Dataset for CDS BCL-2-like of organism Sus scrofa

[Download (right click)] [Edit] [Sequences] [Repertoires]

12 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


C7F841_BCL2A1-01        atgactgacgacgagtttggatatattcacatg----ctggccc-aggac
O77737_BCL2L1-01        atg-----------tctcagagc-----aaccgggagctggtgg-ttgac
F1RZB9_BCL2L10-01       atggc-ggacgcgttcagggagcgcacagcccggcttctga----ccgac
Q95KR3_MCL1-01          atg------tttggcct-----ccagagaaacg-----cagtaatcggac
A0A287BK44_MCL1-02      atg------tttggcct-----ccagagaaacg-----cagtaatcggac
A0A287BK44_MCL1-01      atg------tttggcct-----ccagagaaacg-----cagtaatcggac
A0A287ATE4_BCL2L2-      atggc-gaccccggcctcagccccagacacacgggctctagtgg-cagac
A0A3Q9B4M8_BCL2L2-      atggc-gaccccggcctcagccccagacacacgggctctagtgg-cagac
A0A482LX62_BCL2L2-      atggc-gaccccggcctcagccccagacacacgggctctagtgg-cagac
A0A4D6NWN1_BCL2L2-      atggc-gaccccggcctcagccccagacacacgggctctagtgg-cagac
A0A287ATE4_BCL2L2-      atggc-gaccccggcctcagccccagacacacgggctctagtgg-cagac
A0A287ATE4_BCL2L2-      atggc-gaccccggcctcagccccagacacacgggctctagtgg-cagac
                        ***                             *              ***

C7F841_BCL2A1-01        tatctgaagtatgtcctg-----cagataccacaacct------------
O77737_BCL2L1-01        tttctctcctacaagctttcccagaaaggatacagctggagtcagtttac
F1RZB9_BCL2L10-01       tacct------------------ggagtactgcgcccgg-----------
Q95KR3_MCL1-01          tcaac---ctctactgtgggggggccggattggggcctg-----------
A0A287BK44_MCL1-02      tcaac---ctctactgtgggggggccggattggggcctg-----------
A0A287BK44_MCL1-01      tcaac---ctctactgtgggggggccggattggggcctg-----------
A0A287ATE4_BCL2L2-      tttgtgggctataagctgaggcagaagggttatgtctgt-----------
A0A3Q9B4M8_BCL2L2-      tttgtgggctataagatgaggcagaagggttatgtctgt-----------
A0A482LX62_BCL2L2-      tttgtgggctataagctgaggcagaagggttatgtctgt-----------
A0A4D6NWN1_BCL2L2-      tttgtgggctataagctgaggcagaagggttatgtctgt-----------
A0A287ATE4_BCL2L2-      tttgtgggctataagctgaggcagaagggttatgtctgt-----------
A0A287ATE4_BCL2L2-      tttgtgggctataagctgaggcagaagggttatgtctgt-----------
                        *                                  *              

C7F841_BCL2A1-01        ----------------------------------------------ggat
O77737_BCL2L1-01        tgatgtggaagagaacagaactgaggccccagaagggactgaatcagaag
F1RZB9_BCL2L10-01       ----------------------------------------------gagc
Q95KR3_MCL1-01          ----------------------------------------------gaag
A0A287BK44_MCL1-02      ----------------------------------------------gaag
A0A287BK44_MCL1-01      ----------------------------------------------gaag
A0A287ATE4_BCL2L2-      ----------------------------------------------ggag
A0A3Q9B4M8_BCL2L2-      ----------------------------------------------ggag
A0A482LX62_BCL2L2-      ----------------------------------------------ggag
A0A4D6NWN1_BCL2L2-      ----------------------------------------------ggag
A0A287ATE4_BCL2L2-      ----------------------------------------------ggag
A0A287ATE4_BCL2L2-      ----------------------------------------------ggag
                                                                      *   

C7F841_BCL2A1-01        ctggtcca------------------------------------------
O77737_BCL2L1-01        cggaaacccctagtgccatcaatggcaacccatcctggcacctggcggac
F1RZB9_BCL2L10-01       ccggcacc------------------------------------gccgcg
Q95KR3_MCL1-01          cgg-----------------------------------------------
A0A287BK44_MCL1-02      cgg-----------------------------------------------
A0A287BK44_MCL1-01      cgg-----------------------------------------------
A0A287ATE4_BCL2L2-      ctggcccc------------------------------------ggggag
A0A3Q9B4M8_BCL2L2-      ctggcccc------------------------------------ggggag
A0A482LX62_BCL2L2-      ctggcccc------------------------------------ggggag
A0A4D6NWN1_BCL2L2-      ctggcccc------------------------------------ggggag
A0A287ATE4_BCL2L2-      ctggcccc------------------------------------ggggag
A0A287ATE4_BCL2L2-      ctggcccc------------------------------------ggggag
                        * *                                               

C7F841_BCL2A1-01        agcaaaacatctaga-----------gtgttacgagacgtggctttctcc
O77737_BCL2L1-01        agccccgcggtgaatggagccactggccacagcagcagcttggatgcccg
F1RZB9_BCL2L10-01       ----cggcagccgtcctcgcccgaggccgcagtgctgcgttg--cgt---
Q95KR3_MCL1-01          ----cagcagc---------------------------------------
A0A287BK44_MCL1-02      ----cagcagcgcct-----------ccgctccgggaggccgtctct---
A0A287BK44_MCL1-01      ----cagcagcgcct-----------ccgctccgggaggccgtctct---
A0A287ATE4_BCL2L2-      ggcccagcagctgac-----------ccgctgcaccaagcca--tgc---
A0A3Q9B4M8_BCL2L2-      ggcccagcagctgac-----------ccgctgcaccaagcca--tgc---
A0A482LX62_BCL2L2-      ggcccagcagctgac-----------ccgctgcaccaagcca--tgc---
A0A4D6NWN1_BCL2L2-      ggcccagcagctgac-----------ccgctgcaccaagcca--tgc---
A0A287ATE4_BCL2L2-      ggcccagcagctgac-----------ccgctgcaccaagcca--tgc---
A0A287ATE4_BCL2L2-      ggcccagcagctgac-----------ccgctgcaccaagcca--tgc---
                               *                                          

C7F841_BCL2A1-01        gtccaa--------------------------------aacgaagttgaa
O77737_BCL2L1-01        ggaggtgatccccatggctgcagtgaagcaagcgctgagggaggcgggcg
F1RZB9_BCL2L10-01       --------------------------------------ggctgcccagat
Q95KR3_MCL1-01          --------------------------------------------------
A0A287BK44_MCL1-02      --------------------------------------tggctacgggaa
A0A287BK44_MCL1-01      --------------------------------------tggctacgggaa
A0A287ATE4_BCL2L2-      --------------------------------------gggcagctggag
A0A3Q9B4M8_BCL2L2-      --------------------------------------gggcagctggag
A0A482LX62_BCL2L2-      --------------------------------------gggcagctggag
A0A4D6NWN1_BCL2L2-      --------------------------------------gggcagctggag
A0A287ATE4_BCL2L2-      --------------------------------------gggcagctggag
A0A287ATE4_BCL2L2-      --------------------------------------gggcagctggag
                                                                          

C7F841_BCL2A1-01        aagaatttgaaac-------------------------------------
O77737_BCL2L1-01        atgagtttgaactgag----------------------------------
F1RZB9_BCL2L10-01       acgggagtacaacgtg----------------------------------
Q95KR3_MCL1-01          --------------------------------------------------
A0A287BK44_MCL1-02      aagaggccacggcccggcaagaggtagggggaggggaagccggcatggtg
A0A287BK44_MCL1-01      aagaggccacggcccggcaagaggtagggggaggggaagccggcatggtg
A0A287ATE4_BCL2L2-      atgagttcgagacccg----------------------------------
A0A3Q9B4M8_BCL2L2-      atgagttcgagacccg----------------------------------
A0A482LX62_BCL2L2-      atgagttcgagacccg----------------------------------
A0A4D6NWN1_BCL2L2-      atgagttcgagacccg----------------------------------
A0A287ATE4_BCL2L2-      atgagttcgagacccg----------------------------------
A0A287ATE4_BCL2L2-      atgagttcgagacccg----------------------------------
                                                                          

C7F841_BCL2A1-01        --------------------------------------------------
O77737_BCL2L1-01        --------------------------------------------------
F1RZB9_BCL2L10-01       --------------------------------------------------
Q95KR3_MCL1-01          --------------------------------------------------
A0A287BK44_MCL1-02      attggcggaagcgccggcgcgagccccccgtccactcctgcgccagacgc
A0A287BK44_MCL1-01      attggcggaagcgccggcgcgagccccccgtccactcctgcgccagacgc
A0A287ATE4_BCL2L2-      --------------------------------------------------
A0A3Q9B4M8_BCL2L2-      --------------------------------------------------
A0A482LX62_BCL2L2-      --------------------------------------------------
A0A4D6NWN1_BCL2L2-      --------------------------------------------------
A0A287ATE4_BCL2L2-      --------------------------------------------------
A0A287ATE4_BCL2L2-      --------------------------------------------------
                                                                          

C7F841_BCL2A1-01        --------------------------------------------------
O77737_BCL2L1-01        --------------------------------------------------
F1RZB9_BCL2L10-01       --------------------------------------------------
Q95KR3_MCL1-01          --------------------------------------------------
A0A287BK44_MCL1-02      ccggagggtcgcgcggccctcgcccattggcgccgagggccccgacgtca
A0A287BK44_MCL1-01      ccggagggtcgcgcggccctcgcccattggcgccgagggccccgacgtca
A0A287ATE4_BCL2L2-      --------------------------------------------------
A0A3Q9B4M8_BCL2L2-      --------------------------------------------------
A0A482LX62_BCL2L2-      --------------------------------------------------
A0A4D6NWN1_BCL2L2-      --------------------------------------------------
A0A287ATE4_BCL2L2-      --------------------------------------------------
A0A287ATE4_BCL2L2-      --------------------------------------------------
                                                                          

C7F841_BCL2A1-01        --------------------------------catgcttggacaattttg
O77737_BCL2L1-01        -------------------------gtaccggagggcattcagtgacctg
F1RZB9_BCL2L10-01       --------------------------------cgcaccttgtctgtct--
Q95KR3_MCL1-01          --------------------------------------------------
A0A287BK44_MCL1-02      ccgcgacccccgccagactgctgttcttcgcgcccacccgcctcgcgtcg
A0A287BK44_MCL1-01      ccgcgacccccgccagactgctgttcttcgcgcccacccgcctcgcgtcg
A0A287ATE4_BCL2L2-      -------------------------cttccggcgcaccttctcagatttg
A0A3Q9B4M8_BCL2L2-      -------------------------cttccggcgcaccttctcagatttg
A0A482LX62_BCL2L2-      -------------------------cttccggcgcaccttctcagatttg
A0A4D6NWN1_BCL2L2-      -------------------------cttccggcgcaccttctcagatttg
A0A287ATE4_BCL2L2-      -------------------------cttccggcgcaccttctcagatttg
A0A287ATE4_BCL2L2-      -------------------------cttccggcgcaccttctcagatttg
                                                                          

C7F841_BCL2A1-01        atgt----------tgtgtccatagacactgccagaataata--------
O77737_BCL2L1-01        acgtcccagctccacatcaccccagggacagcg-----------------
F1RZB9_BCL2L10-01       ------------------accgcggcttccgctggaaccgtgtc------
Q95KR3_MCL1-01          --------------------------------------------------
A0A287BK44_MCL1-02      ccgcctgaagagatggaatccccggcctccgacgccatcatgtctcccga
A0A287BK44_MCL1-01      ccgcctgaagagatggaatccccggcctccgacgccatcatgtctcccga
A0A287ATE4_BCL2L2-      gcagctcagttgcatgtgaccccgggctcggcc-----------------
A0A3Q9B4M8_BCL2L2-      gcagctcagttgcatgtgaccccgggctcggcc-----------------
A0A482LX62_BCL2L2-      gcagctcagttgcatgtgaccccgggctcggcc-----------------
A0A4D6NWN1_BCL2L2-      gcagctcagttgcatgtgaccccgggctcggcc-----------------
A0A287ATE4_BCL2L2-      gcagctcagttgcatgtgaccccgggctcggcc-----------------
A0A287ATE4_BCL2L2-      gcagctcagttgcatgtgaccccgggctcggcc-----------------
                                                                          

C7F841_BCL2A1-01        -------------------------------ttcaatcaa----------
O77737_BCL2L1-01        ----------------------tatcagagctttgagcag----------
F1RZB9_BCL2L10-01       -gaattggtggcctggatggcacagaaactactcgcaag-----------
Q95KR3_MCL1-01          --------------------------------------------------
A0A287BK44_MCL1-02      agaggagctggacgggtacgagccggagcccctcgggaagcggccggccg
A0A287BK44_MCL1-01      agaggagctggacgggtacgagccggagcccctcgggaagcggccggccg
A0A287ATE4_BCL2L2-      ----------------------cagcagcgcttcacccag----------
A0A3Q9B4M8_BCL2L2-      ----------------------cagcagcgcttcacccag----------
A0A482LX62_BCL2L2-      ----------------------cagcagcgcttcacccag----------
A0A4D6NWN1_BCL2L2-      ----------------------cagcagcgcttcacccag----------
A0A287ATE4_BCL2L2-      ----------------------cagcagcgcttcacccag----------
A0A287ATE4_BCL2L2-      ----------------------cagcagcgcttcacccag----------
                                                                          

C7F841_BCL2A1-01        ----gtgatggaaaaggaatttgaagatggcatcattaactggggaagga
O77737_BCL2L1-01        ----gtattgaacgaactcttccgggatggggtg---aactggggtcgca
F1RZB9_BCL2L10-01       ---------------------cccacgtggcccc---aactggtaccgcg
Q95KR3_MCL1-01          --------------------------------------------------
A0A287BK44_MCL1-02      tcctgcccttgctggggttagtcgaggaggccag---tagtggccccggc
A0A287BK44_MCL1-01      tcctgcccttgctggggttagtcgaggaggccag---tagtggccccggc
A0A287ATE4_BCL2L2-      ----gtctctgatgaactcttccaaggaggcccc---aactggggccgcc
A0A3Q9B4M8_BCL2L2-      ----gtctctgatgaactcttccaagggggcccc---aactggggccgcc
A0A482LX62_BCL2L2-      ----gtctctgatgaactcttccaagggggcccc---aactggggccgcc
A0A4D6NWN1_BCL2L2-      ----gtctctgatgaactcttccaagggggcccc---aactggggccgcc
A0A287ATE4_BCL2L2-      ----gtctctgatgaactcttccaaggaggcccc---aactggggccgcc
A0A287ATE4_BCL2L2-      ----gtctctgatgaactcttccaaggaggcccc---aactggggccgcc
                                                                          

C7F841_BCL2A1-01        ttgtgaccatatttgcatttgaag--------------------------
O77737_BCL2L1-01        ttgtggcctttttctccttcggtggggcact-------------------
F1RZB9_BCL2L10-01       tggcatcactcttgaccttcgcag--------------------------
Q95KR3_MCL1-01          --------------------------------------------------
A0A287BK44_MCL1-02      acggacggctcgctcccctcgacgccgcccccggcagaggaggaggagga
A0A287BK44_MCL1-01      acggacggctcgctcccctcgacgccgcccccggcagaggaggaggagga
A0A287ATE4_BCL2L2-      ttgtggccttctttgtcttcggagctgcact-------------------
A0A3Q9B4M8_BCL2L2-      ttgtggccttctttgtcttcggagctgcact-------------------
A0A482LX62_BCL2L2-      ttgtggccttctttgtcttcggagctgcact-------------------
A0A4D6NWN1_BCL2L2-      ttgtggccttctttgtcttcggagctgcact-------------------
A0A287ATE4_BCL2L2-      ttgtggccttctttgtcttcggagctgcact-------------------
A0A287ATE4_BCL2L2-      ttgtggccttctttgtcttcggagctgcact-------------------
                                                                          

C7F841_BCL2A1-01        ----gtattctcatg-----------------------------------
O77737_BCL2L1-01        ----gtgcgtggagagc---------------------------------
F1RZB9_BCL2L10-01       ----ggatgctgctgg----------------------------------
Q95KR3_MCL1-01          --------------------------------------------------
A0A287BK44_MCL1-02      cgagttataccggcagtccctggagattatctctcggtaccttcgggagc
A0A287BK44_MCL1-01      cgagttataccggcagtccctggagattatctctcggtaccttcgggagc
A0A287ATE4_BCL2L2-      ----gtgtgctgagagt---------------------------------
A0A3Q9B4M8_BCL2L2-      ----gtgtgctgagagt---------------------------------
A0A482LX62_BCL2L2-      ----gtgtgctgagagt---------------------------------
A0A4D6NWN1_BCL2L2-      ----gtgtgctgagagt---------------------------------
A0A287ATE4_BCL2L2-      ----gtgtgctgagagt---------------------------------
A0A287ATE4_BCL2L2-      ----gtgtgctgagagt---------------------------------
                                                                          

C7F841_BCL2A1-01        --------------aagaaacttctgcgaaagcgaat-------------
O77737_BCL2L1-01        --------gtagacaaggagat------gcaggtatt-------------
F1RZB9_BCL2L10-01       --------------aaagacatcctcgggaggcctgt-------------
Q95KR3_MCL1-01          --------------------------------------------------
A0A287BK44_MCL1-02      aggcaaccggcgccaaggacgc------gaagccaatgggcgggtctggg
A0A287BK44_MCL1-01      aggcaaccggcgccaaggacgc------gaagccaatgggcgggtctggg
A0A287ATE4_BCL2L2-      --------gtcaataaggagat------ggagccact-------------
A0A3Q9B4M8_BCL2L2-      --------gtcaataaggagat------ggagccact-------------
A0A482LX62_BCL2L2-      --------gtcaataaggagat------ggagccact-------------
A0A4D6NWN1_BCL2L2-      --------gtcaataaggagat------ggagccact-------------
A0A287ATE4_BCL2L2-      --------gtcaataaggagat------ggagccact-------------
A0A287ATE4_BCL2L2-      --------gtcaataaggagat------ggagccact-------------
                                                                          

C7F841_BCL2A1-01        ----------------------------tgccccagatgtggacacgtac
O77737_BCL2L1-01        --------------------------ggtgagtcggatcgcaacttggat
F1RZB9_BCL2L10-01       ------------------------------------gggcggaagaagaa
Q95KR3_MCL1-01          --------------------------------------------------
A0A287BK44_MCL1-02      gccgccagccggaaggcgttagagaccctgcgacgggtcggggacggggt
A0A287BK44_MCL1-01      gccgccagccggaaggcgttagagaccctgcgacgggtcggggacggggt
A0A287ATE4_BCL2L2-      --------------------------cgtgggacaagtgcaggagtggat
A0A3Q9B4M8_BCL2L2-      --------------------------cgtgggacaagtgccggagtggat
A0A482LX62_BCL2L2-      --------------------------cgtgggacaagtgcaggagtggat
A0A4D6NWN1_BCL2L2-      --------------------------cgtgggacaagtgcaggagtggat
A0A287ATE4_BCL2L2-      --------------------------cgtgggacaagtgcaggagtggat
A0A287ATE4_BCL2L2-      --------------------------cgtgggacaagtgcaggagtggat
                                                                          

C7F841_BCL2A1-01        aagga----------gatttcttactttgtcgccgagttcatc-accaaa
O77737_BCL2L1-01        ---------------ggccacttacctgaa--------tgaccacctaga
F1RZB9_BCL2L10-01       ggagggcaacgttagcagggactgcc--gactcctggtggctttgctgtg
Q95KR3_MCL1-01          -------------------gccttcc--aaggcatgcttcggaaactgga
A0A287BK44_MCL1-02      gcagcgcaaccacgagacggccttcc--aaggcatgcttcggaaactgga
A0A287BK44_MCL1-01      gcagcgcaaccacgagacggccttcc--aaggcatgcttcggaaactgga
A0A287ATE4_BCL2L2-      ---------------ggtgacctacctggagacacggctggccgactgga
A0A3Q9B4M8_BCL2L2-      ---------------ggtgacctacctggagacacggctggccgactgga
A0A482LX62_BCL2L2-      ---------------ggtgacctacctggagacacggctggccgactgga
A0A4D6NWN1_BCL2L2-      ---------------ggtgacctacctggagtcacggctggccgactgga
A0A287ATE4_BCL2L2-      ---------------ggtgacctacctggagacacggctggccgactgga
A0A287ATE4_BCL2L2-      ---------------ggtgacctacctggagacacggctggccgactgga
                                              * *                    *    

C7F841_BCL2A1-01        aacacaggacagtggat-------------aaggcaaaacggaggctggg
O77737_BCL2L1-01        gcct------------------------------------tggatccagg
F1RZB9_BCL2L10-01       cgctcagctctcagggc------------agcatcgcacctggctattgg
Q95KR3_MCL1-01          -catcaaaaacgaagac------------gatgtcaaatctttgtctcga
A0A287BK44_MCL1-02      -catcaaaaacgaagac------------gatgtcaaatctttgtctcga
A0A287BK44_MCL1-01      -catcaaaaacgaagac------------gatgtcaaatctttgtctcga
A0A287ATE4_BCL2L2-      tccacagcagtgggggctgggcg------gagttcacagctctatacggg
A0A3Q9B4M8_BCL2L2-      tccacagcagtgggggctgggcg------gagttcacagctctatacggg
A0A482LX62_BCL2L2-      tccacagcagc---------------------------gcttcacccagg
A0A4D6NWN1_BCL2L2-      tccacagcagtgggggctgggagctggaagcgatcaaagctcgagtcagg
A0A287ATE4_BCL2L2-      tccacagcagtgggggctgggagctggaagcgatcaaagctcgagtcagg
A0A287ATE4_BCL2L2-      tccacagcagtgggggctgggagctggaagcgatcaaagctcgagtcagg
                                                                        * 

C7F841_BCL2A1-01        aaaatgg-------------------------------------------
O77737_BCL2L1-01        agaacgg-------------------------------------------
F1RZB9_BCL2L10-01       cgaacgg-------------------------------------------
Q95KR3_MCL1-01          gtgatgg-------------------------------------------
A0A287BK44_MCL1-02      gtgatgg-------------------------------------------
A0A287BK44_MCL1-01      gtgatgg-------------------------------------------
A0A287ATE4_BCL2L2-      gacgggg-------------------------------------------
A0A3Q9B4M8_BCL2L2-      gacgggg-------------------------------------------
A0A482LX62_BCL2L2-      --------------------------------tct---------------
A0A4D6NWN1_BCL2L2-      gagatggaggaagaagctgagaagctaaaggagctacagaacgaagtaga
A0A287ATE4_BCL2L2-      gagatggaggaagaagctgagaagctaaaggagctacagaacgaagtaga
A0A287ATE4_BCL2L2-      gagatggaggaagaagctgagaagctaaaggagctacagaacgaagtaga
                                                                          

C7F841_BCL2A1-01        --------------------------------------------------
O77737_BCL2L1-01        --------------------------------------------------
F1RZB9_BCL2L10-01       --------------------------------------------------
Q95KR3_MCL1-01          -------------------------------------------tccacgt
A0A287BK44_MCL1-02      -------------------------------------------tccacgt
A0A287BK44_MCL1-01      -------------------------------------------tccacgt
A0A287ATE4_BCL2L2-      --------------------------------------------------
A0A3Q9B4M8_BCL2L2-      --------------------------------------------------
A0A482LX62_BCL2L2-      ----ctgatgaac-------------------------------------
A0A4D6NWN1_BCL2L2-      gaagcagatgaatatgagtccaccaccaggcaatgctggcccagttatca
A0A287ATE4_BCL2L2-      gaagcagatgaatatgagtccaccaccaggcaatgctggcccagttatca
A0A287ATE4_BCL2L2-      gaagcagatgaatatgagtccaccaccaggcaatgctggcccagttatca
                                                                          

C7F841_BCL2A1-01        -ctttgtaaagaag---------tttgaacccaaatctggctggctgacc
O77737_BCL2L1-01        -------------------------------------cggctgggacact
F1RZB9_BCL2L10-01       -------------------------------------cggctgggatgg-
Q95KR3_MCL1-01          tttaagtgacggag-------------------taacaaactggggcagg
A0A287BK44_MCL1-02      tttcagtgacggag-------------------taacaaactggggcagg
A0A287BK44_MCL1-01      tttcagtgacggag-------------------taacaaactggggcagg
A0A287ATE4_BCL2L2-      ---ccctggaggag---------------gcgcggcgtctgcgggagggg
A0A3Q9B4M8_BCL2L2-      ---ccctggaggag---------------gcgcggcgtctgcgggagggg
A0A482LX62_BCL2L2-      --tcttccaaggag-------------------gccccaactggggccgc
A0A4D6NWN1_BCL2L2-      tgtccattgaggagaagatggaggcagatgcccgatctatctatgttggc
A0A287ATE4_BCL2L2-      tgtccattgaggagaagatggaggcagatgcccgatctatctatgttggc
A0A287ATE4_BCL2L2-      tgtccattgaggagaagatggaggcagatgcccgatctatctatgttggc
                                                                          

C7F841_BCL2A1-01        tttgtggaagtta-------------------------------------
O77737_BCL2L1-01        tttgtggaactctacggaaacaatgcagcagctg------------agag
F1RZB9_BCL2L10-01       attttgtctcttcttcc------aaggttcattgcaacaaacttggacaa
Q95KR3_MCL1-01          attgtgactcttatttcttttggtgcctttgtggccaaacacttgaagag
A0A287BK44_MCL1-02      attgtgactcttatttcttttggtgcctttgtggccaaacacttgaagag
A0A287BK44_MCL1-01      attgtgactcttatttcttttggtgcctttgtggccaaacacttgaagag
A0A287ATE4_BCL2L2-      aac-tgggcctcagtg------------------------------agga
A0A3Q9B4M8_BCL2L2-      aac-tgggcctcagtg------------------------------agga
A0A482LX62_BCL2L2-      cttgtggccttctttg-------------------------tcttcggag
A0A4D6NWN1_BCL2L2-      aatgtggactatggtgcaacagcagaagagctggaagcacactttcatgg
A0A287ATE4_BCL2L2-      aatgtggactatggtgcaacagcagaagagctggaagcacactttcatgg
A0A287ATE4_BCL2L2-      aatgtggactatggtgcaacagcagaagagctggaagcacactttcatgg
                            **                                            

C7F841_BCL2A1-01        ----------caggaaagatctgtgaaatgttatgt--------------
O77737_BCL2L1-01        ccggaagggccaggaacgcttcaaccgatggttcctgacgggcatgactc
F1RZB9_BCL2L10-01       gacacatggtctgggtttttgtgtcatactgta-----------------
Q95KR3_MCL1-01          ta---taaatcaagaaagctgcatcgaaccgttagcagaaagcatcacag
A0A287BK44_MCL1-02      ta---taaatcaagaaagctgcatcgaaccgttagcagaaagcatcacag
A0A287BK44_MCL1-01      ta---taaatcaagaaagctgcatcgaaccgttagcagaaagcatcacag
A0A287ATE4_BCL2L2-      ca---gtgctgacgggggccgtggc--actgggggc------cctggtaa
A0A3Q9B4M8_BCL2L2-      ca---gtgctgacgggggccgtggc--actgggggc------cctggtaa
A0A482LX62_BCL2L2-      ct---g------------------c--actgtgtgc------tg------
A0A4D6NWN1_BCL2L2-      ct---gtggttcagtcaaccgcgtt--actatactc------tgtgacaa
A0A287ATE4_BCL2L2-      ct---gtggttcagtcaaccgcgtt--actatactc------tgtgacaa
A0A287ATE4_BCL2L2-      ct---gtggttcagtcaaccgcgtt--actatactc------tgtgacaa
                                                   *                      

C7F841_BCL2A1-01        --------------------------------------------------
O77737_BCL2L1-01        tag-----------------------------------------------
F1RZB9_BCL2L10-01       --------------------------------------------------
Q95KR3_MCL1-01          atgttctcgtaaggacaaaacg-------agactggctagtcaaacaaag
A0A287BK44_MCL1-02      atgttctcgtaaggacaaaacg-------agactggctagtcaaacaaag
A0A287BK44_MCL1-01      atgttctcgtaaggacaaaacg-------agactggctagtcaaacaaag
A0A287ATE4_BCL2L2-      ctgta---------------------------------------------
A0A3Q9B4M8_BCL2L2-      ctgta---------------------------------------------
A0A482LX62_BCL2L2-      ----------------------------------------------agag
A0A4D6NWN1_BCL2L2-      atttagtggccatcccaaagggtttgcatatatagagttctcagacaaag
A0A287ATE4_BCL2L2-      atttagtggccatcccaaagggtttgcatatatagagttctcagacaaag
A0A287ATE4_BCL2L2-      atttagtggccatcccaaagggtttgcatatatagagttctcagacaaag
                                                                          

C7F841_BCL2A1-01        -------------------------------------ctcctgaagcaat
O77737_BCL2L1-01        ---ctggggtggttct-----------gctgggttcgctcttcagtcgga
F1RZB9_BCL2L10-01       ---cagcagtggtctt---------------actctacttgtggagaaaa
Q95KR3_MCL1-01          aggctgggatgggttt-----------gtggagttcttccatgtagagga
A0A287BK44_MCL1-02      aggctgggatgggttt-----------gtggagttcttccatgtagagga
A0A287BK44_MCL1-01      aggctgggatgggttt-----------gtggagttcttccatgtagagga
A0A287ATE4_BCL2L2-      -----------------------------ggggccttttttgctag----
A0A3Q9B4M8_BCL2L2-      -----------------------------ggggccttttttgctag----
A0A482LX62_BCL2L2-      tgtcaataagg--------------agatggagcc--actcgtggga---
A0A4D6NWN1_BCL2L2-      agtcagtgaggacttccttggccttagatgagtccctatttagaggaaga
A0A287ATE4_BCL2L2-      agtcagtgaggacttccttggccttagatgagtccctatttagaggaaga
A0A287ATE4_BCL2L2-      agtcagtgaggacttccttggccttagatgagtccctatttagaggaaga
                                                                          

C7F841_BCL2A1-01        a-------------------------------------------------
O77737_BCL2L1-01        --------------------------------------------------
F1RZB9_BCL2L10-01       --------------------------------------------------
Q95KR3_MCL1-01          cctagaagg--------------------------cggcatcagaaatgt
A0A287BK44_MCL1-02      cctagaagg--------------------------cggcatcag------
A0A287BK44_MCL1-01      cctagaagg--------------------------cggcatcagaaatgt
A0A287ATE4_BCL2L2-      --------------------------------------------------
A0A3Q9B4M8_BCL2L2-      --------------------------------------------------
A0A482LX62_BCL2L2-      --------------------------------------------------
A0A4D6NWN1_BCL2L2-      caaatcaaggtgatcccaaaacgaaccaacagaccaggcatcagcacaac
A0A287ATE4_BCL2L2-      caaatcaaggtgatcccaaaacgaaccaacagaccaggcatcagcacaac
A0A287ATE4_BCL2L2-      caaatcaaggtgatcccaaaacgaaccaacagaccaggcatcagcacaac
                                                                          

C7F841_BCL2A1-01        -------------------------------------------------c
O77737_BCL2L1-01        --------------------------------------------------
F1RZB9_BCL2L10-01       -------------------------------------------------t
Q95KR3_MCL1-01          gctgctggcttttgcaggtgttgctggagtaggagctggtttggcatatc
A0A287BK44_MCL1-02      -----------------------------------------------atc
A0A287BK44_MCL1-01      gctgctggcttttgcaggtgttgctggagtaggagctggtttggcatatc
A0A287ATE4_BCL2L2-      -------------------------------------------------c
A0A3Q9B4M8_BCL2L2-      -------------------------------------------------c
A0A482LX62_BCL2L2-      -------------------------------------------------c
A0A4D6NWN1_BCL2L2-      agaccggggttttccacgagct-------cgataccgtgcccggaccacc
A0A287ATE4_BCL2L2-      agaccggggttttccacgagct-------cgataccgtgcccggaccacc
A0A287ATE4_BCL2L2-      agaccggggttttccacgagct-------cgataccgtgcccggaccacc
                                                                          

C7F841_BCL2A1-01        tattga--------------------------------------------
O77737_BCL2L1-01        -aatga--------------------------------------------
F1RZB9_BCL2L10-01       tattgtga------------------------------------------
Q95KR3_MCL1-01          taataagatag---------------------------------------
A0A287BK44_MCL1-02      taataagatagccttttaa-------------------------------
A0A287BK44_MCL1-01      taataagatag---------------------------------------
A0A287ATE4_BCL2L2-      aagtga--------------------------------------------
A0A3Q9B4M8_BCL2L2-      aagtga--------------------------------------------
A0A482LX62_BCL2L2-      aagtgcaggagt--------------------------------------
A0A4D6NWN1_BCL2L2-      aactacaacagttcccgctctcgattctacagtggttttaacagcaggcc
A0A287ATE4_BCL2L2-      aactacaacagttcccgctctcgattctacagtggttttaacagcaggcc
A0A287ATE4_BCL2L2-      aactacaacagttcccgctctcgattctacagtggttttaacagcaggcc
                         * *                                              

C7F841_BCL2A1-01        --------------------------------------------------
O77737_BCL2L1-01        --------------------------------------------------
F1RZB9_BCL2L10-01       --------------------------------------------------
Q95KR3_MCL1-01          --------------------------------------------------
A0A287BK44_MCL1-02      --------------------------------------------------
A0A287BK44_MCL1-01      --------------------------------------------------
A0A287ATE4_BCL2L2-      --------------------------------------------------
A0A3Q9B4M8_BCL2L2-      --------------------------------------------------
A0A482LX62_BCL2L2-      ---ggatggtga--------------------------------------
A0A4D6NWN1_BCL2L2-      ccggggtcgtgtctacaggggccgggctagagcgacatcatggtattccc
A0A287ATE4_BCL2L2-      ccggggtcgtgtctaca--ggtcaggatag--------------------
A0A287ATE4_BCL2L2-      ccggggtcgtgtctacaggggccgggctagagcgacatcatggtattccc
                                                                          

C7F841_BCL2A1-01        --------
O77737_BCL2L1-01        --------
F1RZB9_BCL2L10-01       --------
Q95KR3_MCL1-01          --------
A0A287BK44_MCL1-02      --------
A0A287BK44_MCL1-01      --------
A0A287ATE4_BCL2L2-      --------
A0A3Q9B4M8_BCL2L2-      --------
A0A482LX62_BCL2L2-      --------
A0A4D6NWN1_BCL2L2-      cttactaa
A0A287ATE4_BCL2L2-      --------
A0A287ATE4_BCL2L2-      cttactaa
                                

© 1998-2020Legal notice