Dataset for CDS BAK1 of Organism Canis lupus dingo

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A8C0JQK7_BAK1-01 BCL2-antagonist/killer 1 gene OS=[Eukaryota] Canis lupus dingo GN=BAK1 (length=732 residues).
atggcatccgggcaaggcccagggcctcccaggcgggagtgtggagaggctgccccgtcttctacttctgaggagcaggt
agcccgggacaccgaggaggttttccgcagctatgttttttaccgccatcggcaggagcaggaggctgagggggcggctg
tgccagctgacccagaaatggtcaccttgcccctagaacctagcagcaccatggggcaggtgggtcggcagctcgctatc
attggggacgacatcaaccagcgctatgactcggagttccaggccatgctgcagcacctacagccgacagcagagaatgc
ctatgagtacttcaccaagattgcctcgagcctatttgagagcggcatcaactggggccgagtggtggctctcctgggct
ttggctaccgcctggccctgcatgtctaccaacgcggcctgaccggcttcctgggccaggtgacccgcttcgtggccgac
ttcatgctgcatcattgcattgcccggtggatcgcgcagaggggtggctgggtggcagccctgaacttgggaaacggccc
catcctgaacgtgctgatagtgctgtctgtggttctgttgggccagtttgtgcctacaggtctgggggaaaggagagaga
agttcatgattaagccaaatgcagggagcggatgcagatggagcccgctgaccagcccccaccctctgagtgtgtctgaa
aataaactgtaa
© 1998-2023Legal notice