Dataset for CDS BCL2L10 of organism Haplochromis burtoni

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A3Q2UUN9_BCL2L10      atgatttatggattatttgtcacccttttttgtaccataccaaaccatga
A0A3Q2UUN9_BCL2L10      atgatttatggattatttgtcacccttttttgtaccataccaaaccatga

A0A3Q2UUN9_BCL2L10      ccacacttccgctggttattccgtggcggtggtgtcttctttccacagtc
A0A3Q2UUN9_BCL2L10      ccacacttccgctggttattccgtggcggtggtgtcttctttccacagtc

A0A3Q2UUN9_BCL2L10      cacacgacgttcccagcacaaaaatcatgtcgagaggcggagtcacgcat
A0A3Q2UUN9_BCL2L10      cacacgacgttcccagcacaaaaatcatgtcgagaggcggagtcacgcat

A0A3Q2UUN9_BCL2L10      tctgcatcagctgaagggaagactcaactgtaccgacgctctccttccgc
A0A3Q2UUN9_BCL2L10      tctgcatcagctgaagggaagactcaactgtaccgacgctctccttccgc

A0A3Q2UUN9_BCL2L10      cgtctgtatgtgcagagagcagtctgatatcgctgggaggaaaatgaaat
A0A3Q2UUN9_BCL2L10      cgtctgtatgtgcagagagcagtctgatatcgctgggaggaaaatgaaat

A0A3Q2UUN9_BCL2L10      tctgtgggctgtggaaagagaccctggttttggccgaggactacctgtcc
A0A3Q2UUN9_BCL2L10      tctgtgggctgtggaaagagaccctggttttggccgaggactacctgtcc

A0A3Q2UUN9_BCL2L10      ttttgctgcacgagtccacatcaagcccctccacctcccagcgaatcagc
A0A3Q2UUN9_BCL2L10      ttttgctgcacgagtccacatcaagcccctccacctcccagcgaatcagc

A0A3Q2UUN9_BCL2L10      cgctgccatgaggcgtctaggctgggacatcgaaagacagcaccaagctc
A0A3Q2UUN9_BCL2L10      cgctgccatgaggcgtctaggctgggacatcgaaagacagcaccaagctc

A0A3Q2UUN9_BCL2L10      gcttcgacaacctcgctcagaccttcctggtgcagtgtggaccggaccac
A0A3Q2UUN9_BCL2L10      gcttcgacaacctcgctcagaccttcctggtgcagtgtggaccggaccac

A0A3Q2UUN9_BCL2L10      tgcctcagcctcagaaaggtgatgaaggagctggttggagatggacactt
A0A3Q2UUN9_BCL2L10      tgcctcagcctcagaaaggtgatgaaggagctggttggagatggacactt

A0A3Q2UUN9_BCL2L10      gaactgggggagggttgtttctcttttcgcctttactggagtgctggcca
A0A3Q2UUN9_BCL2L10      gaactgggggagggttgtttctcttttcgcctttactggagtgctggcca

A0A3Q2UUN9_BCL2L10      gaaagatcctggagcagaagccggggctggaccctcgtcaacagcaggaa
A0A3Q2UUN9_BCL2L10      gaaagatcctggagcagaagccggggctggaccctcgtcaacagcaggaa

A0A3Q2UUN9_BCL2L10      ctgggacaggagcccatgagctgcagaaggctggcagagaccatagctga
A0A3Q2UUN9_BCL2L10      ctgggacaggagcccatgagctgcagaaggctggcagagaccatagctga

A0A3Q2UUN9_BCL2L10      ttacctgggagaagagaagaaagactggctgttggataatgatggatggg
A0A3Q2UUN9_BCL2L10      ttacctgggagaagagaagaaagactggctgttggataatgatggatggg

A0A3Q2UUN9_BCL2L10      aaggcttctgtaagttctcccgcagtgccagagaagtgagccaggactca
A0A3Q2UUN9_BCL2L10      aaggcttctgtaagttctcccgcagtgccagagaagtgagccaggactca

A0A3Q2UUN9_BCL2L10      tccatgaagaaagcgctgtttgctgccgccggtgtcggccttgctgggct
A0A3Q2UUN9_BCL2L10      tccatgaagaaagcgctgtttgctgccgccggtgtcggccttgctgggct

A0A3Q2UUN9_BCL2L10      taccttcctcttggtgcgctag
A0A3Q2UUN9_BCL2L10      taccttcctcttg------tga
                        *************      *  

© 1998-2020Legal notice