Dataset for CDS MCL-1 of organism Amphiprion percula

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A3P8RQX7_MCL1-02      atgaatatgattccgacgacgacgaagaggacggcgttcatgaactactt
A0A3P8RQX7_MCL1-01      atgaatatgattccgacgacgacgaagaggacggcgttcatgaactactt

A0A3P8RQX7_MCL1-02      aatttttcctcaaaatggagtcgtggagggaccgatgcactatggatccg
A0A3P8RQX7_MCL1-01      aatttttcctcaaaatggagtcgtggagggaccgatgcactatggatccg

A0A3P8RQX7_MCL1-02      gagattcctccccgcagattgccgtggcctcctccatagactctcacaac
A0A3P8RQX7_MCL1-01      gagattcctccccgcagattgccgtggcctcctccatagactctcacaac

A0A3P8RQX7_MCL1-02      gggaatgttggctccagtgaaaccccaaaacggccgaagaacctgggagt
A0A3P8RQX7_MCL1-01      gggaatgttggctccagtgaaaccccaaaacggccgaagaacctgggagt

A0A3P8RQX7_MCL1-02      gaatgggtatgcgtccaaaaaccttcgacaagacagcgacagtatggagg
A0A3P8RQX7_MCL1-01      gaatgggtatgcgtccaaaaaccttcgacaagacagcgacagtatggagg

A0A3P8RQX7_MCL1-02      agggctctttaccgtgcaccccggagctgcagtcggacagtgaaaccgac
A0A3P8RQX7_MCL1-01      agggctctttaccgtgcaccccggagctgcagtcggacagtgaaaccgac

A0A3P8RQX7_MCL1-02      gtctccagttgtccagcaggagacgagttgctggagaatgacacgaggca
A0A3P8RQX7_MCL1-01      gtctccagttgtccagcaggagacgagttgctggagaatgacacgaggca

A0A3P8RQX7_MCL1-02      actccttcgccgtttcttaagagactttactggactttcaaagccccggt
A0A3P8RQX7_MCL1-01      actccttcgccgtttcttaagagactttactggactttcaaagccccggt

A0A3P8RQX7_MCL1-02      ggaatgaaagcaaagcattatcaacaatgaaaagagttgtggatgacgtt
A0A3P8RQX7_MCL1-01      ggaatgaaagcaaagcattatcaacaatgaaaagagttgtggatgacgtt

A0A3P8RQX7_MCL1-02      ttggacaaacacagatacgcatacaatggtatgatcaacaaactgtcgct
A0A3P8RQX7_MCL1-01      ttggacaaacacagatacgcatacaatggtatgatcaacaaactgtcgct

A0A3P8RQX7_MCL1-02      ggatgacagaggggatgatgtgtcgtttgtcagtgcagtagccaagagcc
A0A3P8RQX7_MCL1-01      ggatgacagaggggatgatgtgtcgtttgtcagtgcagtagccaagagcc

A0A3P8RQX7_MCL1-02      tctttgcagacaggacgaccaactggggtcgtattacgagcctggtggcc
A0A3P8RQX7_MCL1-01      tctttgcagacaggacgaccaactggggtcgtattacgagcctggtggcc

A0A3P8RQX7_MCL1-02      tttggggcggtggtatgtcagtacctgaaggagaggggcagggagaactg
A0A3P8RQX7_MCL1-01      tttggggcggtggtatgtcagtacctgaaggagaggggcagggagaactg

A0A3P8RQX7_MCL1-02      cgtggacctggtcagccaggagatttccacatacctgctttctgaacagc
A0A3P8RQX7_MCL1-01      cgtggacctggtcagccaggagatttccacatacctgctttctgaacagc

A0A3P8RQX7_MCL1-02      gagactggctggtcaaaaacaactcatgggatggttttgtggagtttttt
A0A3P8RQX7_MCL1-01      gagactggctggtcaaaaacaactcatgggatggttttgtggagtttttt

A0A3P8RQX7_MCL1-02      cgagtagcagaccctgagttgacggtcaggaacacactcatggcctttgc
A0A3P8RQX7_MCL1-01      cgagtagcagaccctgagttgacggtcaggaacacactcatggcctttgc

A0A3P8RQX7_MCL1-02      tggatttgctggtattggggcaacactggccctgctgatcaggtga
A0A3P8RQX7_MCL1-01      tggatttgctggtattggggcaacactggccctgctgatcaggtga

© 1998-2020Legal notice