Dataset for CDS BCL2L1 of organism Sus scrofa

[Download (right click)] [Edit] [Sequences] [Repertoires]

6 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A4X1SQU7_BCL2L1-      atgtctcagagcaaccgggagctggtggttgactttctctcctacaagct
O77737_BCL2L1-01        atgtctcagagcaaccgggagctggtggttgactttctctcctacaagct
A0A4X1SQU7_BCL2L1-      atgtctcagagcaaccgggagctggtggttgactttctctcctacaagct
A0A4X1SQU7_BCL2L1-      atgtctcagagcaaccgggagctggtggttgactttctctcctacaagct
A0A4X1SQU7_BCL2L1-      atgtctcagagcaaccgggagctggtggttgactttctctcctacaagct
A0A4X1SQU7_BCL2L1-      atgtctcagagcaaccgggagctggtggttgactttctctcctacaagct

A0A4X1SQU7_BCL2L1-      ttcccagaaaggatacagctggagtcagtttactgatgtggaagagaaca
O77737_BCL2L1-01        ttcccagaaaggatacagctggagtcagtttactgatgtggaagagaaca
A0A4X1SQU7_BCL2L1-      ttcccagaaaggatacagctggagtcagtttactgatgtggaagagaaca
A0A4X1SQU7_BCL2L1-      ttcccagaaaggatacagctggagtcagtttactgatgtggaagagaaca
A0A4X1SQU7_BCL2L1-      ttcccagaaaggatacagctggagtcagtttactgatgtggaagagaaca
A0A4X1SQU7_BCL2L1-      ttcccagaaaggatacagctggagtcagtttactgatgtggaagagaaca

A0A4X1SQU7_BCL2L1-      gaactgaggccccagaagggactgaatcagaagcggaaacccctagtgcc
O77737_BCL2L1-01        gaactgaggccccagaagggactgaatcagaagcggaaacccctagtgcc
A0A4X1SQU7_BCL2L1-      gaactgaggccccagaagggactgaatcagaagcggaaacccctagtgcc
A0A4X1SQU7_BCL2L1-      gaactgaggccccagaagggactgaatcagaagcggaaacccctagtgcc
A0A4X1SQU7_BCL2L1-      gaactgaggccccagaagggactgaatcagaagcggaaacccctagtgcc
A0A4X1SQU7_BCL2L1-      gaactgaggccccagaagggactgaatcagaagcggaaacccctagtgcc

A0A4X1SQU7_BCL2L1-      atcaatggcaacccatcctggcacctggcggacagccccgcggtgaatgg
O77737_BCL2L1-01        atcaatggcaacccatcctggcacctggcggacagccccgcggtgaatgg
A0A4X1SQU7_BCL2L1-      atcaatggcaacccatcctggcacctggcggacagccccgcggtgaatgg
A0A4X1SQU7_BCL2L1-      atcaatggcaacccatcctggcacctggcggacagccccgcggtgaatgg
A0A4X1SQU7_BCL2L1-      atcaatggcaacccatcctggcacctggcggacagccccgcggtgaatgg
A0A4X1SQU7_BCL2L1-      atcaatggcaacccatcctggcacctggcggacagccccgcggtgaatgg

A0A4X1SQU7_BCL2L1-      agccactggccacagcagcagcttggatgcccgggaggtgatccccatgg
O77737_BCL2L1-01        agccactggccacagcagcagcttggatgcccgggaggtgatccccatgg
A0A4X1SQU7_BCL2L1-      agccactggccacagcagcagcttggatgcccgggaggtgatccccatgg
A0A4X1SQU7_BCL2L1-      agccactggccacagcagcagcttggatgcccgggaggtgatccccatgg
A0A4X1SQU7_BCL2L1-      agccactggccacagcagcagcttggatgcccgggaggtgatccccatgg
A0A4X1SQU7_BCL2L1-      agccactggccacagcagcagcttggatgcccgggaggtgatccccatgg

A0A4X1SQU7_BCL2L1-      ctgcagtgaagcaagcgctgagggaggcgggcgatgagtttgaactgagg
O77737_BCL2L1-01        ctgcagtgaagcaagcgctgagggaggcgggcgatgagtttgaactgagg
A0A4X1SQU7_BCL2L1-      ctgcagtgaagcaagcgctgagggaggcgggcgatgagtttgaactgagg
A0A4X1SQU7_BCL2L1-      ctgcagtgaagcaagcgctgagggaggcgggcgatgagtttgaactgagg
A0A4X1SQU7_BCL2L1-      ctgcagtgaagcaagcgctgagggaggcgggcgatgagtttgaactgagg
A0A4X1SQU7_BCL2L1-      ctgcagtgaagcaagcgctgagggaggcgggcgatgagtttgaactgagg

A0A4X1SQU7_BCL2L1-      taccggagggcattcagtgacctgacgtcccagctccacatcaccccagg
O77737_BCL2L1-01        taccggagggcattcagtgacctgacgtcccagctccacatcaccccagg
A0A4X1SQU7_BCL2L1-      taccggagggcattcagtgacctgacgtcccagctccacatcaccccagg
A0A4X1SQU7_BCL2L1-      taccggagggcattcagtgacctgacgtcccagctccacatcaccccagg
A0A4X1SQU7_BCL2L1-      taccggagggcattcagtgacctgacgtcccagctccacatcaccccagg
A0A4X1SQU7_BCL2L1-      taccggagggcattcagtgacctgacgtcccagctccacatcaccccagg

A0A4X1SQU7_BCL2L1-      gacagcgtatcagagctttgagcaggtagtgaacgaactcttccgggatg
O77737_BCL2L1-01        gacagcgtatcagagctttgagcaggtattgaacgaactcttccgggatg
A0A4X1SQU7_BCL2L1-      gacagcgtatcagagctttgagcaggtagtgaacgaactcttccgggatg
A0A4X1SQU7_BCL2L1-      gacagcgtatcagagctttgagcaggtagtgaacgaactcttccgggatg
A0A4X1SQU7_BCL2L1-      gacagcgtatcagagctttgagcaggtagtgaacgaactcttccgggatg
A0A4X1SQU7_BCL2L1-      gacagcgtatcagagctttgag----------------------------

A0A4X1SQU7_BCL2L1-      gggtgaactggggtcgcattgtggcctttttctccttcggtggggcactg
O77737_BCL2L1-01        gggtgaactggggtcgcattgtggcctttttctccttcggtggggcactg
A0A4X1SQU7_BCL2L1-      gggtgaactggggtcgcattgtggcctttttctccttcggtggggcactg
A0A4X1SQU7_BCL2L1-      gggtgaactggggtcgcattgtggcctttttctccttcggtggggcactg
A0A4X1SQU7_BCL2L1-      gggtgaactggggtcgcattgtggcctttttctccttcggtggggcactg
A0A4X1SQU7_BCL2L1-      --------------------------------------------------

A0A4X1SQU7_BCL2L1-      tgcgtggagagcgtagacaaggagatgcaggtattggtgagtcggatcgc
O77737_BCL2L1-01        tgcgtggagagcgtagacaaggagatgcaggtattggtgagtcggatcgc
A0A4X1SQU7_BCL2L1-      tgcgtggagagcgtagacaaggagatgcaggtattggtgagtcggatcgc
A0A4X1SQU7_BCL2L1-      tgcgtggagagcgtagacaaggagatgcaggtattggtgagtcggatcgc
A0A4X1SQU7_BCL2L1-      tgcgtggagagcgtagacaaggagatgcaggtattggtgagtcggatcgc
A0A4X1SQU7_BCL2L1-      --------------------------------------------------

A0A4X1SQU7_BCL2L1-      aacttggatggccacttacctgaatgaccacctagagccttggatccagg
O77737_BCL2L1-01        aacttggatggccacttacctgaatgaccacctagagccttggatccagg
A0A4X1SQU7_BCL2L1-      aacttggatggccacttacctgaatgaccacctagagccttggatccagg
A0A4X1SQU7_BCL2L1-      aacttggatggccacttacctgaatgaccacctagagccttggatccagg
A0A4X1SQU7_BCL2L1-      aacttggatggccacttacctgaatgaccacctagagccttggatccagg
A0A4X1SQU7_BCL2L1-      ----------------------------------------------cagg

A0A4X1SQU7_BCL2L1-      agaacggcggctgggacacttttgtggaactctacggaaacaatgcagca
O77737_BCL2L1-01        agaacggcggctgggacacttttgtggaactctacggaaacaatgcagca
A0A4X1SQU7_BCL2L1-      agaacggcggctgggacacttttgtggaactctacggaaacaatgcagca
A0A4X1SQU7_BCL2L1-      agaacggcggctgggacacttttgtggaactctacggaaacaatgcagca
A0A4X1SQU7_BCL2L1-      agaacggcggctgggacacttttgtggaactctacggaaacaatgcagca
A0A4X1SQU7_BCL2L1-      agaacggcggctgggacacttttgtggaactctacggaaacaatgcagca

A0A4X1SQU7_BCL2L1-      gctgagagccggaagggccaggagcgcttcaaccgatgg-ccctgtggct
O77737_BCL2L1-01        gctgagagccggaagggccaggaacgcttcaaccgatggttcctg-----
A0A4X1SQU7_BCL2L1-      gctgagagccggaagggccaggagcgcttcaaccgatggttcctg-----
A0A4X1SQU7_BCL2L1-      gctgagagccggaagggccaggagcgcttcaaccgatggttcctg-----
A0A4X1SQU7_BCL2L1-      gctgagagccggaagggccaggagcgcttcaaccgatggttcctg-----
A0A4X1SQU7_BCL2L1-      gctgagagccggaagggccaggagcgcttcaaccgatggttcctg-----
                        *********************** ***************  ****     

A0A4X1SQU7_BCL2L1-      ccaaccctccagtagaaacccaaacagaaacaggcagctctcactcagtt
O77737_BCL2L1-01        -----------------------------acgggca-------------t
A0A4X1SQU7_BCL2L1-      -----------------------------acgggca-------------t
A0A4X1SQU7_BCL2L1-      -----------------------------acgggca-------------t
A0A4X1SQU7_BCL2L1-      -----------------------------acgggca-------------t
A0A4X1SQU7_BCL2L1-      -----------------------------acgggca-------------t
                                                     ** ****             *

A0A4X1SQU7_BCL2L1-      gatctgatccagggagcccctgagattctgcccagacacaaacacctgca
O77737_BCL2L1-01        gactctagctggggtg----------------------------------
A0A4X1SQU7_BCL2L1-      gactctagctggggtg----------------------------------
A0A4X1SQU7_BCL2L1-      gactctagctggggtg----------------------------------
A0A4X1SQU7_BCL2L1-      gactctagctggggtg----------------------------------
A0A4X1SQU7_BCL2L1-      gactctagctggggtg----------------------------------
                        **    * *  *** *                                  

A0A4X1SQU7_BCL2L1-      acaggatctcagcatcctgccggtaagaccctttccccaccccacgccgt
O77737_BCL2L1-01        -------------gttctgctgg-------------------------gt
A0A4X1SQU7_BCL2L1-      -------------gttctgctgg-------------------------gt
A0A4X1SQU7_BCL2L1-      -------------gttctgctgg-------------------------gt
A0A4X1SQU7_BCL2L1-      -------------gttctgctgg-------------------------gt
A0A4X1SQU7_BCL2L1-      -------------gttctgctgg-------------------------gt
                                      * **** **                         **

A0A4X1SQU7_BCL2L1-      tcaggtttcatgcaggacccacttccgtcccctcagaccagaggagacaa
O77737_BCL2L1-01        tcg----------------ctcttcagtc-------------ggaaatga
A0A4X1SQU7_BCL2L1-      tcg----------------ctcttcagtc-------------ggaaatga
A0A4X1SQU7_BCL2L1-      tcg----------------ctcttcagtc-------------ggaaatga
A0A4X1SQU7_BCL2L1-      tcg----------------ctcttcagtc-------------ggaaatga
A0A4X1SQU7_BCL2L1-      tcg----------------ctcttcagtc-------------ggaaatga
                        **                 * **** ***             *** *  *

A0A4X1SQU7_BCL2L1-      ctgaggaagacgtag
O77737_BCL2L1-01        ---------------
A0A4X1SQU7_BCL2L1-      ---------------
A0A4X1SQU7_BCL2L1-      ---------------
A0A4X1SQU7_BCL2L1-      ---------------
A0A4X1SQU7_BCL2L1-      ---------------

© 1998-2021Legal notice