Dataset for CDS BCL-2-like of organism Sus scrofa

[Download (right click)] [Alignment] [Repertoires]

12 sequence(s)

>gnl|bcl2dbcds|A0A287ATE4_BCL2L2-03 BCL2-like 2 gene OS=[Eukaryota] Sus scrofa GN=BCL2L2 (length=972 residues).
atggcgaccccggcctcagccccagacacacgggctctagtggcagactttgtgggctataagctgaggcagaagggtta
tgtctgtggagctggccccggggagggcccagcagctgacccgctgcaccaagccatgcgggcagctggagatgagttcg
agacccgcttccggcgcaccttctcagatttggcagctcagttgcatgtgaccccgggctcggcccagcagcgcttcacc
caggtctctgatgaactcttccaaggaggccccaactggggccgccttgtggccttctttgtcttcggagctgcactgtg
tgctgagagtgtcaataaggagatggagccactcgtgggacaagtgcaggagtggatggtgacctacctggagacacggc
tggccgactggatccacagcagtgggggctgggagctggaagcgatcaaagctcgagtcagggagatggaggaagaagct
gagaagctaaaggagctacagaacgaagtagagaagcagatgaatatgagtccaccaccaggcaatgctggcccagttat
catgtccattgaggagaagatggaggcagatgcccgatctatctatgttggcaatgtggactatggtgcaacagcagaag
agctggaagcacactttcatggctgtggttcagtcaaccgcgttactatactctgtgacaaatttagtggccatcccaaa
gggtttgcatatatagagttctcagacaaagagtcagtgaggacttccttggccttagatgagtccctatttagaggaag
acaaatcaaggtgatcccaaaacgaaccaacagaccaggcatcagcacaacagaccggggttttccacgagctcgatacc
gtgcccggaccaccaactacaacagttcccgctctcgattctacagtggttttaacagcaggccccggggtcgtgtctac
aggtcaggatag
>gnl|bcl2dbcds|A0A287ATE4_BCL2L2-01 BCL2-like 2 gene OS=[Eukaryota] Sus scrofa GN=BCL2L2 (length=1002 residues).
atggcgaccccggcctcagccccagacacacgggctctagtggcagactttgtgggctataagctgaggcagaagggtta
tgtctgtggagctggccccggggagggcccagcagctgacccgctgcaccaagccatgcgggcagctggagatgagttcg
agacccgcttccggcgcaccttctcagatttggcagctcagttgcatgtgaccccgggctcggcccagcagcgcttcacc
caggtctctgatgaactcttccaaggaggccccaactggggccgccttgtggccttctttgtcttcggagctgcactgtg
tgctgagagtgtcaataaggagatggagccactcgtgggacaagtgcaggagtggatggtgacctacctggagacacggc
tggccgactggatccacagcagtgggggctgggagctggaagcgatcaaagctcgagtcagggagatggaggaagaagct
gagaagctaaaggagctacagaacgaagtagagaagcagatgaatatgagtccaccaccaggcaatgctggcccagttat
catgtccattgaggagaagatggaggcagatgcccgatctatctatgttggcaatgtggactatggtgcaacagcagaag
agctggaagcacactttcatggctgtggttcagtcaaccgcgttactatactctgtgacaaatttagtggccatcccaaa
gggtttgcatatatagagttctcagacaaagagtcagtgaggacttccttggccttagatgagtccctatttagaggaag
acaaatcaaggtgatcccaaaacgaaccaacagaccaggcatcagcacaacagaccggggttttccacgagctcgatacc
gtgcccggaccaccaactacaacagttcccgctctcgattctacagtggttttaacagcaggccccggggtcgtgtctac
aggggccgggctagagcgacatcatggtattccccttactaa
>gnl|bcl2dbcds|A0A287ATE4_BCL2L2-05 BCL2-like 2 gene OS=[Eukaryota] Sus scrofa GN=BCL2L2 (length=582 residues).
atggcgaccccggcctcagccccagacacacgggctctagtggcagactttgtgggctataagctgaggcagaagggtta
tgtctgtggagctggccccggggagggcccagcagctgacccgctgcaccaagccatgcgggcagctggagatgagttcg
agacccgcttccggcgcaccttctcagatttggcagctcagttgcatgtgaccccgggctcggcccagcagcgcttcacc
caggtctctgatgaactcttccaaggaggccccaactggggccgccttgtggccttctttgtcttcggagctgcactgtg
tgctgagagtgtcaataaggagatggagccactcgtgggacaagtgcaggagtggatggtgacctacctggagacacggc
tggccgactggatccacagcagtgggggctgggcggagttcacagctctatacggggacggggccctggaggaggcgcgg
cgtctgcgggaggggaactgggcctcagtgaggacagtgctgacgggggccgtggcactgggggccctggtaactgtagg
ggccttttttgctagcaagtga
>gnl|bcl2dbcds|A0A287BK44_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Sus scrofa GN=MCL-1 (length=1011 residues).
atgtttggcctccagagaaacgcagtaatcggactcaacctctactgtgggggggccggattggggcctggaagcggcag
cagcgcctccgctccgggaggccgtctcttggctacgggaaaagaggccacggcccggcaagaggtagggggaggggaag
ccggcatggtgattggcggaagcgccggcgcgagccccccgtccactcctgcgccagacgcccggagggtcgcgcggccc
tcgcccattggcgccgagggccccgacgtcaccgcgacccccgccagactgctgttcttcgcgcccacccgcctcgcgtc
gccgcctgaagagatggaatccccggcctccgacgccatcatgtctcccgaagaggagctggacgggtacgagccggagc
ccctcgggaagcggccggccgtcctgcccttgctggggttagtcgaggaggccagtagtggccccggcacggacggctcg
ctcccctcgacgccgcccccggcagaggaggaggaggacgagttataccggcagtccctggagattatctctcggtacct
tcgggagcaggcaaccggcgccaaggacgcgaagccaatgggcgggtctggggccgccagccggaaggcgttagagaccc
tgcgacgggtcggggacggggtgcagcgcaaccacgagacggccttccaaggcatgcttcggaaactggacatcaaaaac
gaagacgatgtcaaatctttgtctcgagtgatggtccacgttttcagtgacggagtaacaaactggggcaggattgtgac
tcttatttcttttggtgcctttgtggccaaacacttgaagagtataaatcaagaaagctgcatcgaaccgttagcagaaa
gcatcacagatgttctcgtaaggacaaaacgagactggctagtcaaacaaagaggctgggatgggtttgtggagttcttc
catgtagaggacctagaaggcggcatcagatctaataagatagccttttaa
>gnl|bcl2dbcds|A0A287BK44_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Sus scrofa GN=MCL-1 (length=1056 residues).
atgtttggcctccagagaaacgcagtaatcggactcaacctctactgtgggggggccggattggggcctggaagcggcag
cagcgcctccgctccgggaggccgtctcttggctacgggaaaagaggccacggcccggcaagaggtagggggaggggaag
ccggcatggtgattggcggaagcgccggcgcgagccccccgtccactcctgcgccagacgcccggagggtcgcgcggccc
tcgcccattggcgccgagggccccgacgtcaccgcgacccccgccagactgctgttcttcgcgcccacccgcctcgcgtc
gccgcctgaagagatggaatccccggcctccgacgccatcatgtctcccgaagaggagctggacgggtacgagccggagc
ccctcgggaagcggccggccgtcctgcccttgctggggttagtcgaggaggccagtagtggccccggcacggacggctcg
ctcccctcgacgccgcccccggcagaggaggaggaggacgagttataccggcagtccctggagattatctctcggtacct
tcgggagcaggcaaccggcgccaaggacgcgaagccaatgggcgggtctggggccgccagccggaaggcgttagagaccc
tgcgacgggtcggggacggggtgcagcgcaaccacgagacggccttccaaggcatgcttcggaaactggacatcaaaaac
gaagacgatgtcaaatctttgtctcgagtgatggtccacgttttcagtgacggagtaacaaactggggcaggattgtgac
tcttatttcttttggtgcctttgtggccaaacacttgaagagtataaatcaagaaagctgcatcgaaccgttagcagaaa
gcatcacagatgttctcgtaaggacaaaacgagactggctagtcaaacaaagaggctgggatgggtttgtggagttcttc
catgtagaggacctagaaggcggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggc
atatctaataagatag
>gnl|bcl2dbcds|A0A3Q9B4M8_BCL2L2-01 BCL2-like 2 gene OS=[Eukaryota] Sus scrofa GN=BCL2L2 (length=582 residues).
atggcgaccccggcctcagccccagacacacgggctctagtggcagactttgtgggctataagatgaggcagaagggtta
tgtctgtggagctggccccggggagggcccagcagctgacccgctgcaccaagccatgcgggcagctggagatgagttcg
agacccgcttccggcgcaccttctcagatttggcagctcagttgcatgtgaccccgggctcggcccagcagcgcttcacc
caggtctctgatgaactcttccaagggggccccaactggggccgccttgtggccttctttgtcttcggagctgcactgtg
tgctgagagtgtcaataaggagatggagccactcgtgggacaagtgccggagtggatggtgacctacctggagacacggc
tggccgactggatccacagcagtgggggctgggcggagttcacagctctatacggggacggggccctggaggaggcgcgg
cgtctgcgggaggggaactgggcctcagtgaggacagtgctgacgggggccgtggcactgggggccctggtaactgtagg
ggccttttttgctagcaagtga
>gnl|bcl2dbcds|A0A482LX62_BCL2L2-01 BCL2-like 2 gene OS=[Eukaryota] Sus scrofa GN=BCL2L2 (length=573 residues).
atggcgaccccggcctcagccccagacacacgggctctagtggcagactttgtgggctataagctgaggcagaagggtta
tgtctgtggagctggccccggggagggcccagcagctgacccgctgcaccaagccatgcgggcagctggagatgagttcg
agacccgcttccggcgcaccttctcagatttggcagctcagttgcatgtgaccccgggctcggcccagcagcgcttcacc
caggtctctgatgaactcttccaagggggccccaactggggccgccttgtggccttctttgtcttcggagctgcactgtg
tgctgagagtgtcaataaggagatggagccactcgtgggacaagtgcaggagtggatggtgacctacctggagacacggc
tggccgactggatccacagcagcgcttcacccaggtctctgatgaactcttccaaggaggccccaactggggccgccttg
tggccttctttgtcttcggagctgcactgtgtgctgagagtgtcaataaggagatggagccactcgtgggacaagtgcag
gagtggatggtga
>gnl|bcl2dbcds|A0A4D6NWN1_BCL2L2-01 BCL2-like 2 gene OS=[Eukaryota] Sus scrofa GN=BCL2L2 (length=1002 residues).
atggcgaccccggcctcagccccagacacacgggctctagtggcagactttgtgggctataagctgaggcagaagggtta
tgtctgtggagctggccccggggagggcccagcagctgacccgctgcaccaagccatgcgggcagctggagatgagttcg
agacccgcttccggcgcaccttctcagatttggcagctcagttgcatgtgaccccgggctcggcccagcagcgcttcacc
caggtctctgatgaactcttccaagggggccccaactggggccgccttgtggccttctttgtcttcggagctgcactgtg
tgctgagagtgtcaataaggagatggagccactcgtgggacaagtgcaggagtggatggtgacctacctggagtcacggc
tggccgactggatccacagcagtgggggctgggagctggaagcgatcaaagctcgagtcagggagatggaggaagaagct
gagaagctaaaggagctacagaacgaagtagagaagcagatgaatatgagtccaccaccaggcaatgctggcccagttat
catgtccattgaggagaagatggaggcagatgcccgatctatctatgttggcaatgtggactatggtgcaacagcagaag
agctggaagcacactttcatggctgtggttcagtcaaccgcgttactatactctgtgacaaatttagtggccatcccaaa
gggtttgcatatatagagttctcagacaaagagtcagtgaggacttccttggccttagatgagtccctatttagaggaag
acaaatcaaggtgatcccaaaacgaaccaacagaccaggcatcagcacaacagaccggggttttccacgagctcgatacc
gtgcccggaccaccaactacaacagttcccgctctcgattctacagtggttttaacagcaggccccggggtcgtgtctac
aggggccgggctagagcgacatcatggtattccccttactaa
>gnl|bcl2dbcds|C7F841_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Sus scrofa GN=BCL2A1 (length=528 residues).
atgactgacgacgagtttggatatattcacatgctggcccaggactatctgaagtatgtcctgcagataccacaacctgg
atctggtccaagcaaaacatctagagtgttacgagacgtggctttctccgtccaaaacgaagttgaaaagaatttgaaac
catgcttggacaattttgatgttgtgtccatagacactgccagaataatattcaatcaagtgatggaaaaggaatttgaa
gatggcatcattaactggggaaggattgtgaccatatttgcatttgaaggtattctcatgaagaaacttctgcgaaagcg
aattgccccagatgtggacacgtacaaggagatttcttactttgtcgccgagttcatcaccaaaaacacaggacagtgga
taaggcaaaacggaggctgggaaaatggctttgtaaagaagtttgaacccaaatctggctggctgacctttgtggaagtt
acaggaaagatctgtgaaatgttatgtctcctgaagcaatactattga
>gnl|bcl2dbcds|F1RZB9_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Sus scrofa GN=BCL2L10 (length=555 residues).
atggcggacgcgttcagggagcgcacagcccggcttctgaccgactacctggagtactgcgcccgggagcccggcaccgc
cgcgcggcagccgtcctcgcccgaggccgcagtgctgcgttgcgtggctgcccagatacgggagtacaacgtgcgcacct
tgtctgtctaccgcggcttccgctggaaccgtgtcgaattggtggcctggatggcacagaaactactcgcaagcccacgt
ggccccaactggtaccgcgtggcatcactcttgaccttcgcagggatgctgctggaaagacatcctcgggaggcctgtgg
gcggaagaagaaggagggcaacgttagcagggactgccgactcctggtggctttgctgtgcgctcagctctcagggcagc
atcgcacctggctattggcgaacggcggctgggatggattttgtctcttcttccaaggttcattgcaacaaacttggaca
agacacatggtctgggtttttgtgtcatactgtacagcagtggtcttactctacttgtggagaaaattattgtga
>gnl|bcl2dbcds|O77737_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Sus scrofa GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tactgatgtggaagagaacagaactgaggccccagaagggactgaatcagaagcggaaacccctagtgccatcaatggca
acccatcctggcacctggcggacagccccgcggtgaatggagccactggccacagcagcagcttggatgcccgggaggtg
atccccatggctgcagtgaagcaagcgctgagggaggcgggcgatgagtttgaactgaggtaccggagggcattcagtga
cctgacgtcccagctccacatcaccccagggacagcgtatcagagctttgagcaggtattgaacgaactcttccgggatg
gggtgaactggggtcgcattgtggcctttttctccttcggtggggcactgtgcgtggagagcgtagacaaggagatgcag
gtattggtgagtcggatcgcaacttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggacacttttgtggaactctacggaaacaatgcagcagctgagagccggaagggccaggaacgcttcaaccgatggt
tcctgacgggcatgactctagctggggtggttctgctgggttcgctcttcagtcggaaatga
>gnl|bcl2dbcds|Q95KR3_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Sus scrofa GN=MCL-1 (length=459 residues).
atgtttggcctccagagaaacgcagtaatcggactcaacctctactgtgggggggccggattggggcctggaagcggcag
cagcgccttccaaggcatgcttcggaaactggacatcaaaaacgaagacgatgtcaaatctttgtctcgagtgatggtcc
acgttttaagtgacggagtaacaaactggggcaggattgtgactcttatttcttttggtgcctttgtggccaaacacttg
aagagtataaatcaagaaagctgcatcgaaccgttagcagaaagcatcacagatgttctcgtaaggacaaaacgagactg
gctagtcaaacaaagaggctgggatgggtttgtggagttcttccatgtagaggacctagaaggcggcatcagaaatgtgc
tgctggcttttgcaggtgttgctggagtaggagctggtttggcatatctaataagatag
© 1998-2020Legal notice