggag---------------------taggagc
                                                                          

A0A8C3WEA1_BCL2A1-      ctgcgaaatgttatgtgtcctgaagcaatactattga-
A0A8C3WJH5_BCL2L1-      cgtggttctgctgggttcgcttttcagtcggaaatga-
A0A8C3WCN0_BCL2-01      ttgcatcaccctgggtgcctatctgggccataagtga-
A0A8C3X592_BCL2L2-      cctggtaactgtaggggccttttttgctagcaagtga-
A0A8C3W949_MCL1-01      tttcctga------ggctttctacttcctgtaa-----
A0A8C3W949_MCL1-02      t-------------ggtttggcatatctaataagatag
A0A8C3W949_MCL1-03      t-------------ggtttggcatatctaataagatag
                                      *                 *     

© 1998-2022Legal notice