Dataset for CDS BCL-2-like of organism Sus scrofa

[Download (right click)] [Edit] [Sequences] [Repertoires]

90 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8D1N411_BCL2L10      atggcggacgcgttcagggagcgcacagcccgg-----------------
A0A8D1ITC0_BCL2L10      atggcggacgcgttcagggagcgcacagcccgg-----------------
A0A4X1T1Z2_BCL2L10      atggcggacgcgttcagggagcgcacagcccgg-----------------
A0A8D1QEZ6_BCL2L10      atggcggacgcgttcagggagcgcacagcccgg-----------------
A0A8D1ALD6_BCL2L1-      atgtc----------------tcagagcaaccgggag-------------
A0A4X1SQU7_BCL2L1-      atgtc----------------tcagagcaaccgggag-------------
A0A8D0XF62_BCL2L1-      atgtc----------------tcagagcaaccgggag-------------
O77737_BCL2L1-01        atgtc----------------tcagagcaaccgggag-------------
A0A8D0J6V8_BCL2L1-      atgtc----------------tcagagcaaccgggag-------------
A0A8D0J6V8_BCL2L1-      atgtc----------------tcagagcaaccgggag-------------
A0A8D0J6V8_BCL2L1-      atgtc----------------tcagagcaaccgggag-------------
A0A8D0J6V8_BCL2L1-      atgtc----------------tcagagcaaccgggag-------------
A0A8D0J6V8_BCL2L1-      atgtc----------------tcagagcaaccgggag-------------
A0A4X1SQU7_BCL2L1-      atgtc----------------tcagagcaaccgggag-------------
A0A4X1SQU7_BCL2L1-      atgtc----------------tcagagcaaccgggag-------------
A0A4X1SQU7_BCL2L1-      atgtc----------------tcagagcaaccgggag-------------
A0A4X1SRM7_BCL2L1-      atgtc----------------tcagagcaaccgggag-------------
A0A8D0XF62_BCL2L1-      atgtc----------------tcagagcaaccgggag-------------
A0A8D1ALD6_BCL2L1-      atgtc----------------tcagagcaaccgggag-------------
A0A4X1SQU7_BCL2L1-      atgtc----------------tcagagcaaccgggag-------------
A0A4X1SF63_BCL2L2-      atggcggcggcggcggcggcggcagcagcagcggggg-------------
A0A4X1SF63_BCL2L2-      atggcggcggcggcggcggcggcagcagcagcggggg-------------
A0A8D0TJQ9_BCL2L2-      atggcggcggcggcggcggcggcagcagcagcggggg-------------
A0A482LX62_BCL2L2-      atggcgaccccggcctcagccccagacaca-cgggct-------------
A0A3Q9B4M8_BCL2L2-      atggcgaccccggcctcagccccagacaca-cgggct-------------
A0A7T8CLX7_BCL2L2-      --------------------------------------------------
A0A8D0TJQ9_BCL2L2-      atggcgaccccggcctcagccccagacaca-cgggct-------------
A0A4X1SF60_BCL2L2-      atggcgaccccggcctcagccccagacaca-cgggct-------------
A0A4X1SF63_BCL2L2-      atggcgaccccggcctcagccccagacaca-cgggct-------------
A0A8D0TJQ9_BCL2L2-      atggcgaccccggcctcagccccagacaca-cgggct-------------
A0A4X1SF63_BCL2L2-      atggcgaccccggcctcagccccagacaca-cgggct-------------
A0A4D6NWN1_BCL2L2-      atggcgaccccggcctcagccccagacaca-cgggct-------------
A0A4X1SF60_BCL2L2-      atggcgaccccggcctcagccccagacaca-cgggct-------------
A0A4X1SF63_BCL2L2-      atggcgaccccggcctcagccccagacaca-cgggct-------------
A0A8D0TJQ9_BCL2L2-      atggcgaccccggcctcagccccagacaca-cgggct-------------
A0A4X1SF60_BCL2L2-      atggcgaccccggcctcagccccagacaca-cgggct-------------
A0A8D0TJQ9_BCL2L2-      atggcgaccccggcctcagccccagacaca-cgggct-------------
A0A8D0QLD9_BCL2-03      atggc-----------------gcacgctgggagaacagggtatgataac
A0A4X1TRR9_BCL2-01      atggc-----------------gcacgctgggagaacagggtatgataac
A0A8D0QLD9_BCL2-01      atggc-----------------gcacgctgggagaacagggtatgataac
A0A4X1TRR9_BCL2-03      atggc-----------------gcacgctgggagaacagggtatgataac
A0A8D1BRF8_BCL2A1-      atggc---------------------ggcggcg-----------------
A0A8D0Z1Y4_BCL2A1-      atggc---------------------ggcggcg-----------------
A0A8D1SK15_BCL2A1-      atggc---------------------ggcggcg-----------------
A0A4X1UP21_BCL2A1-      atggc---------------------ggcggcg-----------------
A0A8D1BRF8_BCL2A1-      atggc---------------------ggcggcg-----------------
A0A8D1YBS8_BCL2A1-      atggc---------------------ggcggcg-----------------
A0A4X1UP21_BCL2A1-      atgac--------------------tgacgacgagtttggatatattc-a
A0A4X1UQW5_BCL2A1-      atgac--------------------tgacgacgagtttggatatattc-a
A0A8D0Z1Y4_BCL2A1-      atgac--------------------tgacgacgagtttggatatattc-a
A0A8D1BRF8_BCL2A1-      atgac--------------------tgacgacgagtttggatatattc-a
A0A8D1SK15_BCL2A1-      atgac--------------------tgacgacgagtttggatatattc-a
A0A8D1YBS8_BCL2A1-      atgac--------------------tgacgacgagtttggatatattc-a
C7F841_BCL2A1-01        atgac--------------------tgacgacgagtttggatatattc-a
A0A8D1KPD1_BCL2A1-      atgac--------------------tgacgacgagtttggatatattc-a
A0A8D1BRF8_BCL2A1-      atgac--------------------tgacgacgagtttggatatattc-a
A0A4X1UP21_BCL2A1-      atgac--------------------tgacgacgagtttggatatattc-a
A0A8D1SK15_BCL2A1-      atgac--------------------tgacgacgagtttggatatattc-a
A0A8D0Z1Y4_BCL2A1-      atgac--------------------tgacgacgagtttggatatattc-a
A0A8D1YBS8_BCL2A1-      atgac--------------------tgacgacgagtttggatatattc-a
Q95KR3_MCL1-01          atgtt--------------------------------------tggcctc
A0A8D1FTD4_MCL1-03      atgtt--------------------------------------tggcctc
A0A8D1G1G8_MCL1-04      atgtt--------------------------------------tggcctc
A0A4X1SEZ6_MCL1-01      atgtt--------------------------------------tggcctc
A0A4X1SFB1_MCL1-01      atgtt--------------------------------------tggcctc
A0A8D1FTD4_MCL1-01      atgtt--------------------------------------tggcctc
A0A8D1G1G8_MCL1-02      atgtt--------------------------------------tggcctc
A0A8D1RYD1_MCL1-01      atgtt--------------------------------------tggcctc
A0A4X1SEU3_MCL1-02      atgtt--------------------------------------tggcctc
A0A4X1SEZ6_MCL1-03      atgtt--------------------------------------tggcctc
A0A4X1SFB1_MCL1-02      atgtt--------------------------------------tggcctc
A0A8D1FTD4_MCL1-05      atgtt--------------------------------------tggcctc
A0A8D1G1G8_MCL1-01      atgtt--------------------------------------tggcctc
A0A8D1RYD1_MCL1-03      atgtt--------------------------------------tggcctc
A0A4X1SEU3_MCL1-01      atgtt--------------------------------------tggcctc
A0A8D1G1G8_MCL1-03      atgtt--------------------------------------tggcctc
A0A8D1FTD4_MCL1-02      atgtt--------------------------------------tggcctc
A0A8D1RYD1_MCL1-02      atgtt--------------------------------------tggcctc
A0A4X1SEZ6_MCL1-02      atgtt--------------------------------------tggcctc
A0A8D1FTD4_MCL1-04      atgtt--------------------------------------tggcctc
A0A8D0QLD9_BCL2-07      atgctgctgctggctgccgccttcctcgtggcgttcgtgctgctgctcta
A0A4X1TRR9_BCL2-06      atgctgctgctggctgccgccttcctcgtggcgttcgtgctgctgctcta
A0A8D0QLD9_BCL2-05      atgctgctgctggctgccgccttcctcgtggcgttcgtgctgctgctcta
A0A4X1TRR9_BCL2-05      atgctgctgctggctgccgccttcctcgtggcgttcgtgctgctgctcta
A0A8D0QLD9_BCL2-04      atgctgctgctggctgccgccttcctcgtggcgttcgtgctgctgctcta
A0A4X1TRR9_BCL2-07      atgctgctgctggctgccgccttcctcgtggcgttcgtgctgctgctcta
A0A8D0QLD9_BCL2-06      atgctgctgctggctgccgccttcctcgtggcgttcgtgctgctgctcta
A0A4X1TRR9_BCL2-04      atgctgctgctggctgccgccttcctcgtggcgttcgtgctgctgctcta
A0A4X1TRR9_BCL2-02      atgctgctgctggctgccgccttcctcgtggcgttcgtgctgctgctcta
A0A8D0QLD9_BCL2-02      atgctgctgctggctgccgccttcctcgtggcgttcgtgctgctgctcta
                                                                          

A0A8D1N411_BCL2L10      ------cttctgaccgactacctggagtac----------tgcgcccgtg
A0A8D1ITC0_BCL2L10      ------cttctgaccgactacctggagtac----------tgcgcccggg
A0A4X1T1Z2_BCL2L10      ------cttctgaccgactacctggagtac----------tgcgcccggg
A0A8D1QEZ6_BCL2L10      ------cttctgaccgactacctggagtac----------tgcgcccggg
A0A8D1ALD6_BCL2L1-      ------ctggtggttgactttctctcctacaagc------tttcccagaa
A0A4X1SQU7_BCL2L1-      ------ctggtggttgactttctctcctacaagc------tttcccagaa
A0A8D0XF62_BCL2L1-      ------ctggtggttgactttctctcctacaagc------tttcccagaa
O77737_BCL2L1-01        ------ctggtggttgactttctctcctacaagc------tttcccagaa
A0A8D0J6V8_BCL2L1-      ------ctggtggttgactttctctcctacaagc------tttcccagaa
A0A8D0J6V8_BCL2L1-      ------ctggtggttgactttctctcctacaagc------tttcccagaa
A0A8D0J6V8_BCL2L1-      ------ctggtggttgactttctctcctacaagc------tttcccagaa
A0A8D0J6V8_BCL2L1-      ------ctggtggttgactttctctcctacaagc------tttcccagaa
A0A8D0J6V8_BCL2L1-      ------ctggtggttgactttctctcctacaagc------tttcccagaa
A0A4X1SQU7_BCL2L1-      ------ctggtggttgactttctctcctacaagc------tttcccagaa
A0A4X1SQU7_BCL2L1-      ------ctggtggttgactttctctcctacaagc------tttcccagaa
A0A4X1SQU7_BCL2L1-      ------ctggtggttgactttctctcctacaagc------tttcccagaa
A0A4X1SRM7_BCL2L1-      ------ctggtggttgactttctctcctacaagc------tttcccagaa
A0A8D0XF62_BCL2L1-      ------ctggtggttgactttctctcctacaagc------tttcccagaa
A0A8D1ALD6_BCL2L1-      ------ctggtggttgactttctctcctacaagc------tttcccagaa
A0A4X1SQU7_BCL2L1-      ------ctggtggttgactttctctcctacaagc------tttcccagaa
A0A4X1SF63_BCL2L2-      ------ct----gcgggcggtcggggctccgggc------cggggcggcg
A0A4X1SF63_BCL2L2-      ------ct----gcgggcggtcggggctccgggc------cggggcggcg
A0A8D0TJQ9_BCL2L2-      ------ct----gcgggcggtcggggctccgggc------cggggcggcg
A0A482LX62_BCL2L2-      ------ctagtggcagactttgtgggctataagc------tgaggcagaa
A0A3Q9B4M8_BCL2L2-      ------ctagtggcagactttgtgggctataaga------tgaggcagaa
A0A7T8CLX7_BCL2L2-      --------------------------------------------------
A0A8D0TJQ9_BCL2L2-      ------ctagtggcagactttgtgggctataagc------tgaggcagaa
A0A4X1SF60_BCL2L2-      ------ctagtggcagactttgtgggctataagc------tgaggcagaa
A0A4X1SF63_BCL2L2-      ------ctagtggcagactttgtgggctataagc------tgaggcagaa
A0A8D0TJQ9_BCL2L2-      ------ctagtggcagactttgtgggctataagc------tgaggcagaa
A0A4X1SF63_BCL2L2-      ------ctagtggcagactttgtgggctataagc------tgaggcagaa
A0A4D6NWN1_BCL2L2-      ------ctagtggcagactttgtgggctataagc------tgaggcagaa
A0A4X1SF60_BCL2L2-      ------ctagtggcagactttgtgggctataagc------tgaggcagaa
A0A4X1SF63_BCL2L2-      ------ctagtggcagactttgtgggctataagc------tgaggcagaa
A0A8D0TJQ9_BCL2L2-      ------ctagtggcagactttgtgggctataagc------tgaggcagaa
A0A4X1SF60_BCL2L2-      ------ctagtggcagactttgtgggctataagc------tgaggcagaa
A0A8D0TJQ9_BCL2L2-      ------ctagtggcagactttgtgggctataagc------tgaggcagaa
A0A8D0QLD9_BCL2-03      cgggaaatagtgatgaagtacatccactataagc------tgtcgcagag
A0A4X1TRR9_BCL2-01      cgggaaatagtgatgaagtacatccactataagc------tgtcgcagag
A0A8D0QLD9_BCL2-01      cgggaaatagtgatgaagtacatccactataagc------tgtcgcagag
A0A4X1TRR9_BCL2-03      cgggaaatagtgatgaagtacatccactataagc------tgtcgcagag
A0A8D1BRF8_BCL2A1-      --------------------------------------------------
A0A8D0Z1Y4_BCL2A1-      --------------------------------------------------
A0A8D1SK15_BCL2A1-      --------------------------------------------------
A0A4X1UP21_BCL2A1-      --------------------------------------------------
A0A8D1BRF8_BCL2A1-      --------------------------------------------------
A0A8D1YBS8_BCL2A1-      --------------------------------------------------
A0A4X1UP21_BCL2A1-      c-----atgctggcccag----------------------gactatctga
A0A4X1UQW5_BCL2A1-      c-----atgctggcccag----------------------gactatctga
A0A8D0Z1Y4_BCL2A1-      c-----atgctggcccag----------------------gactatctga
A0A8D1BRF8_BCL2A1-      c-----atgctggcccag----------------------gactatctga
A0A8D1SK15_BCL2A1-      c-----atgctggcccag----------------------gactatctga
A0A8D1YBS8_BCL2A1-      c-----atgctggcccag----------------------gactatctga
C7F841_BCL2A1-01        c-----atgctggcccag----------------------gactatctga
A0A8D1KPD1_BCL2A1-      c-----atgctggcccag----------------------gactatctga
A0A8D1BRF8_BCL2A1-      c-----atgctggcccag----------------------gactatctga
A0A4X1UP21_BCL2A1-      c-----atgctggcccag----------------------gactatctga
A0A8D1SK15_BCL2A1-      c-----atgctggcccag----------------------gactatctga
A0A8D0Z1Y4_BCL2A1-      c-----atgctggcccag----------------------gactatctga
A0A8D1YBS8_BCL2A1-      c-----atgctggcccag----------------------gactatctga
Q95KR3_MCL1-01          c-----agagaaacgcag-taatcggactcaacctc----tactgtgggg
A0A8D1FTD4_MCL1-03      c-----agagaaacgcag-taatcggactcaacctc----tactgtgggg
A0A8D1G1G8_MCL1-04      c-----agagaaacgcag-taatcggactcaacctc----tactgtgggg
A0A4X1SEZ6_MCL1-01      c-----agagaaacgcag-taatcggactcaacctc----tactgtgggg
A0A4X1SFB1_MCL1-01      c-----agagaaacgcag-taatcggactcaacctc----tactgtgggg
A0A8D1FTD4_MCL1-01      c-----agagaaacgcag-taatcggactcaacctc----tactgtgggg
A0A8D1G1G8_MCL1-02      c-----agagaaacgcag-taatcggactcaacctc----tactgtgggg
A0A8D1RYD1_MCL1-01      c-----agagaaacgcag-taatcggactcaacctc----tactgtgggg
A0A4X1SEU3_MCL1-02      c-----agagaaacgcag-taatcggactcaacctc----tactgtgggg
A0A4X1SEZ6_MCL1-03      c-----agagaaacgcag-taatcggactcaacctc----tactgtgggg
A0A4X1SFB1_MCL1-02      c-----agagaaacgcag-taatcggactcaacctc----tactgtgggg
A0A8D1FTD4_MCL1-05      c-----agagaaacgcag-taatcggactcaacctc----tactgtgggg
A0A8D1G1G8_MCL1-01      c-----agagaaacgcag-taatcggactcaacctc----tactgtgggg
A0A8D1RYD1_MCL1-03      c-----agagaaacgcag-taatcggactcaacctc----tactgtgggg
A0A4X1SEU3_MCL1-01      c-----agagaaacgcag-taatcggactcaacctc----tactgtgggg
A0A8D1G1G8_MCL1-03      c-----agagaaacgcag-taatcggactcaacctc----tactgtgggg
A0A8D1FTD4_MCL1-02      c-----agagaaacgcag-taatcggactcaacctc----tactgtgggg
A0A8D1RYD1_MCL1-02      c-----agagaaacgcag-taatcggactcaacctc----tactgtgggg
A0A4X1SEZ6_MCL1-02      c-----agagaaacgcag-taatcggactcaacctc----tactgtgggg
A0A8D1FTD4_MCL1-04      c-----agagaaacgcag-taatcggactcaacctc----tactgtgggg
A0A8D0QLD9_BCL2-07      c-----atggtgtctccgctcatcagccccaagcccctcgccctgcccgg
A0A4X1TRR9_BCL2-06      c-----atggtgtctccgctcatcagccccaagcccctcgccctgcccgg
A0A8D0QLD9_BCL2-05      c-----atggtgtctccgctcatcagccccaagcccctcgccctgcccgg
A0A4X1TRR9_BCL2-05      c-----atggtgtctccgctcatcagccccaagcccctcgccctgcccgg
A0A8D0QLD9_BCL2-04      c-----atggtgtctccgctcatcagccccaagcccctcgccctgcccgg
A0A4X1TRR9_BCL2-07      c-----atggtgtctccgctcatcagccccaagcccctcgccctgcccgg
A0A8D0QLD9_BCL2-06      c-----atggtgtctccgctcatcagccccaagcccctcgccctgcccgg
A0A4X1TRR9_BCL2-04      c-----atggtgtctccgctcatcagccccaagcccctcgccctgcccgg
A0A4X1TRR9_BCL2-02      c-----atggtgtctccgctcatcagccccaagcccctcgccctgcccgg
A0A8D0QLD9_BCL2-02      c-----atggtgtctccgctcatcagccccaagcccctcgccctgcccgg
                                                                          

A0A8D1N411_BCL2L10      agcccggcaccgc-------------------------------------
A0A8D1ITC0_BCL2L10      agcccggcaccgc-------------------------------------
A0A4X1T1Z2_BCL2L10      agcccggcaccgc-------------------------------------
A0A8D1QEZ6_BCL2L10      agcccggcaccgc-------------------------------------
A0A8D1ALD6_BCL2L1-      aggatacagctggagtcagtttactgatgtggaagagaacagaactgagg
A0A4X1SQU7_BCL2L1-      aggatacagctggagtcagtttactgatgtggaagagaacagaactgagg
A0A8D0XF62_BCL2L1-      aggatacagctggagtcagtttactgatgtggaagagaacagaactgagg
O77737_BCL2L1-01        aggatacagctggagtcagtttactgatgtggaagagaacagaactgagg
A0A8D0J6V8_BCL2L1-      aggatacagctggagtcagtttactgatgtggaagagaacagaactgagg
A0A8D0J6V8_BCL2L1-      aggatacagctggagtcagtttactgatgtggaagagaacagaactgagg
A0A8D0J6V8_BCL2L1-      aggatacagctggagtcagtttactgatgtggaagagaacagaactgagg
A0A8D0J6V8_BCL2L1-      aggatacagctggagtcagtttactgatgtggaagagaacagaactgagg
A0A8D0J6V8_BCL2L1-      aggatacagctggagtcagtttactgatgtggaagagaacagaactgagg
A0A4X1SQU7_BCL2L1-      aggatacagctggagtcagtttactgatgtggaagagaacagaactgagg
A0A4X1SQU7_BCL2L1-      aggatacagctggagtcagtttactgatgtggaagagaacagaactgagg
A0A4X1SQU7_BCL2L1-      aggatacagctggagtcagtttactgatgtggaagagaacagaactgagg
A0A4X1SRM7_BCL2L1-      aggatacagctggagtcagtttactgatgtggaagagaacagaactgagg
A0A8D0XF62_BCL2L1-      aggatacagctggagtcagtttactgatgtggaagagaacagaactgagg
A0A8D1ALD6_BCL2L1-      aggatacagctggagtcagtttactgatgtggaagagaacagaactgagg
A0A4X1SQU7_BCL2L1-      aggatacagctggagtcagtttactgatgtggaagagaacagaactgagg
A0A4X1SF63_BCL2L2-      gcgccatctt----------------------------------------
A0A4X1SF63_BCL2L2-      gcgccatctt----------------------------------------
A0A8D0TJQ9_BCL2L2-      gcgccatctt----------------------------------------
A0A482LX62_BCL2L2-      gggtta---t----------------------------------------
A0A3Q9B4M8_BCL2L2-      gggtta---t----------------------------------------
A0A7T8CLX7_BCL2L2-      --------------------------------------------------
A0A8D0TJQ9_BCL2L2-      gggtta---t----------------------------------------
A0A4X1SF60_BCL2L2-      gggtta---t----------------------------------------
A0A4X1SF63_BCL2L2-      gggtta---t----------------------------------------
A0A8D0TJQ9_BCL2L2-      gggtta---t----------------------------------------
A0A4X1SF63_BCL2L2-      gggtta---t----------------------------------------
A0A4D6NWN1_BCL2L2-      gggtta---t----------------------------------------
A0A4X1SF60_BCL2L2-      gggtta---t----------------------------------------
A0A4X1SF63_BCL2L2-      gggtta---t----------------------------------------
A0A8D0TJQ9_BCL2L2-      gggtta---t----------------------------------------
A0A4X1SF60_BCL2L2-      gggtta---t----------------------------------------
A0A8D0TJQ9_BCL2L2-      gggtta---t----------------------------------------
A0A8D0QLD9_BCL2-03      gggcta---c----------------------------------------
A0A4X1TRR9_BCL2-01      gggcta---c----------------------------------------
A0A8D0QLD9_BCL2-01      gggcta---c----------------------------------------
A0A4X1TRR9_BCL2-03      gggcta---c----------------------------------------
A0A8D1BRF8_BCL2A1-      --------------------------------------------------
A0A8D0Z1Y4_BCL2A1-      --------------------------------------------------
A0A8D1SK15_BCL2A1-      --------------------------------------------------
A0A4X1UP21_BCL2A1-      --------------------------------------------------
A0A8D1BRF8_BCL2A1-      --------------------------------------------------
A0A8D1YBS8_BCL2A1-      --------------------------------------------------
A0A4X1UP21_BCL2A1-      agtatg---t----------------------------------------
A0A4X1UQW5_BCL2A1-      agtatg---t----------------------------------------
A0A8D0Z1Y4_BCL2A1-      agtatg---t----------------------------------------
A0A8D1BRF8_BCL2A1-      agtatg---t----------------------------------------
A0A8D1SK15_BCL2A1-      agtatg---t----------------------------------------
A0A8D1YBS8_BCL2A1-      agtatg---t----------------------------------------
C7F841_BCL2A1-01        agtatg---t----------------------------------------
A0A8D1KPD1_BCL2A1-      agtatg---t----------------------------------------
A0A8D1BRF8_BCL2A1-      agtatg---t----------------------------------------
A0A4X1UP21_BCL2A1-      agtatg---t----------------------------------------
A0A8D1SK15_BCL2A1-      agtatg---t----------------------------------------
A0A8D0Z1Y4_BCL2A1-      agtatg---t----------------------------------------
A0A8D1YBS8_BCL2A1-      agtatg---t----------------------------------------
Q95KR3_MCL1-01          gggccg---g----------------------------------------
A0A8D1FTD4_MCL1-03      gggccg---g----------------------------------------
A0A8D1G1G8_MCL1-04      gggccg---g----------------------------------------
A0A4X1SEZ6_MCL1-01      gggccg---g----------------------------------------
A0A4X1SFB1_MCL1-01      gggccg---g----------------------------------------
A0A8D1FTD4_MCL1-01      gggccg---g----------------------------------------
A0A8D1G1G8_MCL1-02      gggccg---g----------------------------------------
A0A8D1RYD1_MCL1-01      gggccg---g----------------------------------------
A0A4X1SEU3_MCL1-02      gggccg---g----------------------------------------
A0A4X1SEZ6_MCL1-03      gggccg---g----------------------------------------
A0A4X1SFB1_MCL1-02      gggccg---g----------------------------------------
A0A8D1FTD4_MCL1-05      gggccg---g----------------------------------------
A0A8D1G1G8_MCL1-01      gggccg---g----------------------------------------
A0A8D1RYD1_MCL1-03      gggccg---g----------------------------------------
A0A4X1SEU3_MCL1-01      gggccg---g----------------------------------------
A0A8D1G1G8_MCL1-03      gggccg---g----------------------------------------
A0A8D1FTD4_MCL1-02      gggccg---g----------------------------------------
A0A8D1RYD1_MCL1-02      gggccg---g----------------------------------------
A0A4X1SEZ6_MCL1-02      gggccg---g----------------------------------------
A0A8D1FTD4_MCL1-04      gggccg---g----------------------------------------
A0A8D0QLD9_BCL2-07      agctca---t----------------------------------------
A0A4X1TRR9_BCL2-06      agctca---t----------------------------------------
A0A8D0QLD9_BCL2-05      agctca---t----------------------------------------
A0A4X1TRR9_BCL2-05      agctca---t----------------------------------------
A0A8D0QLD9_BCL2-04      agctca---t----------------------------------------
A0A4X1TRR9_BCL2-07      agctca---t----------------------------------------
A0A8D0QLD9_BCL2-06      agctca---t----------------------------------------
A0A4X1TRR9_BCL2-04      agctca---t----------------------------------------
A0A4X1TRR9_BCL2-02      agctca---t----------------------------------------
A0A8D0QLD9_BCL2-02      agctca---t----------------------------------------
                                                                          

A0A8D1N411_BCL2L10      --------------------------------------------------
A0A8D1ITC0_BCL2L10      --------------------------------------------------
A0A4X1T1Z2_BCL2L10      --------------------------------------------------
A0A8D1QEZ6_BCL2L10      --------------------------------------------------
A0A8D1ALD6_BCL2L1-      ccccagaagggactgaatcagaagcggaaacccctagtgccatcaatggc
A0A4X1SQU7_BCL2L1-      ccccagaagggactgaatcagaagcggaaacccctagtgccatcaatggc
A0A8D0XF62_BCL2L1-      ccccagaagggactgaatcagaagcggaaacccctagtgccatcaatggc
O77737_BCL2L1-01        ccccagaagggactgaatcagaagcggaaacccctagtgccatcaatggc
A0A8D0J6V8_BCL2L1-      ccccagaagggactgaatcagaagcggaaacccctagtgccatcaatggc
A0A8D0J6V8_BCL2L1-      ccccagaagggactgaatcagaagcggaaacccctagtgccatcaatggc
A0A8D0J6V8_BCL2L1-      ccccagaagggactgaatcagaagcggaaacccctagtgccatcaatggc
A0A8D0J6V8_BCL2L1-      ccccagaagggactgaatcagaagcggaaacccctagtgccatcaatggc
A0A8D0J6V8_BCL2L1-      ccccagaagggactgaatcagaagcggaaacccctagtgccatcaatggc
A0A4X1SQU7_BCL2L1-      ccccagaagggactgaatcagaagcggaaacccctagtgccatcaatggc
A0A4X1SQU7_BCL2L1-      ccccagaagggactgaatcagaagcggaaacccctagtgccatcaatggc
A0A4X1SQU7_BCL2L1-      ccccagaagggactgaatcagaagcggaaacccctagtgccatcaatggc
A0A4X1SRM7_BCL2L1-      ccccagaagggactgaatcagaagcggaaacccctagtgccatcaatggc
A0A8D0XF62_BCL2L1-      ccccagaagggactgaatcagaagcggaaacccctagtgccatcaatggc
A0A8D1ALD6_BCL2L1-      ccccagaagggactgaatcagaagcggaaacccctagtgccatcaatggc
A0A4X1SQU7_BCL2L1-      ccccagaagggactgaatcagaagcggaaacccctagtgccatcaatggc
A0A4X1SF63_BCL2L2-      --------------------------------------------------
A0A4X1SF63_BCL2L2-      --------------------------------------------------
A0A8D0TJQ9_BCL2L2-      --------------------------------------------------
A0A482LX62_BCL2L2-      --------------------------------------------------
A0A3Q9B4M8_BCL2L2-      --------------------------------------------------
A0A7T8CLX7_BCL2L2-      --------------------------------------------------
A0A8D0TJQ9_BCL2L2-      --------------------------------------------------
A0A4X1SF60_BCL2L2-      --------------------------------------------------
A0A4X1SF63_BCL2L2-      --------------------------------------------------
A0A8D0TJQ9_BCL2L2-      --------------------------------------------------
A0A4X1SF63_BCL2L2-      --------------------------------------------------
A0A4D6NWN1_BCL2L2-      --------------------------------------------------
A0A4X1SF60_BCL2L2-      --------------------------------------------------
A0A4X1SF63_BCL2L2-      --------------------------------------------------
A0A8D0TJQ9_BCL2L2-      --------------------------------------------------
A0A4X1SF60_BCL2L2-      --------------------------------------------------
A0A8D0TJQ9_BCL2L2-      --------------------------------------------------
A0A8D0QLD9_BCL2-03      --------------------------------------------------
A0A4X1TRR9_BCL2-01      --------------------------------------------------
A0A8D0QLD9_BCL2-01      --------------------------------------------------
A0A4X1TRR9_BCL2-03      --------------------------------------------------
A0A8D1BRF8_BCL2A1-      --------------------------------------------------
A0A8D0Z1Y4_BCL2A1-      --------------------------------------------------
A0A8D1SK15_BCL2A1-      --------------------------------------------------
A0A4X1UP21_BCL2A1-      --------------------------------------------------
A0A8D1BRF8_BCL2A1-      --------------------------------------------------
A0A8D1YBS8_BCL2A1-      --------------------------------------------------
A0A4X1UP21_BCL2A1-      --------------------------------------------------
A0A4X1UQW5_BCL2A1-      --------------------------------------------------
A0A8D0Z1Y4_BCL2A1-      --------------------------------------------------
A0A8D1BRF8_BCL2A1-      --------------------------------------------------
A0A8D1SK15_BCL2A1-      --------------------------------------------------
A0A8D1YBS8_BCL2A1-      --------------------------------------------------
C7F841_BCL2A1-01        --------------------------------------------------
A0A8D1KPD1_BCL2A1-      --------------------------------------------------
A0A8D1BRF8_BCL2A1-      --------------------------------------------------
A0A4X1UP21_BCL2A1-      --------------------------------------------------
A0A8D1SK15_BCL2A1-      --------------------------------------------------
A0A8D0Z1Y4_BCL2A1-      --------------------------------------------------
A0A8D1YBS8_BCL2A1-      --------------------------------------------------
Q95KR3_MCL1-01          --------------------------------------------------
A0A8D1FTD4_MCL1-03      --------------------------------------------------
A0A8D1G1G8_MCL1-04      --------------------------------------------------
A0A4X1SEZ6_MCL1-01      --------------------------------------------------
A0A4X1SFB1_MCL1-01      --------------------------------------------------
A0A8D1FTD4_MCL1-01      --------------------------------------------------
A0A8D1G1G8_MCL1-02      --------------------------------------------------
A0A8D1RYD1_MCL1-01      --------------------------------------------------
A0A4X1SEU3_MCL1-02      --------------------------------------------------
A0A4X1SEZ6_MCL1-03      --------------------------------------------------
A0A4X1SFB1_MCL1-02      --------------------------------------------------
A0A8D1FTD4_MCL1-05      --------------------------------------------------
A0A8D1G1G8_MCL1-01      --------------------------------------------------
A0A8D1RYD1_MCL1-03      --------------------------------------------------
A0A4X1SEU3_MCL1-01      --------------------------------------------------
A0A8D1G1G8_MCL1-03      --------------------------------------------------
A0A8D1FTD4_MCL1-02      --------------------------------------------------
A0A8D1RYD1_MCL1-02      --------------------------------------------------
A0A4X1SEZ6_MCL1-02      --------------------------------------------------
A0A8D1FTD4_MCL1-04      --------------------------------------------------
A0A8D0QLD9_BCL2-07      --------------------------------------------------
A0A4X1TRR9_BCL2-06      --------------------------------------------------
A0A8D0QLD9_BCL2-05      --------------------------------------------------
A0A4X1TRR9_BCL2-05      --------------------------------------------------
A0A8D0QLD9_BCL2-04      --------------------------------------------------
A0A4X1TRR9_BCL2-07      --------------------------------------------------
A0A8D0QLD9_BCL2-06      --------------------------------------------------
A0A4X1TRR9_BCL2-04      --------------------------------------------------
A0A4X1TRR9_BCL2-02      --------------------------------------------------
A0A8D0QLD9_BCL2-02      --------------------------------------------------
                                                                          

A0A8D1N411_BCL2L10      ------------------------------------cccgcggcagccgt
A0A8D1ITC0_BCL2L10      ------------------------------------cgcgcggcagccgt
A0A4X1T1Z2_BCL2L10      ------------------------------------cgcgcggcagccgt
A0A8D1QEZ6_BCL2L10      ------------------------------------cgcgcggcagccgt
A0A8D1ALD6_BCL2L1-      aacccatcctggcacctggcggacagccccgcggtgaatggagccactgg
A0A4X1SQU7_BCL2L1-      aacccatcctggcacctggcggacagccccgcggtgaatggagccactgg
A0A8D0XF62_BCL2L1-      aacccatcctggcacctggcggacagccccgcggtgaatggagccactgg
O77737_BCL2L1-01        aacccatcctggcacctggcggacagccccgcggtgaatggagccactgg
A0A8D0J6V8_BCL2L1-      aacccatcctggcacctggcggacagccccgcggtgaatggagccactgg
A0A8D0J6V8_BCL2L1-      aacccatcctggcacctggcggacagccccgcggtgaatggagccactgg
A0A8D0J6V8_BCL2L1-      aacccatcctggcacctggcggacagccccgcggtgaatggagccactgg
A0A8D0J6V8_BCL2L1-      aacccatcctggcacctggcggacagccccgcggtgaatggagccactgg
A0A8D0J6V8_BCL2L1-      aacccatcctggcacctggcggacagccccgcggtgaatggagccactgg
A0A4X1SQU7_BCL2L1-      aacccatcctggcacctggcggacagccccgcggtgaatggagccactgg
A0A4X1SQU7_BCL2L1-      aacccatcctggcacctggcggacagccccgcggtgaatggagccactgg
A0A4X1SQU7_BCL2L1-      aacccatcctggcacctggcggacagccccgcggtgaatggagccactgg
A0A4X1SRM7_BCL2L1-      aacccatcctggcacctggcggacagccccgcggtgaatggagccactgg
A0A8D0XF62_BCL2L1-      aacccatcctggcacctggcggacagccccgcggtgaatggagccactgg
A0A8D1ALD6_BCL2L1-      aacccatcctggcacctggcggacagccccgcggtgaatggagccactgg
A0A4X1SQU7_BCL2L1-      aacccatcctggcacctggcggacagccccgcggtgaatggagccactgg
A0A4X1SF63_BCL2L2-      ------------------------------------gtgcccggggccgg
A0A4X1SF63_BCL2L2-      ------------------------------------gtgcccggggccgg
A0A8D0TJQ9_BCL2L2-      ------------------------------------gtgcccggggccgg
A0A482LX62_BCL2L2-      ------------------------------------gtctgtggagctgg
A0A3Q9B4M8_BCL2L2-      ------------------------------------gtctgtggagctgg
A0A7T8CLX7_BCL2L2-      --------------------------------------------------
A0A8D0TJQ9_BCL2L2-      ------------------------------------gtctgtggagctgg
A0A4X1SF60_BCL2L2-      ------------------------------------gtctgtggagctgg
A0A4X1SF63_BCL2L2-      ------------------------------------gtctgtggagctgg
A0A8D0TJQ9_BCL2L2-      ------------------------------------gtctgtggagctgg
A0A4X1SF63_BCL2L2-      ------------------------------------gtctgtggagctgg
A0A4D6NWN1_BCL2L2-      ------------------------------------gtctgtggagctgg
A0A4X1SF60_BCL2L2-      ------------------------------------gtctgtggagctgg
A0A4X1SF63_BCL2L2-      ------------------------------------gtctgtggagctgg
A0A8D0TJQ9_BCL2L2-      ------------------------------------gtctgtggagctgg
A0A4X1SF60_BCL2L2-      ------------------------------------gtctgtggagctgg
A0A8D0TJQ9_BCL2L2-      ------------------------------------gtctgtggagctgg
A0A8D0QLD9_BCL2-03      ------------------------------------gagtgggatgccgg
A0A4X1TRR9_BCL2-01      ------------------------------------gagtgggatgccgg
A0A8D0QLD9_BCL2-01      ------------------------------------gagtgggatgccgg
A0A4X1TRR9_BCL2-03      ------------------------------------gagtgggatgccgg
A0A8D1BRF8_BCL2A1-      --------------------------------------------------
A0A8D0Z1Y4_BCL2A1-      --------------------------------------------------
A0A8D1SK15_BCL2A1-      --------------------------------------------------
A0A4X1UP21_BCL2A1-      --------------------------------------------------
A0A8D1BRF8_BCL2A1-      --------------------------------------------------
A0A8D1YBS8_BCL2A1-      --------------------------------------------------
A0A4X1UP21_BCL2A1-      ------------------------------------cctgcagataccac
A0A4X1UQW5_BCL2A1-      ------------------------------------cctgcagataccac
A0A8D0Z1Y4_BCL2A1-      ------------------------------------cctgcagataccac
A0A8D1BRF8_BCL2A1-      ------------------------------------cctgcagataccac
A0A8D1SK15_BCL2A1-      ------------------------------------cctgcagataccac
A0A8D1YBS8_BCL2A1-      ------------------------------------cctgcagataccac
C7F841_BCL2A1-01        ------------------------------------cctgcagataccac
A0A8D1KPD1_BCL2A1-      ------------------------------------cctgcagataccac
A0A8D1BRF8_BCL2A1-      ------------------------------------cctgcagataccac
A0A4X1UP21_BCL2A1-      ------------------------------------cctgcagataccac
A0A8D1SK15_BCL2A1-      ------------------------------------cctgcagataccac
A0A8D0Z1Y4_BCL2A1-      ------------------------------------cctgcagataccac
A0A8D1YBS8_BCL2A1-      ------------------------------------cctgcagataccac
Q95KR3_MCL1-01          ------------------------------------attggggc--ctgg
A0A8D1FTD4_MCL1-03      ------------------------------------attggggc--ctgg
A0A8D1G1G8_MCL1-04      ------------------------------------attggggc--ctgg
A0A4X1SEZ6_MCL1-01      ------------------------------------attggggc--ctgg
A0A4X1SFB1_MCL1-01      ------------------------------------attggggc--ctgg
A0A8D1FTD4_MCL1-01      ------------------------------------attggggc--ctgg
A0A8D1G1G8_MCL1-02      ------------------------------------attggggc--ctgg
A0A8D1RYD1_MCL1-01      ------------------------------------attggggc--ctgg
A0A4X1SEU3_MCL1-02      ------------------------------------attggggc--ctgg
A0A4X1SEZ6_MCL1-03      ------------------------------------attggggc--ctgg
A0A4X1SFB1_MCL1-02      ------------------------------------attggggc--ctgg
A0A8D1FTD4_MCL1-05      ------------------------------------attggggc--ctgg
A0A8D1G1G8_MCL1-01      ------------------------------------attggggc--ctgg
A0A8D1RYD1_MCL1-03      ------------------------------------attggggc--ctgg
A0A4X1SEU3_MCL1-01      ------------------------------------attggggc--ctgg
A0A8D1G1G8_MCL1-03      ------------------------------------attggggc--ctgg
A0A8D1FTD4_MCL1-02      ------------------------------------attggggc--ctgg
A0A8D1RYD1_MCL1-02      ------------------------------------attggggc--ctgg
A0A4X1SEZ6_MCL1-02      ------------------------------------attggggc--ctgg
A0A8D1FTD4_MCL1-04      ------------------------------------attggggc--ctgg
A0A8D0QLD9_BCL2-07      ------------------------------------gtggtggttactgg
A0A4X1TRR9_BCL2-06      ------------------------------------gtggtggttactgg
A0A8D0QLD9_BCL2-05      ------------------------------------gtggtggttactgg
A0A4X1TRR9_BCL2-05      ------------------------------------gtggtggttactgg
A0A8D0QLD9_BCL2-04      ------------------------------------gtggtggttactgg
A0A4X1TRR9_BCL2-07      ------------------------------------gtggtggttactgg
A0A8D0QLD9_BCL2-06      ------------------------------------gtggtggttactgg
A0A4X1TRR9_BCL2-04      ------------------------------------gtggtggttactgg
A0A4X1TRR9_BCL2-02      ------------------------------------gtggtggttactgg
A0A8D0QLD9_BCL2-02      ------------------------------------gtggtggttactgg
                                                                          

A0A8D1N411_BCL2L10      cctcgcccgaggc-------------------------------------
A0A8D1ITC0_BCL2L10      cctcgcccgaggc-------------------------------------
A0A4X1T1Z2_BCL2L10      cctcgcccgaggc-------------------------------------
A0A8D1QEZ6_BCL2L10      cctcgcccgaggc-------------------------------------
A0A8D1ALD6_BCL2L1-      ccacagcagcagcttggatgc-------------------------ccgg
A0A4X1SQU7_BCL2L1-      ccacagcagcagcttggatgc-------------------------ccgg
A0A8D0XF62_BCL2L1-      ccacagcagcagcttggatgc-------------------------ccgg
O77737_BCL2L1-01        ccacagcagcagcttggatgc-------------------------ccgg
A0A8D0J6V8_BCL2L1-      ccacagcagcagcttggatgc-------------------------ccgg
A0A8D0J6V8_BCL2L1-      ccacagcagcagcttggatgc-------------------------ccgg
A0A8D0J6V8_BCL2L1-      ccacagcagcagcttggatgc-------------------------ccgg
A0A8D0J6V8_BCL2L1-      ccacagcagcagcttggatgc-------------------------ccgg
A0A8D0J6V8_BCL2L1-      ccacagcagcagcttggatgc-------------------------ccgg
A0A4X1SQU7_BCL2L1-      ccacagcagcagcttggatgc-------------------------ccgg
A0A4X1SQU7_BCL2L1-      ccacagcagcagcttggatgc-------------------------ccgg
A0A4X1SQU7_BCL2L1-      ccacagcagcagcttggatgc-------------------------ccgg
A0A4X1SRM7_BCL2L1-      ccacagcagcagcttggatgc-------------------------ccgg
A0A8D0XF62_BCL2L1-      ccacagcagcagcttggatgc-------------------------ccgg
A0A8D1ALD6_BCL2L1-      ccacagcagcagcttggatgc-------------------------ccgg
A0A4X1SQU7_BCL2L1-      ccacagcagcagcttggatgc-------------------------ccgg
A0A4X1SF63_BCL2L2-      t----ggggaggc---------------------------------cggg
A0A4X1SF63_BCL2L2-      t----ggggaggc---------------------------------cggg
A0A8D0TJQ9_BCL2L2-      t----ggggaggc---------------------------------cggg
A0A482LX62_BCL2L2-      ccccggggagggc---------------------------------ccag
A0A3Q9B4M8_BCL2L2-      ccccggggagggc---------------------------------ccag
A0A7T8CLX7_BCL2L2-      --------------------------------------------------
A0A8D0TJQ9_BCL2L2-      ccccggggagggc---------------------------------ccag
A0A4X1SF60_BCL2L2-      ccccggggagggc---------------------------------ccag
A0A4X1SF63_BCL2L2-      ccccggggagggc---------------------------------ccag
A0A8D0TJQ9_BCL2L2-      ccccggggagggc---------------------------------ccag
A0A4X1SF63_BCL2L2-      ccccggggagggc---------------------------------ccag
A0A4D6NWN1_BCL2L2-      ccccggggagggc---------------------------------ccag
A0A4X1SF60_BCL2L2-      ccccggggagggc---------------------------------ccag
A0A4X1SF63_BCL2L2-      ccccggggagggc---------------------------------ccag
A0A8D0TJQ9_BCL2L2-      ccccggggagggc---------------------------------ccag
A0A4X1SF60_BCL2L2-      ccccggggagggc---------------------------------ccag
A0A8D0TJQ9_BCL2L2-      ccccggggagggc---------------------------------ccag
A0A8D0QLD9_BCL2-03      agacgcgggcgccgc----------------------------gtccccg
A0A4X1TRR9_BCL2-01      agacgcgggcgccgc----------------------------gtccccg
A0A8D0QLD9_BCL2-01      agacgcgggcgccgc----------------------------gtccccg
A0A4X1TRR9_BCL2-03      agacgcgggcgccgc----------------------------gtccccg
A0A8D1BRF8_BCL2A1-      -gccgtgagcggcgc-------------------------------taag
A0A8D0Z1Y4_BCL2A1-      -gccgtgagcggcgc-------------------------------taag
A0A8D1SK15_BCL2A1-      -gccgtgagcggcgc-------------------------------taag
A0A4X1UP21_BCL2A1-      -gccgtgagcggcgc-------------------------------taag
A0A8D1BRF8_BCL2A1-      -gccgtgagcggcgc-------------------------------taag
A0A8D1YBS8_BCL2A1-      -gccgtgagcggcgc-------------------------------taag
A0A4X1UP21_BCL2A1-      aacctggatctggtc-------------------------------caag
A0A4X1UQW5_BCL2A1-      aacctggatctggtc-------------------------------caag
A0A8D0Z1Y4_BCL2A1-      aacctggatctggtc-------------------------------caag
A0A8D1BRF8_BCL2A1-      aacctggatctggtc-------------------------------caag
A0A8D1SK15_BCL2A1-      aacctggatctggtc-------------------------------caag
A0A8D1YBS8_BCL2A1-      aacctggatctggtc-------------------------------caag
C7F841_BCL2A1-01        aacctggatctggtc-------------------------------caag
A0A8D1KPD1_BCL2A1-      aacctggatctggtc-------------------------------caag
A0A8D1BRF8_BCL2A1-      aacctggatctggtc-------------------------------caag
A0A4X1UP21_BCL2A1-      aacctggatctggtc-------------------------------caag
A0A8D1SK15_BCL2A1-      aacctggatctggtc-------------------------------caag
A0A8D0Z1Y4_BCL2A1-      aacctggatctggtc-------------------------------caag
A0A8D1YBS8_BCL2A1-      aacctggatctggtc-------------------------------caag
Q95KR3_MCL1-01          aagcggcagcagcgc------------------------ct---------
A0A8D1FTD4_MCL1-03      aagcggcagcagcgc------------------------ctccgctccgg
A0A8D1G1G8_MCL1-04      aagcggcagcagcgc------------------------ctccgctccgg
A0A4X1SEZ6_MCL1-01      aagcggcagcagcgc------------------------ctccgctccgg
A0A4X1SFB1_MCL1-01      aagcggcagcagcgc------------------------ctccgctccgg
A0A8D1FTD4_MCL1-01      aagcggcagcagcgc------------------------ctccgctccgg
A0A8D1G1G8_MCL1-02      aagcggcagcagcgc------------------------ctccgctccgg
A0A8D1RYD1_MCL1-01      aagcggcagcagcgc------------------------ctccgctccgg
A0A4X1SEU3_MCL1-02      aagcggcagcagcgc------------------------ctccgctccgg
A0A4X1SEZ6_MCL1-03      aagcggcagcagcgc------------------------ctccgctccgg
A0A4X1SFB1_MCL1-02      aagcggcagcagcgc------------------------ctccgctccgg
A0A8D1FTD4_MCL1-05      aagcggcagcagcgc------------------------ctccgctccgg
A0A8D1G1G8_MCL1-01      aagcggcagcagcgc------------------------ctccgctccgg
A0A8D1RYD1_MCL1-03      aagcggcagcagcgc------------------------ctccgctccgg
A0A4X1SEU3_MCL1-01      aagcggcagcagcgc------------------------ctccgctccgg
A0A8D1G1G8_MCL1-03      aagcggcagcagcgc------------------------ctccgctccgg
A0A8D1FTD4_MCL1-02      aagcggcagcagcgc------------------------ctccgctccgg
A0A8D1RYD1_MCL1-02      aagcggcagcagcgc------------------------ctccgctccgg
A0A4X1SEZ6_MCL1-02      aagcggcagcagcgc------------------------ctccgctccgg
A0A8D1FTD4_MCL1-04      aagcggcagcagcgc------------------------ctccgctccgg
A0A8D0QLD9_BCL2-07      aggctccagcggcatcggaaagtgcattgccattgagtgctataaacaag
A0A4X1TRR9_BCL2-06      aggctccagcggcatcggaaagtgcattgccattgagtgctataaacaag
A0A8D0QLD9_BCL2-05      aggctccagcggcatcggaaagtgcattgccattgagtgctataaacaag
A0A4X1TRR9_BCL2-05      aggctccagcggcatcggaaagtgcattgccattgagtgctataaacaag
A0A8D0QLD9_BCL2-04      aggctccagcggcatcggaaagtgcattgccattgagtgctataaacaag
A0A4X1TRR9_BCL2-07      aggctccagcggcatcggaaagtgcattgccattgagtgctataaacaag
A0A8D0QLD9_BCL2-06      aggctccagcggcatcggaaagtgcattgccattgagtgctataaacaag
A0A4X1TRR9_BCL2-04      aggctccagcggcatcggaaagtgcattgccattgagtgctataaacaag
A0A4X1TRR9_BCL2-02      aggctccagcggcatcggaaagtgcattgccattgagtgctataaacaag
A0A8D0QLD9_BCL2-02      aggctccagcggcatcggaaagtgcattgccattgagtgctataaacaag
                                                                          

A0A8D1N411_BCL2L10      ---------cgcagtgctg-----------------cgttgcgtggctgc
A0A8D1ITC0_BCL2L10      ---------cgcagtgctg-----------------cgttgcgtggctgc
A0A4X1T1Z2_BCL2L10      ---------cgcagtgctg-----------------cgttgcgtggctgc
A0A8D1QEZ6_BCL2L10      ---------cgcagtgctg-----------------cgttgcgtggctgc
A0A8D1ALD6_BCL2L1-      gaggtgatccccatggctg-------cagtgaagcaagcgctgagggagg
A0A4X1SQU7_BCL2L1-      gaggtgatccccatggctg-------cagtgaagcaagcgctgagggagg
A0A8D0XF62_BCL2L1-      gaggtgatccccatggctg-------cagtgaagcaagcgctgagggagg
O77737_BCL2L1-01        gaggtgatccccatggctg-------cagtgaagcaagcgctgagggagg
A0A8D0J6V8_BCL2L1-      ggggtgatccccatggctg-------cagtgaagcaagcgctgagggagg
A0A8D0J6V8_BCL2L1-      ggggtgatccccatggctg-------cagtgaagcaagcgctgagggagg
A0A8D0J6V8_BCL2L1-      ggggtgatccccatggctg-------cagtgaagcaagcgctgagggagg
A0A8D0J6V8_BCL2L1-      ggggtgatccccatggctg-------cagtgaagcaagcgctgagggagg
A0A8D0J6V8_BCL2L1-      ggggtgatccccatggctg-------cagtgaagcaagcgctgagggagg
A0A4X1SQU7_BCL2L1-      gaggtgatccccatggctg-------cagtgaagcaagcgctgagggagg
A0A4X1SQU7_BCL2L1-      gaggtgatccccatggctg-------cagtgaagcaagcgctgagggagg
A0A4X1SQU7_BCL2L1-      gaggtgatccccatggctg-------cagtgaagcaagcgctgagggagg
A0A4X1SRM7_BCL2L1-      gaggtgatccccatggctg-------cagtgaagcaagcgctgagggagg
A0A8D0XF62_BCL2L1-      gaggtgatccccatggctg-------cagtgaagcaagcgctgagggagg
A0A8D1ALD6_BCL2L1-      gaggtgatccccatggctg-------cagtgaagcaagcgctgagggagg
A0A4X1SQU7_BCL2L1-      gaggtgatccccatggctg-------cagtgaagcaagcgctgagggagg
A0A4X1SF63_BCL2L2-      gagggggccccggggggcg------------caggggactacgggaacgg
A0A4X1SF63_BCL2L2-      gagggggccccggggggcg------------caggggactacgggaacgg
A0A8D0TJQ9_BCL2L2-      gagggggccccggggggcg------------caggggactacgggaacgg
A0A482LX62_BCL2L2-      cagctgaccc-----gctg------------caccaagccatgcgggcag
A0A3Q9B4M8_BCL2L2-      cagctgaccc-----gctg------------caccaagccatgcgggcag
A0A7T8CLX7_BCL2L2-      ----------------------------------------atgcgggcag
A0A8D0TJQ9_BCL2L2-      cagctgaccc-----gctg------------caccaagccatgcgggcag
A0A4X1SF60_BCL2L2-      cagctgaccc-----gctg------------caccaagccatgcgggcag
A0A4X1SF63_BCL2L2-      cagctgaccc-----gctg------------caccaagccatgcgggcag
A0A8D0TJQ9_BCL2L2-      cagctgaccc-----gctg------------caccaagccatgcgggcag
A0A4X1SF63_BCL2L2-      cagctgaccc-----gctg------------caccaagccatgcgggcag
A0A4D6NWN1_BCL2L2-      cagctgaccc-----gctg------------caccaagccatgcgggcag
A0A4X1SF60_BCL2L2-      cagctgaccc-----gctg------------caccaagccatgcgggcag
A0A4X1SF63_BCL2L2-      cagctgaccc-----gctg------------caccaagccatgcgggcag
A0A8D0TJQ9_BCL2L2-      cagctgaccc-----gctg------------caccaagccatgcgggcag
A0A4X1SF60_BCL2L2-      cagctgaccc-----gctg------------caccaagccatgcgggcag
A0A8D0TJQ9_BCL2L2-      cagctgaccc-----gctg------------caccaagccatgcgggcag
A0A8D0QLD9_BCL2-03      ggggccgctc---------------------ccgcaccgggcatcttctc
A0A4X1TRR9_BCL2-01      ggggccgctc---------------------ccgcaccgggcatcttctc
A0A8D0QLD9_BCL2-01      ggggccgctc---------------------ccgcaccgggcatcttctc
A0A4X1TRR9_BCL2-03      ggggccgctc---------------------ccgcaccgggcatcttctc
A0A8D1BRF8_BCL2A1-      cggagc----------ctg------------cgggccg------------
A0A8D0Z1Y4_BCL2A1-      cggagc----------ctg------------cgggccg------------
A0A8D1SK15_BCL2A1-      cggagc----------ctg------------cgggccg------------
A0A4X1UP21_BCL2A1-      cggagc----------ctg------------cgggccg------------
A0A8D1BRF8_BCL2A1-      cggagc----------ctg------------cgggccg------------
A0A8D1YBS8_BCL2A1-      cggagc----------ctg------------cgggccg------------
A0A4X1UP21_BCL2A1-      caaaacatctagagtgtta------------cgagacgtggctttctccg
A0A4X1UQW5_BCL2A1-      caaaacatctagagtgtta------------cgagacgtggctttctccg
A0A8D0Z1Y4_BCL2A1-      caaaacatctagagtgtta------------cgagacgtggctttctccg
A0A8D1BRF8_BCL2A1-      caaaacatctagagtgtta------------cgagacgtggctttctccg
A0A8D1SK15_BCL2A1-      caaaacatctagagtgtta------------cgagacgtggctttctccg
A0A8D1YBS8_BCL2A1-      caaaacatctagagtgtta------------cgagacgtggctttctccg
C7F841_BCL2A1-01        caaaacatctagagtgtta------------cgagacgtggctttctccg
A0A8D1KPD1_BCL2A1-      caaaacatctagagtgtta------------cgagacgtggctttctccg
A0A8D1BRF8_BCL2A1-      caaaacatctagagtgtta------------cgagacgtggctttctccg
A0A4X1UP21_BCL2A1-      caaaacatctagagtgtta------------cgagacgtggctttctccg
A0A8D1SK15_BCL2A1-      caaaacatctagagtgtta------------cgagacgtggctttctccg
A0A8D0Z1Y4_BCL2A1-      caaaacatctagagtgtta------------cgagacgtggctttctccg
A0A8D1YBS8_BCL2A1-      caaaacatctagagtgtta------------cgagacgtggctttctccg
Q95KR3_MCL1-01          --------------------------------------------------
A0A8D1FTD4_MCL1-03      gaggccgtctct-----tggctacgggaaaagaggccacggcccggcaag
A0A8D1G1G8_MCL1-04      gaggccgtctct-----tggctacgggaaaagaggccacggcccggcaag
A0A4X1SEZ6_MCL1-01      gaggccgtctct-----tggctacgggaaaagaggccacggcccggcaag
A0A4X1SFB1_MCL1-01      gaggccgtctct-----tggctacgggaaaagaggccacggcccggcaag
A0A8D1FTD4_MCL1-01      gaggccgtctct-----tggctacgggaaaagaggccacggcccggcaag
A0A8D1G1G8_MCL1-02      gaggccgtctct-----tggctacgggaaaagaggccacggcccggcaag
A0A8D1RYD1_MCL1-01      gaggccgtctct-----tggctacgggaaaagaggccacggcccggcaag
A0A4X1SEU3_MCL1-02      gaggccgtctct-----t--------------------------------
A0A4X1SEZ6_MCL1-03      gaggccgtctct-----t--------------------------------
A0A4X1SFB1_MCL1-02      gaggccgtctct-----t--------------------------------
A0A8D1FTD4_MCL1-05      gaggccgtctct-----t--------------------------------
A0A8D1G1G8_MCL1-01      gaggccgtctct-----t--------------------------------
A0A8D1RYD1_MCL1-03      gaggccgtctct-----t--------------------------------
A0A4X1SEU3_MCL1-01      gaggccgtctct-----tggctacgggaaaagaggccacggccnnnnnnn
A0A8D1G1G8_MCL1-03      g-------------------------------------------------
A0A8D1FTD4_MCL1-02      gaggccgtctct-----tggctacgggaaaagaggccacggcccggcaag
A0A8D1RYD1_MCL1-02      gaggccgtctct-----tggctacgggaaaagaggccacggcccggcaag
A0A4X1SEZ6_MCL1-02      gaggccgtctct-----tggctacgggaaaagaggccacggcccggcaag
A0A8D1FTD4_MCL1-04      gaggccgtctct-----tggctacgggaaaagaggccacggcccggcaag
A0A8D0QLD9_BCL2-07      gag--cgtttataactctggttgcacgaaatgaggacaagctgttgcagg
A0A4X1TRR9_BCL2-06      gag--cgtttataactctggttgcacgaaatgaggacaagctgttgcagg
A0A8D0QLD9_BCL2-05      gag--cgtttataactctggttgcacgaaatgaggacaagctgttgcagg
A0A4X1TRR9_BCL2-05      gag--cgtttataactctggttgcacgaaatgaggacaagctgttgcagg
A0A8D0QLD9_BCL2-04      gag--cgtttataactctggttgcacgaaatgaggacaagctgttgcagg
A0A4X1TRR9_BCL2-07      gag--cgtttataactctggttgcacgaaatgaggacaagctgttgcagg
A0A8D0QLD9_BCL2-06      gag--cgtttataactctggttgcacgaaatgaggacaagctgttgcagg
A0A4X1TRR9_BCL2-04      gag--cgtttataactctggttgcacgaaatgaggacaagctgttgcagg
A0A4X1TRR9_BCL2-02      gag--cgtttataactctggttgcacgaaatgaggacaagctgttgcagg
A0A8D0QLD9_BCL2-02      gag--cgtttataactctggttgcacgaaatgaggacaagctgttgcagg
                                                                          

A0A8D1N411_BCL2L10      ccagatacgggagtacaacgt-----------------------------
A0A8D1ITC0_BCL2L10      ccagatacgggagtacaacgt-----------------------------
A0A4X1T1Z2_BCL2L10      ccagatacgggagtacaacgt-----------------------------
A0A8D1QEZ6_BCL2L10      ccagatacgggagtacaacgt-----------------------------
A0A8D1ALD6_BCL2L1-      cgggcgatgagtttgaactga---------------------------gg
A0A4X1SQU7_BCL2L1-      cgggcgatgagtttgaactga---------------------------gg
A0A8D0XF62_BCL2L1-      cgggcgatgagtttgaactga---------------------------gg
O77737_BCL2L1-01        cgggcgatgagtttgaactga---------------------------gg
A0A8D0J6V8_BCL2L1-      cgggcgatgagtttgaactga---------------------------gg
A0A8D0J6V8_BCL2L1-      cgggcgatgagtttgaactga---------------------------gg
A0A8D0J6V8_BCL2L1-      cgggcgatgagtttgaactga---------------------------gg
A0A8D0J6V8_BCL2L1-      cgggcgatgagtttgaactga---------------------------gg
A0A8D0J6V8_BCL2L1-      cgggcgatgagtttgaactga---------------------------gg
A0A4X1SQU7_BCL2L1-      cgggcgatgagtttgaactga---------------------------gg
A0A4X1SQU7_BCL2L1-      cgggcgatgagtttgaactga---------------------------gg
A0A4X1SQU7_BCL2L1-      cgggcgatgagtttgaactga---------------------------gg
A0A4X1SRM7_BCL2L1-      cgggcgatgagtttgaactga---------------------------gg
A0A8D0XF62_BCL2L1-      cgggcgatgagtttgaactga---------------------------gg
A0A8D1ALD6_BCL2L1-      cgggcgatgagtttgaactga---------------------------gg
A0A4X1SQU7_BCL2L1-      cgggcgatgagtttgaactga---------------------------gg
A0A4X1SF63_BCL2L2-      cttg----gagtctgaggagctggagcctga-------------------
A0A4X1SF63_BCL2L2-      cttg----gagtctgaggagctggagcctga-------------------
A0A8D0TJQ9_BCL2L2-      cttg----gagtctgaggagctggagcctga-------------------
A0A482LX62_BCL2L2-      ctggagatgagttcgagaccc----gcttcc-------------------
A0A3Q9B4M8_BCL2L2-      ctggagatgagttcgagaccc----gcttcc-------------------
A0A7T8CLX7_BCL2L2-      ctggagatgagttcgagaccc----gcttcc-------------------
A0A8D0TJQ9_BCL2L2-      ctggagatgagttcgagaccc----gcttcc-------------------
A0A4X1SF60_BCL2L2-      ctggagatgagttcgagaccc----gcttcc-------------------
A0A4X1SF63_BCL2L2-      ctggagatgagttcgagaccc----gcttcc-------------------
A0A8D0TJQ9_BCL2L2-      ctggagatgagttcgagaccc----gcttcc-------------------
A0A4X1SF63_BCL2L2-      ctggagatgagttcgagaccc----gcttcc-------------------
A0A4D6NWN1_BCL2L2-      ctggagatgagttcgagaccc----gcttcc-------------------
A0A4X1SF60_BCL2L2-      ctggagatgagttcgagaccc----gcttcc-------------------
A0A4X1SF63_BCL2L2-      ctggagatgagttcgagaccc----gcttcc-------------------
A0A8D0TJQ9_BCL2L2-      ctggagatgagttcgagaccc----gcttcc-------------------
A0A4X1SF60_BCL2L2-      ctggagatgagttcgagaccc----gcttcc-------------------
A0A8D0TJQ9_BCL2L2-      ctggagatgagttcgagaccc----gcttcc-------------------
A0A8D0QLD9_BCL2-03      ctcccagcccgggcgaa---------------------------------
A0A4X1TRR9_BCL2-01      ctcccagcccgggcgaa---------------------------------
A0A8D0QLD9_BCL2-01      ctcccagcccgggcgaa---------------------------------
A0A4X1TRR9_BCL2-03      ctcccagcccgggcgaa---------------------------------
A0A8D1BRF8_BCL2A1-      ----------agctgaa---------------------------------
A0A8D0Z1Y4_BCL2A1-      ----------agctgaa---------------------------------
A0A8D1SK15_BCL2A1-      ----------agctgaa---------------------------------
A0A4X1UP21_BCL2A1-      ----------agctgaa---------------------------------
A0A8D1BRF8_BCL2A1-      ----------agctgaa---------------------------------
A0A8D1YBS8_BCL2A1-      ----------agctgaa---------------------------------
A0A4X1UP21_BCL2A1-      tccaaaacgaagttgaaaaga----atttga-------------------
A0A4X1UQW5_BCL2A1-      tccaaaacgaagttgaaaaga----atttga-------------------
A0A8D0Z1Y4_BCL2A1-      tccaaaacgaagttgaaaaga----atttga-------------------
A0A8D1BRF8_BCL2A1-      tccaaaacgaagttgaaaaga----atttga-------------------
A0A8D1SK15_BCL2A1-      tccaaaacgaagttgaaaaga----atttga-------------------
A0A8D1YBS8_BCL2A1-      tccaaaacgaagttgaaaaga----atttga-------------------
C7F841_BCL2A1-01        tccaaaacgaagttgaaaaga----atttga-------------------
A0A8D1KPD1_BCL2A1-      tccaaaacgaagttgaaaaga----atttga-------------------
A0A8D1BRF8_BCL2A1-      tccaaaacgaagttgaaaaga----atttga-------------------
A0A4X1UP21_BCL2A1-      tccaaaacgaagttgaaaaga----atttga-------------------
A0A8D1SK15_BCL2A1-      tccaaaacgaagttgaaaaga----atttga-------------------
A0A8D0Z1Y4_BCL2A1-      tccaaaacgaagttgaaaaga----atttga-------------------
A0A8D1YBS8_BCL2A1-      tccaaaacgaagttgaaaaga----atttga-------------------
Q95KR3_MCL1-01          --------------------------------------------------
A0A8D1FTD4_MCL1-03      aggtagggggaggggaagccg----gcatggtgattggcggaagcgccgg
A0A8D1G1G8_MCL1-04      aggtagggggaggggaagccg----gcatggtgattggcggaagcgccgg
A0A4X1SEZ6_MCL1-01      aggtagggggaggggaagccg----gcatggtgattggcggaagcgccgg
A0A4X1SFB1_MCL1-01      aggtagggggaggggaagccg----gcatggtgattggcggaagcgccgg
A0A8D1FTD4_MCL1-01      aggtagggggaggggaagccg----gcatggtgattggcggaagcgccgg
A0A8D1G1G8_MCL1-02      aggtagggggaggggaagccg----gcatggtgattggcggaagcgccgg
A0A8D1RYD1_MCL1-01      aggtagggggaggggaagccg----gcatggtgattggcggaagcgccgg
A0A4X1SEU3_MCL1-02      --------------------------------------------------
A0A4X1SEZ6_MCL1-03      --------------------------------------------------
A0A4X1SFB1_MCL1-02      --------------------------------------------------
A0A8D1FTD4_MCL1-05      --------------------------------------------------
A0A8D1G1G8_MCL1-01      --------------------------------------------------
A0A8D1RYD1_MCL1-03      --------------------------------------------------
A0A4X1SEU3_MCL1-01      nnnnnnnnnnnnnnnnnnnnn----nnnnnnnnnnnnnnnnnnnnnnnnn
A0A8D1G1G8_MCL1-03      --------------------------------------------------
A0A8D1FTD4_MCL1-02      aggtagggggaggggaagccg----gcatggtgattggcggaagcgccgg
A0A8D1RYD1_MCL1-02      aggtagggggaggggaagccg----gcatggtgattggcggaagcgccgg
A0A4X1SEZ6_MCL1-02      aggtagggggaggggaagccg----gcatggtgattggcggaagcgccgg
A0A8D1FTD4_MCL1-04      aggtagggggaggggaagccg----gcatggtgattggcggaagcgccgg
A0A8D0QLD9_BCL2-07      caaagaaagaaattgaaaaac----actctattaatgataaacaggtgg-
A0A4X1TRR9_BCL2-06      caaagaaagaaattgaaaaac----actctattaatgataaacaggtgg-
A0A8D0QLD9_BCL2-05      caaagaaagaaattgaaaaac----actctattaatgataaacaggtgg-
A0A4X1TRR9_BCL2-05      caaagaaagaaattgaaaaac----actctattaatgataaacaggtgg-
A0A8D0QLD9_BCL2-04      caaagaaagaaattgaaaaac----actctattaatgataaacaggtgg-
A0A4X1TRR9_BCL2-07      caaagaaagaaattgaaaaac----actctattaatgataaacaggtgg-
A0A8D0QLD9_BCL2-06      caaagaaagaaattgaaaaac----actctattaatgataaacaggtgg-
A0A4X1TRR9_BCL2-04      caaagaaagaaattgaaaaac----actctattaatgataaacaggtgg-
A0A4X1TRR9_BCL2-02      caaagaaagaaattgaaaaac----actctattaatgataaacaggtgg-
A0A8D0QLD9_BCL2-02      caaagaaagaaattgaaaaac----actctattaatgataaacaggtgg-
                                                                          

A0A8D1N411_BCL2L10      ---------------gcgcaccttgtctgtctaccgcggcttccgctgga
A0A8D1ITC0_BCL2L10      ---------------gcgcaccttgtctgtctaccgcggcttccgctgga
A0A4X1T1Z2_BCL2L10      ---------------gcgcaccttgtctgtctaccgcggcttccgctgga
A0A8D1QEZ6_BCL2L10      ---------------gcgcaccttgtctgtctaccgcggcttccgctgga
A0A8D1ALD6_BCL2L1-      taccggagggcattcagtgacctgacgtcccagctccacatcaccccagg
A0A4X1SQU7_BCL2L1-      taccggagggcattcagtgacctgacgtcccagctccacatcaccccagg
A0A8D0XF62_BCL2L1-      taccggagggcattcagtgacctgacgtcccagctccacatcaccccagg
O77737_BCL2L1-01        taccggagggcattcagtgacctgacgtcccagctccacatcaccccagg
A0A8D0J6V8_BCL2L1-      taccggagggcattcagtgacctgacgtcccagctccacatcaccccagg
A0A8D0J6V8_BCL2L1-      taccggagggcattcagtgacctgacgtcccagctccacatcaccccagg
A0A8D0J6V8_BCL2L1-      taccggagggcattcagtgacctgacgtcccagctccacatcaccccagg
A0A8D0J6V8_BCL2L1-      taccggagggcattcagtgacctgacgtcccagctccacatcaccccagg
A0A8D0J6V8_BCL2L1-      taccggagggcattcagtgacctgacgtcccagctccacatcaccccagg
A0A4X1SQU7_BCL2L1-      taccggagggcattcagtgacctgacgtcccagctccacatcaccccagg
A0A4X1SQU7_BCL2L1-      taccggagggcattcagtgacctgacgtcccagctccacatcaccccagg
A0A4X1SQU7_BCL2L1-      taccggagggcattcagtgacctgacgtcccagctccacatcaccccagg
A0A4X1SRM7_BCL2L1-      taccggagggcattcagtgacctgacgtcccagctccacatcaccccagg
A0A8D0XF62_BCL2L1-      taccggagggcattcagtgacctgacgtcccagctccacatcaccccagg
A0A8D1ALD6_BCL2L1-      taccggagggcattcagtgacctgacgtcccagctccacatcaccccagg
A0A4X1SQU7_BCL2L1-      taccggagggcattcagtgacctgacgtcccagctccacatcaccccagg
A0A4X1SF63_BCL2L2-      ----ggagctgctgct--------ggagccc----------gagccggag
A0A4X1SF63_BCL2L2-      ----ggagctgctgct--------ggagccc----------gagccggag
A0A8D0TJQ9_BCL2L2-      ----ggagctgctgct--------ggagccc----------gagccggag
A0A482LX62_BCL2L2-      ----ggcgcaccttctcagatttggcagctcagttgcatgtgaccccggg
A0A3Q9B4M8_BCL2L2-      ----ggcgcaccttctcagatttggcagctcagttgcatgtgaccccggg
A0A7T8CLX7_BCL2L2-      ----ggcgcaccttctcagatttggcagctcagttgcatgtgaccccggg
A0A8D0TJQ9_BCL2L2-      ----ggcgcaccttctcagatttggcagctcagttgcatgtgaccccggg
A0A4X1SF60_BCL2L2-      ----ggcgcaccttctcagatttggcagctcagttgcatgtgaccccggg
A0A4X1SF63_BCL2L2-      ----ggcgcaccttctcagatttggcagctcagttgcatgtgaccccggg
A0A8D0TJQ9_BCL2L2-      ----ggcgcaccttctcagatttggcagctcagttgcatgtgaccccggg
A0A4X1SF63_BCL2L2-      ----ggcgcaccttctcagatttggcagctcagttgcatgtgaccccggg
A0A4D6NWN1_BCL2L2-      ----ggcgcaccttctcagatttggcagctcagttgcatgtgaccccggg
A0A4X1SF60_BCL2L2-      ----ggcgcaccttctcagatttggcagctcagttgcatgtgaccccggg
A0A4X1SF63_BCL2L2-      ----ggcgcaccttctcagatttggcagctcagttgcatgtgaccccggg
A0A8D0TJQ9_BCL2L2-      ----ggcgcaccttctcagatttggcagctcagttgcatgtgaccccggg
A0A4X1SF60_BCL2L2-      ----ggcgcaccttctcagatttggcagctcagttgcatgtgaccccggg
A0A8D0TJQ9_BCL2L2-      ----ggcgcaccttctcagatttggcagctcagttgcatgtgaccccggg
A0A8D0QLD9_BCL2-03      -------cccccgctcccgccaggacctcgccgccgc-cgaccccgaccg
A0A4X1TRR9_BCL2-01      -------cccccgctcccgccaggacctcgccgccgc-cgaccccgaccg
A0A8D0QLD9_BCL2-01      -------cccccgctcccgccaggacctcgccgccgc-cgaccccgaccg
A0A4X1TRR9_BCL2-03      -------cccccgctcccgccaggacctcgccgccgc-cgaccccgaccg
A0A8D1BRF8_BCL2A1-      -----------------------------------gc-agcgtctgcggg
A0A8D0Z1Y4_BCL2A1-      -----------------------------------gc-agcgtctgcggg
A0A8D1SK15_BCL2A1-      -----------------------------------gc-agcgtctgcggg
A0A4X1UP21_BCL2A1-      -----------------------------------gc-agcgtctgcggg
A0A8D1BRF8_BCL2A1-      -----------------------------------gc-agcgtctgcggg
A0A8D1YBS8_BCL2A1-      -----------------------------------gc-agcgtctgcggg
A0A4X1UP21_BCL2A1-      ------------aaccatgcttggacaattttgatgt-tgtgtccataga
A0A4X1UQW5_BCL2A1-      ------------aaccatgcttggacaattttgatgt-tgtgtccataga
A0A8D0Z1Y4_BCL2A1-      ------------aaccatgcttggacaattttgatgt-tgtgtccataga
A0A8D1BRF8_BCL2A1-      ------------aaccatgcttggacaattttgatgt-tgtgtccataga
A0A8D1SK15_BCL2A1-      ------------aaccatgcttggacaattttgatgt-tgtgtccataga
A0A8D1YBS8_BCL2A1-      ------------aaccatgcttggacaattttgatgt-tgtgtccataga
C7F841_BCL2A1-01        ------------aaccatgcttggacaattttgatgt-tgtgtccataga
A0A8D1KPD1_BCL2A1-      ------------aaccatgcttggacaattttgatgt-tgtgtccataga
A0A8D1BRF8_BCL2A1-      ------------aaccatgcttggacaattttgatgt-tgtgtccataga
A0A4X1UP21_BCL2A1-      ------------aaccatgcttggacaattttgatgt-tgtgtccataga
A0A8D1SK15_BCL2A1-      ------------aaccatgcttggacaattttgatgt-tgtgtccataga
A0A8D0Z1Y4_BCL2A1-      ------------aaccatgcttggacaattttgatgt-tgtgtccataga
A0A8D1YBS8_BCL2A1-      ------------aaccatgcttggacaattttgatgt-tgtgtccataga
Q95KR3_MCL1-01          --------------------------------------------------
A0A8D1FTD4_MCL1-03      cgcgagccccccgtccactcctgcgccagacgcccgg-agggtcgcgcgg
A0A8D1G1G8_MCL1-04      cgcgagccccccgtccactcctgcgccagacgcccgg-agggtcgcgcgg
A0A4X1SEZ6_MCL1-01      cgcgagccccccgtccactcctgcgccagacgcccgg-agggtcgcgcgg
A0A4X1SFB1_MCL1-01      cgcgagccccccgtccactcctgcgccagacgcccgg-agggtcgcgcgg
A0A8D1FTD4_MCL1-01      cgcgagccccccgtccactcctgcgccagacgcccgg-agggtcgcgcgg
A0A8D1G1G8_MCL1-02      cgcgagccccccgtccactcctgcgccagacgcccgg-agggtcgcgcgg
A0A8D1RYD1_MCL1-01      cgcgagccccccgtccactcctgcgccagacgcccgg-agggtcgcgcgg
A0A4X1SEU3_MCL1-02      --------------------------------------------------
A0A4X1SEZ6_MCL1-03      --------------------------------------------------
A0A4X1SFB1_MCL1-02      --------------------------------------------------
A0A8D1FTD4_MCL1-05      --------------------------------------------------
A0A8D1G1G8_MCL1-01      --------------------------------------------------
A0A8D1RYD1_MCL1-03      --------------------------------------------------
A0A4X1SEU3_MCL1-01      nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn-nnnnnnnnnnnn
A0A8D1G1G8_MCL1-03      --------------------------------------------------
A0A8D1FTD4_MCL1-02      cgcgagccccccgtccactcctgcgccagacgcccgg-agggtcgcgcgg
A0A8D1RYD1_MCL1-02      cgcgagccccccgtccactcctgcgccagacgcccgg-agggtcgcgcgg
A0A4X1SEZ6_MCL1-02      cgcgagccccccgtccactcctgcgccagacgcccgg-agggtcgcgcgg
A0A8D1FTD4_MCL1-04      cgcgagccccccgtccactcctgcgccagacgcccgg-agggtcgcgcgg
A0A8D0QLD9_BCL2-07      ------------------tgctttgtatatcagttga-tgtgtctcaaga
A0A4X1TRR9_BCL2-06      ------------------tgctttgtatatcagttga-tgtgtctcaaga
A0A8D0QLD9_BCL2-05      ------------------tgctttgtatatcagttga-tgtgtctcaaga
A0A4X1TRR9_BCL2-05      ------------------tgctttgtatatcagttga-tgtgtctcaaga
A0A8D0QLD9_BCL2-04      ------------------tgctttgtatatcagttga-tgtgtctcaaga
A0A4X1TRR9_BCL2-07      ------------------tgctttgtatatcagttga-tgtgtctcaaga
A0A8D0QLD9_BCL2-06      ------------------tgctttgtatatcagttga-tgtgtctcaaga
A0A4X1TRR9_BCL2-04      ------------------tgctttgtatatcagttga-tgtgtctcaaga
A0A4X1TRR9_BCL2-02      ------------------tgctttgtatatcagttga-tgtgtctcaaga
A0A8D0QLD9_BCL2-02      ------------------tgctttgtatatcagttga-tgtgtctcaaga
                                                                          

A0A8D1N411_BCL2L10      accgtgtcgaattggtggcctg----------------------------
A0A8D1ITC0_BCL2L10      accgtgtcgaattggtggcctg----------------------------
A0A4X1T1Z2_BCL2L10      accgtgtcgaattggtggcctg----------------------------
A0A8D1QEZ6_BCL2L10      accgtgtcgaattggtggcctg----------------------------
A0A8D1ALD6_BCL2L1-      gaca-gcgtatcagagctttgagca-------------------------
A0A4X1SQU7_BCL2L1-      gaca-gcgtatcagagctttgagca-------------------------
A0A8D0XF62_BCL2L1-      gaca-gcgtatcagagctttgagca-------------------------
O77737_BCL2L1-01        gaca-gcgtatcagagctttgagca-------------------------
A0A8D0J6V8_BCL2L1-      gaca-gcgtatcagagctttgagca-------------------------
A0A8D0J6V8_BCL2L1-      gaca-gcgtatcagagctttgagca-------------------------
A0A8D0J6V8_BCL2L1-      gaca-gcgtatcagagctttgagca-------------------------
A0A8D0J6V8_BCL2L1-      gaca-gcgtatcagagctttgagca-------------------------
A0A8D0J6V8_BCL2L1-      gaca-gcgtatcagagctttgagca-------------------------
A0A4X1SQU7_BCL2L1-      gaca-gcgtatcagagctttgagca-------------------------
A0A4X1SQU7_BCL2L1-      gaca-gcgtatcagagctttgagca-------------------------
A0A4X1SQU7_BCL2L1-      gaca-gcgtatcagagctttgagca-------------------------
A0A4X1SRM7_BCL2L1-      gaca-gcgtatcagagctttgagca-------------------------
A0A8D0XF62_BCL2L1-      gaca-gcgtatcagagctttgagca-------------------------
A0A8D1ALD6_BCL2L1-      gaca-gcgtatcagagctttgagca-------------------------
A0A4X1SQU7_BCL2L1-      gaca-gcgtatcagagctttgag---------------------------
A0A4X1SF63_BCL2L2-      cccgagcccgaagaggagccgcccc-------------------------
A0A4X1SF63_BCL2L2-      cccgagcccgaagaggagccgcccc-------------------------
A0A8D0TJQ9_BCL2L2-      cccgagcccgaagaggagccgcccc-------------------------
A0A482LX62_BCL2L2-      ctcg-gcccagcagcgcttcaccca-------------------------
A0A3Q9B4M8_BCL2L2-      ctcg-gcccagcagcgcttcaccca-------------------------
A0A7T8CLX7_BCL2L2-      ctcg-gcccagcagcgcttcaccca-------------------------
A0A8D0TJQ9_BCL2L2-      ctcg-gcccagcagcgcttcaccca-------------------------
A0A4X1SF60_BCL2L2-      ctcg-gcccagcagcgcttcaccca-------------------------
A0A4X1SF63_BCL2L2-      ctcg-gcccagcagcgcttcaccca-------------------------
A0A8D0TJQ9_BCL2L2-      ctcg-gcccagcagcgcttcaccca-------------------------
A0A4X1SF63_BCL2L2-      ctcg-gcccagcagcgcttcaccca-------------------------
A0A4D6NWN1_BCL2L2-      ctcg-gcccagcagcgcttcaccca-------------------------
A0A4X1SF60_BCL2L2-      ctcg-gcccagcagcgcttcaccca-------------------------
A0A4X1SF63_BCL2L2-      ctcg-gcccagcagcgcttcaccca-------------------------
A0A8D0TJQ9_BCL2L2-      ctcg-gcccagcagcgcttcaccca-------------------------
A0A4X1SF60_BCL2L2-      ctcg-gcccagcagcgcttcaccca-------------------------
A0A8D0TJQ9_BCL2L2-      ctcg-gcccagcagcgcttcaccca-------------------------
A0A8D0QLD9_BCL2-03      cccccgccg-----------------------------------------
A0A4X1TRR9_BCL2-01      cccccgccg-----------------------------------------
A0A8D0QLD9_BCL2-01      cccccgccg-----------------------------------------
A0A4X1TRR9_BCL2-03      cccccgccg-----------------------------------------
A0A8D1BRF8_BCL2A1-      cggtg---------------------------------------------
A0A8D0Z1Y4_BCL2A1-      cggtg---------------------------------------------
A0A8D1SK15_BCL2A1-      cggtg---------------------------------------------
A0A4X1UP21_BCL2A1-      cggtg---------------------------------------------
A0A8D1BRF8_BCL2A1-      cggtg---------------------------------------------
A0A8D1YBS8_BCL2A1-      cggtg---------------------------------------------
A0A4X1UP21_BCL2A1-      cactgccagaataa------------------------------------
A0A4X1UQW5_BCL2A1-      cactgccagaataa------------------------------------
A0A8D0Z1Y4_BCL2A1-      cactgccagaataa------------------------------------
A0A8D1BRF8_BCL2A1-      cactgccagaataa------------------------------------
A0A8D1SK15_BCL2A1-      cactgccagaataa------------------------------------
A0A8D1YBS8_BCL2A1-      cactgccagaataa------------------------------------
C7F841_BCL2A1-01        cactgccagaataa------------------------------------
A0A8D1KPD1_BCL2A1-      cactgccagaataa------------------------------------
A0A8D1BRF8_BCL2A1-      cactgccagaataa------------------------------------
A0A4X1UP21_BCL2A1-      cactgccagaataa------------------------------------
A0A8D1SK15_BCL2A1-      cactgccagaataa------------------------------------
A0A8D0Z1Y4_BCL2A1-      cactgccagaataa------------------------------------
A0A8D1YBS8_BCL2A1-      cactgccagaataa------------------------------------
Q95KR3_MCL1-01          --------------------------------------------------
A0A8D1FTD4_MCL1-03      ccctcgcccattggcgccgagggccccgacgtcaccgcgacccccgccag
A0A8D1G1G8_MCL1-04      ccctcgcccattggcgccgagggccccgacgtcaccgcgacccccgccag
A0A4X1SEZ6_MCL1-01      ccctcgcccattggcgccgagggccccgacgtcaccgcgacccccgccag
A0A4X1SFB1_MCL1-01      ccctcgcccattggcgccgagggccccgacgtcaccgcgacccccgccag
A0A8D1FTD4_MCL1-01      ccctcgcccattggcgccgagggccccgacgtcaccgcgacccccgccag
A0A8D1G1G8_MCL1-02      ccctcgcccattggcgccgagggccccgacgtcaccgcgacccccgccag
A0A8D1RYD1_MCL1-01      ccctcgcccattggcgccgagggccccgacgtcaccgcgacccccgccag
A0A4X1SEU3_MCL1-02      --------------------------------------------------
A0A4X1SEZ6_MCL1-03      --------------------------------------------------
A0A4X1SFB1_MCL1-02      --------------------------------------------------
A0A8D1FTD4_MCL1-05      --------------------------------------------------
A0A8D1G1G8_MCL1-01      --------------------------------------------------
A0A8D1RYD1_MCL1-03      --------------------------------------------------
A0A4X1SEU3_MCL1-01      nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
A0A8D1G1G8_MCL1-03      --------------------------------------------------
A0A8D1FTD4_MCL1-02      ccctcgcccattggcgccgagggccccgacgtcaccgcgacccccgccag
A0A8D1RYD1_MCL1-02      ccctcgcccattggcgccgagggccccgacgtcaccgcgacccccgccag
A0A4X1SEZ6_MCL1-02      ccctcgcccattggcgccgagggccccgacgtcaccgcgacccccgccag
A0A8D1FTD4_MCL1-04      ccctcgcccattggcgccgagggccccgacgtcaccgcgacccccgccag
A0A8D0QLD9_BCL2-07      ctatagccaagtag----------------------------------ag
A0A4X1TRR9_BCL2-06      ctatagccaagtag----------------------------------ag
A0A8D0QLD9_BCL2-05      ctatagccaagtag----------------------------------ag
A0A4X1TRR9_BCL2-05      ctatagccaagtag----------------------------------ag
A0A8D0QLD9_BCL2-04      ctatagccaagtag----------------------------------ag
A0A4X1TRR9_BCL2-07      ctatagccaagtag----------------------------------ag
A0A8D0QLD9_BCL2-06      ctatagccaagtag----------------------------------ag
A0A4X1TRR9_BCL2-04      ctatagccaagtag----------------------------------ag
A0A4X1TRR9_BCL2-02      ctatagccaagtag----------------------------------ag
A0A8D0QLD9_BCL2-02      ctatagccaagtag----------------------------------ag
                                                                          

A0A8D1N411_BCL2L10      ------------------------------gatggcacagaaactactcg
A0A8D1ITC0_BCL2L10      ------------------------------gatggcacagaaaaaactcg
A0A4X1T1Z2_BCL2L10      ------------------------------gatggcacagaaactactcg
A0A8D1QEZ6_BCL2L10      ------------------------------gatggcacagaaactactcg
A0A8D1ALD6_BCL2L1-      ------------------------------ggtagtgaacgaactcttcc
A0A4X1SQU7_BCL2L1-      ------------------------------ggtagtgaacgaactcttcc
A0A8D0XF62_BCL2L1-      ------------------------------ggtagtgaacgaactcttcc
O77737_BCL2L1-01        ------------------------------ggtattgaacgaactcttcc
A0A8D0J6V8_BCL2L1-      ------------------------------ggtagtgaacgaactcttcc
A0A8D0J6V8_BCL2L1-      ------------------------------ggtagtgaacgaactcttcc
A0A8D0J6V8_BCL2L1-      ------------------------------ggtagtgaacgaactcttcc
A0A8D0J6V8_BCL2L1-      ------------------------------ggtagtgaacgaactcttcc
A0A8D0J6V8_BCL2L1-      ------------------------------ggtagtgaacgaactcttcc
A0A4X1SQU7_BCL2L1-      ------------------------------ggtagtgaacgaactcttcc
A0A4X1SQU7_BCL2L1-      ------------------------------ggtagtgaacgaactcttcc
A0A4X1SQU7_BCL2L1-      ------------------------------ggtagtgaacgaactcttcc
A0A4X1SRM7_BCL2L1-      ------------------------------ggtagtgaacgaactcttcc
A0A8D0XF62_BCL2L1-      ------------------------------ggtagtgaacgaactcttcc
A0A8D1ALD6_BCL2L1-      ------------------------------ggtagtgaacgaactcttcc
A0A4X1SQU7_BCL2L1-      --------------------------------------------------
A0A4X1SF63_BCL2L2-      ------------------------------ggcccc----gcgccccccc
A0A4X1SF63_BCL2L2-      ------------------------------ggcccc----gcgccccccc
A0A8D0TJQ9_BCL2L2-      ------------------------------ggcccc----gcgccccccc
A0A482LX62_BCL2L2-      ------------------------------ggtctctgatgaactcttcc
A0A3Q9B4M8_BCL2L2-      ------------------------------ggtctctgatgaactcttcc
A0A7T8CLX7_BCL2L2-      ------------------------------ggtctctgatgaactcttcc
A0A8D0TJQ9_BCL2L2-      ------------------------------ggtctctgatgaactcttcc
A0A4X1SF60_BCL2L2-      ------------------------------ggtctctgatgaactcttcc
A0A4X1SF63_BCL2L2-      ------------------------------ggtctctgatgaactcttcc
A0A8D0TJQ9_BCL2L2-      ------------------------------ggtctctgatgaactcttcc
A0A4X1SF63_BCL2L2-      ------------------------------ggtctctgatgaactcttcc
A0A4D6NWN1_BCL2L2-      ------------------------------ggtctctgatgaactcttcc
A0A4X1SF60_BCL2L2-      ------------------------------ggtctctgatgaactcttcc
A0A4X1SF63_BCL2L2-      ------------------------------ggtctctgatgaactcttcc
A0A8D0TJQ9_BCL2L2-      ------------------------------ggtctctgatgaactcttcc
A0A4X1SF60_BCL2L2-      ------------------------------ggtctctgatgaactcttcc
A0A8D0TJQ9_BCL2L2-      ------------------------------ggtctctgatgaactcttcc
A0A8D0QLD9_BCL2-03      --------------------------------------------ccaccg
A0A4X1TRR9_BCL2-01      --------------------------------------------ccaccg
A0A8D0QLD9_BCL2-01      --------------------------------------------ccaccg
A0A4X1TRR9_BCL2-03      --------------------------------------------ccaccg
A0A8D1BRF8_BCL2A1-      --------------agc-------------g-------------------
A0A8D0Z1Y4_BCL2A1-      --------------agc-------------g-------------------
A0A8D1SK15_BCL2A1-      --------------agc-------------g-------------------
A0A4X1UP21_BCL2A1-      --------------agc-------------g-------------------
A0A8D1BRF8_BCL2A1-      --------------agc-------------g-------------------
A0A8D1YBS8_BCL2A1-      --------------agc-------------g-------------------
A0A4X1UP21_BCL2A1-      ----tattcaatcaagt-------------gatggaaaaggaatttgaag
A0A4X1UQW5_BCL2A1-      ----tattcaatcaagt-------------gatggaaaaggaatttgaag
A0A8D0Z1Y4_BCL2A1-      ----tattcaatcaagt-------------gatggaaaaggaatttgaag
A0A8D1BRF8_BCL2A1-      ----tattcaatcaagt-------------gatggaaaaggaatttgaag
A0A8D1SK15_BCL2A1-      ----tattcaatcaagt-------------gatggaaaaggaatttgaag
A0A8D1YBS8_BCL2A1-      ----tattcaatcaagt-------------gatggaaaaggaatttgaag
C7F841_BCL2A1-01        ----tattcaatcaagt-------------gatggaaaaggaatttgaag
A0A8D1KPD1_BCL2A1-      ----tattcaatcaagt-------------gatggaaaaggaatttgaag
A0A8D1BRF8_BCL2A1-      ----tattcaatcaagt-------------gatggaaaaggaatttgaag
A0A4X1UP21_BCL2A1-      ----tattcaatcaagt-------------gatggaaaaggaatttgaag
A0A8D1SK15_BCL2A1-      ----tattcaatcaagt-------------gatggaaaaggaatttgaag
A0A8D0Z1Y4_BCL2A1-      ----tattcaatcaagt-------------gatggaaaaggaatttgaag
A0A8D1YBS8_BCL2A1-      ----tattcaatcaagt-------------gatggaaaaggaatttgaag
Q95KR3_MCL1-01          --------------------------------------------------
A0A8D1FTD4_MCL1-03      actgctgttcttcgcgcccacccgcctcgcgtcgccgcctgaagagatgg
A0A8D1G1G8_MCL1-04      actgctgttcttcgcgcccacccgcctcgcgtcgccgcctgaagagatgg
A0A4X1SEZ6_MCL1-01      actgctgttcttcgcgcccacccgcctcgcgtcgccgcctgaagagatgg
A0A4X1SFB1_MCL1-01      actgctgttcttcgcgcccacccgcctcgcgtcgccgcctgaagagatgg
A0A8D1FTD4_MCL1-01      actgctgttcttcgcgcccacccgcctcgcgtcgccgcctgaagagatgg
A0A8D1G1G8_MCL1-02      actgctgttcttcgcgcccacccgcctcgcgtcgccgcctgaagagatgg
A0A8D1RYD1_MCL1-01      actgctgttcttcgcgcccacccgcctcgcgtcgccgcctgaagagatgg
A0A4X1SEU3_MCL1-02      --------------------------------------------------
A0A4X1SEZ6_MCL1-03      --------------------------------------------------
A0A4X1SFB1_MCL1-02      --------------------------------------------------
A0A8D1FTD4_MCL1-05      --------------------------------------------------
A0A8D1G1G8_MCL1-01      --------------------------------------------------
A0A8D1RYD1_MCL1-03      --------------------------------------------------
A0A4X1SEU3_MCL1-01      nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
A0A8D1G1G8_MCL1-03      --------------------------------------------------
A0A8D1FTD4_MCL1-02      actgctgttcttcgcgcccacccgcctcgcgtcgccgcctgaagagatgg
A0A8D1RYD1_MCL1-02      actgctgttcttcgcgcccacccgcctcgcgtcgccgcctgaagagatgg
A0A4X1SEZ6_MCL1-02      actgctgttcttcgcgcccacccgcctcgcgtcgccgcctgaagagatgg
A0A8D1FTD4_MCL1-04      actgctgttcttcgcgcccacccgcctcgcgtcgccgcctgaagagatgg
A0A8D0QLD9_BCL2-07      aatgtcataaaacaagcaca----------ggagaaactgggcccagtgg
A0A4X1TRR9_BCL2-06      aatgtcataaaacaagcaca----------ggagaaactgggcccagtgg
A0A8D0QLD9_BCL2-05      aatgtcataaaacaagcaca----------ggagaaactgggcccagtgg
A0A4X1TRR9_BCL2-05      aatgtcataaaacaagcaca----------ggagaaactgggcccagtgg
A0A8D0QLD9_BCL2-04      aatgtcataaaacaagcaca----------ggagaaactgggcccagtgg
A0A4X1TRR9_BCL2-07      aatgtcataaaacaagcaca----------ggagaaactgggcccagtgg
A0A8D0QLD9_BCL2-06      aatgtcataaaacaagcaca----------ggagaaactgggcccagtgg
A0A4X1TRR9_BCL2-04      aatgtcataaaacaagcaca----------ggagaaactgggcccagtgg
A0A4X1TRR9_BCL2-02      aatgtcataaaacaagcaca----------ggagaaactgggcccagtgg
A0A8D0QLD9_BCL2-02      aatgtcataaaacaagcaca----------ggagaaactgggcccagtgg
                                                                          

A0A8D1N411_BCL2L10      caagcccacgtggccccaactggtaccgcgtggcatcactcttgaccttc
A0A8D1ITC0_BCL2L10      caagcccacgtggccccaactggtaccgcgtggcatcactcttgaccttc
A0A4X1T1Z2_BCL2L10      caagcccacgtggccccaactggtaccgcgtggcatcactcttgaccttc
A0A8D1QEZ6_BCL2L10      caagcccacgtggccccaactggtaccgcgtggcatcactcttgaccttc
A0A8D1ALD6_BCL2L1-      gggat------ggggtgaactggggtcgcattgtggcctttttctccttc
A0A4X1SQU7_BCL2L1-      gggat------ggggtgaactggggtcgcattgtggcctttttctccttc
A0A8D0XF62_BCL2L1-      gggat------ggggtgaactggggtcgcattgtggcctttttctccttc
O77737_BCL2L1-01        gggat------ggggtgaactggggtcgcattgtggcctttttctccttc
A0A8D0J6V8_BCL2L1-      gggat------ggggtgaactggggtcgcattgtggcctttttctccttc
A0A8D0J6V8_BCL2L1-      gggat------ggggtgaactggggtcgcattgtggcctttttctccttc
A0A8D0J6V8_BCL2L1-      gggat------ggggtgaactggggtcgcattgtggcctttttctccttc
A0A8D0J6V8_BCL2L1-      gggat------ggggtgaactggggtcgcattgtggcctttttctccttc
A0A8D0J6V8_BCL2L1-      gggat------ggggtgaactggggtcgcattgtggcctttttctccttc
A0A4X1SQU7_BCL2L1-      gggat------ggggtgaactggggtcgcattgtggcctttttctccttc
A0A4X1SQU7_BCL2L1-      gggat------ggggtgaactggggtcgcattgtggcctttttctccttc
A0A4X1SQU7_BCL2L1-      gggat------ggggtgaactggggtcgcattgtggcctttttctccttc
A0A4X1SRM7_BCL2L1-      gggat------ggggtgaactggggtcgcattgtggcctttttctccttc
A0A8D0XF62_BCL2L1-      gggat------ggggtgaactggggtcgcattgtggcctttttctccttc
A0A8D1ALD6_BCL2L1-      gggat------ggggtgaactggggtcgcattgtggcctttttctccttc
A0A4X1SQU7_BCL2L1-      --------------------------------------------------
A0A4X1SF63_BCL2L2-      aggag------ctccgggccctgggcc----------------tggctcg
A0A4X1SF63_BCL2L2-      aggag------ctccgggccctgggcc----------------tggctcg
A0A8D0TJQ9_BCL2L2-      aggag------ctccgggccctgggcc----------------tggctcg
A0A482LX62_BCL2L2-      aaggg------ggccccaactggggccgccttgtggccttctttgtcttc
A0A3Q9B4M8_BCL2L2-      aaggg------ggccccaactggggccgccttgtggccttctttgtcttc
A0A7T8CLX7_BCL2L2-      aaggg------ggccccaactggggccgccttgtggccttctttgtcttc
A0A8D0TJQ9_BCL2L2-      aaggg------ggccccaactggggccgccttgtggccttctttgtcttc
A0A4X1SF60_BCL2L2-      aagga------ggccccaactggggccgccttgtggccttctttgtcttc
A0A4X1SF63_BCL2L2-      aagga------ggccccaactggggccgccttgtggccttctttgtcttc
A0A8D0TJQ9_BCL2L2-      aaggg------ggccccaactggggccgccttgtggccttctttgtcttc
A0A4X1SF63_BCL2L2-      aagga------ggccccaactggggccgccttgtggccttctttgtcttc
A0A4D6NWN1_BCL2L2-      aaggg------ggccccaactggggccgccttgtggccttctttgtcttc
A0A4X1SF60_BCL2L2-      aagga------ggccccaactggggccgccttgtggccttctttgtcttc
A0A4X1SF63_BCL2L2-      aagga------ggccccaactggggccgccttgtggccttctttgtcttc
A0A8D0TJQ9_BCL2L2-      aaggg------ggccccaactggggccgccttgtggccttctttgtcttc
A0A4X1SF60_BCL2L2-      aagga------ggccccaactggggccgccttgtggccttctttgtcttc
A0A8D0TJQ9_BCL2L2-      aaggg------ggccccaactggggccgccttgtggccttctttgtcttc
A0A8D0QLD9_BCL2-03      ccgcc------gccgccgccgccgcggggcctgtactcag----------
A0A4X1TRR9_BCL2-01      ccgcc------gccgccgccgccgcggggcctgtactcag----------
A0A8D0QLD9_BCL2-01      ccgcc------gccgccgccgccgcggggcctgtactcag----------
A0A4X1TRR9_BCL2-03      ccgcc------gccgccgccgccgcggggcctgtactcag----------
A0A8D1BRF8_BCL2A1-      -------------------ccgaggagcggctgcg-ccagtcccgcctct
A0A8D0Z1Y4_BCL2A1-      -------------------ccgaggagcggctgcg-ccagtcccgcctct
A0A8D1SK15_BCL2A1-      -------------------ccgaggagcggctgcg-ccagtcccgcctct
A0A4X1UP21_BCL2A1-      -------------------ccgaggagcggctgcg-ccagtcccgcctct
A0A8D1BRF8_BCL2A1-      -------------------ccgaggagcggctgcg-ccagtcccgcctct
A0A8D1YBS8_BCL2A1-      -------------------ccgaggagcggctgcg-ccagtcccgcctct
A0A4X1UP21_BCL2A1-      atggc------atcattaactggggaaggattgtgaccatatttgcattt
A0A4X1UQW5_BCL2A1-      atggc------atcattaactggggaaggattgtgaccatatttgcattt
A0A8D0Z1Y4_BCL2A1-      atggc------atcattaactggggaaggattgtgaccatatttgcattt
A0A8D1BRF8_BCL2A1-      atggc------atcattaactggggaaggattgtgaccatatttgcattt
A0A8D1SK15_BCL2A1-      atggc------atcattaactggggaaggattgtgaccatatttgcattt
A0A8D1YBS8_BCL2A1-      atggc------atcattaactggggaaggattgtgaccatatttgcattt
C7F841_BCL2A1-01        atggc------atcattaactggggaaggattgtgaccatatttgcattt
A0A8D1KPD1_BCL2A1-      atggc------atcattaactggggaaggattgtgaccatatttgcattt
A0A8D1BRF8_BCL2A1-      atggc------atcattaactggggaaggattgtgaccatatttgcattt
A0A4X1UP21_BCL2A1-      atggc------atcattaactggggaaggattgtgaccatatttgcattt
A0A8D1SK15_BCL2A1-      atggc------atcattaactggggaaggattgtgaccatatttgcattt
A0A8D0Z1Y4_BCL2A1-      atggc------atcattaactggggaaggattgtgaccatatttgcattt
A0A8D1YBS8_BCL2A1-      atggc------atcattaactggggaaggattgtgaccatatttgcattt
Q95KR3_MCL1-01          --------------------------------------------------
A0A8D1FTD4_MCL1-03      aatcc------ccggcctccgacgccatcatgtctcccgaagaggagctg
A0A8D1G1G8_MCL1-04      aatcc------ccggcctccgacgccatcatgtctcccgaagaggagctg
A0A4X1SEZ6_MCL1-01      aatcc------ccggcctccgacgccatcatgtctcccgaagaggagctg
A0A4X1SFB1_MCL1-01      aatcc------ccggcctccgacgccatcatgtctcccgaagaggagctg
A0A8D1FTD4_MCL1-01      aatcc------ccggcctccgacgccatcatgtctcccgaagaggagctg
A0A8D1G1G8_MCL1-02      aatcc------ccggcctccgacgccatcatgtctcccgaagaggagctg
A0A8D1RYD1_MCL1-01      aatcc------ccggcctccgacgccatcatgtctcccgaagaggagctg
A0A4X1SEU3_MCL1-02      --------------------------------------------------
A0A4X1SEZ6_MCL1-03      --------------------------------------------------
A0A4X1SFB1_MCL1-02      --------------------------------------------------
A0A8D1FTD4_MCL1-05      --------------------------------------------------
A0A8D1G1G8_MCL1-01      --------------------------------------------------
A0A8D1RYD1_MCL1-03      --------------------------------------------------
A0A4X1SEU3_MCL1-01      nnnnn------nnnnnnnnnnnnnn------------------------n
A0A8D1G1G8_MCL1-03      --------------------------------------------------
A0A8D1FTD4_MCL1-02      aatcc------ccggcctccgacgccatcatgtctcccgaagaggagctg
A0A8D1RYD1_MCL1-02      aatcc------ccggcctccgacgccatcatgtctcccgaagaggagctg
A0A4X1SEZ6_MCL1-02      aatcc------ccggcctccgacgccatcatgtctcccgaagaggagctg
A0A8D1FTD4_MCL1-04      aatcc------ccggcctccgacgccatcatgtctcccgaagaggagctg
A0A8D0QLD9_BCL2-07      acatg------cttgtaaactgtgcaggaatgtcactttcaggaaaattt
A0A4X1TRR9_BCL2-06      acatg------cttgtaaactgtgcaggaatgtcactttcaggaaaattt
A0A8D0QLD9_BCL2-05      acatg------cttgtaaactgtgcaggaatgtcactttcaggaaaattt
A0A4X1TRR9_BCL2-05      acatg------cttgtaaactgtgcaggaatgtcactttcaggaaaattt
A0A8D0QLD9_BCL2-04      acatg------cttgtaaactgtgcaggaatgtcactttcaggaaaattt
A0A4X1TRR9_BCL2-07      acatg------cttgtaaactgtgcaggaatgtcactttcaggaaaattt
A0A8D0QLD9_BCL2-06      acatg------cttgtaaactgtgcaggaatgtcactttcaggaaaattt
A0A4X1TRR9_BCL2-04      acatg------cttgtaaactgtgcaggaatgtcactttcaggaaaattt
A0A4X1TRR9_BCL2-02      acatg------cttgtaaactgtgcaggaatgtcactttcaggaaaattt
A0A8D0QLD9_BCL2-02      acatg------cttgtaaactgtgcaggaatgtcactttcaggaaaattt
                                                                          

A0A8D1N411_BCL2L10      gcagggatgctgctgg----------------------------------
A0A8D1ITC0_BCL2L10      gcagggatgctgctgg----------------------------------
A0A4X1T1Z2_BCL2L10      gcagggatgctgctgg----------------------------------
A0A8D1QEZ6_BCL2L10      gcagggatgctgctgg----------------------------------
A0A8D1ALD6_BCL2L1-      ggtggggcactgtgcg-------------------------tggagagcg
A0A4X1SQU7_BCL2L1-      ggtggggcactgtgcg-------------------------tggagagcg
A0A8D0XF62_BCL2L1-      ggtggggcactgtgcg-------------------------tggagagcg
O77737_BCL2L1-01        ggtggggcactgtgcg-------------------------tggagagcg
A0A8D0J6V8_BCL2L1-      ggtggggcactgtgcg-------------------------tggagagcg
A0A8D0J6V8_BCL2L1-      ggtggggcactgtgcg-------------------------tggagagcg
A0A8D0J6V8_BCL2L1-      ggtggggcactgtgcg-------------------------tggagagcg
A0A8D0J6V8_BCL2L1-      ggtggggcactgtgcg-------------------------tggagagcg
A0A8D0J6V8_BCL2L1-      ggtggggcactgtgcg-------------------------tggagagcg
A0A4X1SQU7_BCL2L1-      ggtggggcactgtgcg-------------------------tggagagcg
A0A4X1SQU7_BCL2L1-      ggtggggcactgtgcg-------------------------tggagagcg
A0A4X1SQU7_BCL2L1-      ggtggggcactgtgcg-------------------------tggagagcg
A0A4X1SRM7_BCL2L1-      ggtggggcactgtgcg-------------------------tggagagcg
A0A8D0XF62_BCL2L1-      ggtggggcactgtgcg-------------------------tggagagcg
A0A8D1ALD6_BCL2L1-      ggtggggcactgtgcg-------------------------tggagagcg
A0A4X1SQU7_BCL2L1-      --------------------------------------------------
A0A4X1SF63_BCL2L2-      ggagc--ccccggcag-------------------------ccaggag--
A0A4X1SF63_BCL2L2-      ggagc--ccccggcag-------------------------ccaggag--
A0A8D0TJQ9_BCL2L2-      ggagc--ccccggcag-------------------------ccaggag--
A0A482LX62_BCL2L2-      ggagctgcactgtgtg-------------------------ctgagagtg
A0A3Q9B4M8_BCL2L2-      ggagctgcactgtgtg-------------------------ctgagagtg
A0A7T8CLX7_BCL2L2-      ggagctgcactgtgtg-------------------------ctgagagtg
A0A8D0TJQ9_BCL2L2-      ggagctgcactgtgtg-------------------------ctgagagtg
A0A4X1SF60_BCL2L2-      ggagctgcactgtgtg-------------------------ctgagagtg
A0A4X1SF63_BCL2L2-      ggagctgcactgtgtg-------------------------ctgagagtg
A0A8D0TJQ9_BCL2L2-      ggagctgcactgtgtg-------------------------ctgagagtg
A0A4X1SF63_BCL2L2-      ggagctgcactgtgtg-------------------------ctgagagtg
A0A4D6NWN1_BCL2L2-      ggagctgcactgtgtg-------------------------ctgagagtg
A0A4X1SF60_BCL2L2-      ggagctgcactgtgtg-------------------------ctgagagtg
A0A4X1SF63_BCL2L2-      ggagctgcactgtgtg-------------------------ctgagagtg
A0A8D0TJQ9_BCL2L2-      ggagctgcactgtgtg-------------------------ctgagagtg
A0A4X1SF60_BCL2L2-      ggagctgcactgtgtg-------------------------ctgagagtg
A0A8D0TJQ9_BCL2L2-      ggagctgcactgtgtg-------------------------ctgagagtg
A0A8D0QLD9_BCL2-03      -----------------------------------------cccggtgcc
A0A4X1TRR9_BCL2-01      -----------------------------------------cccggtgcc
A0A8D0QLD9_BCL2-01      -----------------------------------------cccggtgcc
A0A4X1TRR9_BCL2-03      -----------------------------------------cccggtgcc
A0A8D1BRF8_BCL2A1-      taa--------------------------------------cccaga---
A0A8D0Z1Y4_BCL2A1-      taa--------------------------------------cccaga---
A0A8D1SK15_BCL2A1-      taa--------------------------------------cccaga---
A0A4X1UP21_BCL2A1-      taa--------------------------------------cccaga---
A0A8D1BRF8_BCL2A1-      taa--------------------------------------cccaga---
A0A8D1YBS8_BCL2A1-      taa--------------------------------------cccaga---
A0A4X1UP21_BCL2A1-      gaaggtattctcatgaagaaacttctgcgaaagcgaattgccccagatgt
A0A4X1UQW5_BCL2A1-      gaaggtattctcatgaagaaacttctgcgaaagcgaattgccccagatgt
A0A8D0Z1Y4_BCL2A1-      gaaggtattctcatgaagaaacttctgcgaaagcgaattgccccagatgt
A0A8D1BRF8_BCL2A1-      gaaggtattctcatgaagaaacttctgcgaaagcgaattgccccagatgt
A0A8D1SK15_BCL2A1-      gaaggtattctcatgaagaaacttctgcgaaagcgaattgccccagatgt
A0A8D1YBS8_BCL2A1-      gaaggtattctcatgaagaaacttctgcgaaagcgaattgccccagatgt
C7F841_BCL2A1-01        gaaggtattctcatgaagaaacttctgcgaaagcgaattgccccagatgt
A0A8D1KPD1_BCL2A1-      gaaggtattctcatgaagaaacttctgcgaaagcgaattgccccagatgt
A0A8D1BRF8_BCL2A1-      gaaggtattctcatgaagaaacttctgcgaaagcgaattgccccagatgt
A0A4X1UP21_BCL2A1-      gaaggtattctcatgaagaaacttctgcgaaagcgaattgccccagatgt
A0A8D1SK15_BCL2A1-      gaaggtattctcatgaagaaacttctgcgaaagcgaattgccccagatgt
A0A8D0Z1Y4_BCL2A1-      gaaggtattctcatgaagaaacttctgcgaaagcgaattgccccagatgt
A0A8D1YBS8_BCL2A1-      gaaggtattctcatgaagaaacttctgcgaaagcgaattgccccagatgt
Q95KR3_MCL1-01          --------------------------------------------------
A0A8D1FTD4_MCL1-03      gacgggtac-------------------gagccggagcccctcgggaagc
A0A8D1G1G8_MCL1-04      gacgggtac-------------------gagccggagcccctcgggaagc
A0A4X1SEZ6_MCL1-01      gacgggtac-------------------gagccggagcccctcgggaagc
A0A4X1SFB1_MCL1-01      gacgggtac-------------------gagccggagcccctcgggaagc
A0A8D1FTD4_MCL1-01      gacgggtac-------------------gagccggagcccctcgggaagc
A0A8D1G1G8_MCL1-02      gacgggtac-------------------gagccggagcccctcgggaagc
A0A8D1RYD1_MCL1-01      gacgggtac-------------------gagccggagcccctcgggaagc
A0A4X1SEU3_MCL1-02      --------------------------------------------------
A0A4X1SEZ6_MCL1-03      --------------------------------------------------
A0A4X1SFB1_MCL1-02      --------------------------------------------------
A0A8D1FTD4_MCL1-05      --------------------------------------------------
A0A8D1G1G8_MCL1-01      --------------------------------------------------
A0A8D1RYD1_MCL1-03      --------------------------------------------------
A0A4X1SEU3_MCL1-01      nnnnnnnnn-------------------nngccggagcccctggggaagc
A0A8D1G1G8_MCL1-03      --------------------------------------------------
A0A8D1FTD4_MCL1-02      gacgggtac-------------------gagccggagcccctcgggaagc
A0A8D1RYD1_MCL1-02      gacgggtac-------------------gagccggagcccctcgggaagc
A0A4X1SEZ6_MCL1-02      gacgggtac-------------------gagccggagcccctcgggaagc
A0A8D1FTD4_MCL1-04      gacgggtac-------------------gagccggagcccctcgggaagc
A0A8D0QLD9_BCL2-07      gaagatctt-------------------gaagttagtacttttgagaggc
A0A4X1TRR9_BCL2-06      gaagatctt-------------------gaagttagtacttttgagaggc
A0A8D0QLD9_BCL2-05      gaagatctt-------------------gaagttagtacttttgagaggc
A0A4X1TRR9_BCL2-05      gaagatctt-------------------gaagttagtacttttgagaggc
A0A8D0QLD9_BCL2-04      gaagatctt-------------------gaagttagtacttttgagaggc
A0A4X1TRR9_BCL2-07      gaagatctt-------------------gaagttagtactttt-------
A0A8D0QLD9_BCL2-06      gaagatctt-------------------gaagttagtactttt-------
A0A4X1TRR9_BCL2-04      gaagatctt-------------------gaagttagtacttttgagaggc
A0A4X1TRR9_BCL2-02      gaagatctt-------------------gaagttagtacttttgagaggc
A0A8D0QLD9_BCL2-02      gaagatctt-------------------gaagttagtacttttgagaggc
                                                                          

A0A8D1N411_BCL2L10      -----------aaagacatcctcgggaggcctgtgggcg---gaagaagg
A0A8D1ITC0_BCL2L10      -----------aaagacatcctcgggaggcctgtgggcggaagaagaagg
A0A4X1T1Z2_BCL2L10      -----------aaagacatcctcgg-------------------------
A0A8D1QEZ6_BCL2L10      -----------aaagacatcctcgggaggcctgtgggcggaagaagaagg
A0A8D1ALD6_BCL2L1-      tagacaaggagatgcaggtattggtgagtcggatcgcaacttggatggcc
A0A4X1SQU7_BCL2L1-      tagacaaggagatgcaggtattggtgagtcggatcgcaacttggatggcc
A0A8D0XF62_BCL2L1-      tagacaaggagatgcaggtattggtgagtcggatcgcaacttggatggcc
O77737_BCL2L1-01        tagacaaggagatgcaggtattggtgagtcggatcgcaacttggatggcc
A0A8D0J6V8_BCL2L1-      tagacaaggagatgcaggtattggtgagtcggatcgcaacttggatggcc
A0A8D0J6V8_BCL2L1-      tagacaaggagatgcaggtattggtgagtcggatcgcaacttggatggcc
A0A8D0J6V8_BCL2L1-      tagacaaggagatgcaggtattggtgagtcggatcgcaacttggatggcc
A0A8D0J6V8_BCL2L1-      tagacaaggagatgcaggtattggtgagtcggatcgcaacttggatggcc
A0A8D0J6V8_BCL2L1-      tagacaaggagatgcaggtattggtgagtcggatcgcaacttggatggcc
A0A4X1SQU7_BCL2L1-      tagacaaggagatgcaggtattggtgagtcggatcgcaacttggatggcc
A0A4X1SQU7_BCL2L1-      tagacaaggagatgcaggtattggtgagtcggatcgcaacttggatggcc
A0A4X1SQU7_BCL2L1-      tagacaaggagatgcaggtattggtgagtcggatcgcaacttggatggcc
A0A4X1SRM7_BCL2L1-      tagacaaggagatgcaggtattggtgagtcggatcgcaacttggatggcc
A0A8D0XF62_BCL2L1-      tagacaaggagatgcaggtattggtgagtcggatcgcaacttggatggcc
A0A8D1ALD6_BCL2L1-      tagacaaggagatgcaggtattggtgagtcggatcgcaacttggatggcc
A0A4X1SQU7_BCL2L1-      --------------------------------------------------
A0A4X1SF63_BCL2L2-      -----gaggaggaggagcc------gggac--------tggtcgagggtg
A0A4X1SF63_BCL2L2-      -----gaggaggaggagcc------gggac--------tggtcgagggtg
A0A8D0TJQ9_BCL2L2-      -----gaggaggaggagcc------gggac--------tggtcgagggtg
A0A482LX62_BCL2L2-      tcaataaggagatggagccactcgtgggacaagtgcaggagtggatggtg
A0A3Q9B4M8_BCL2L2-      tcaataaggagatggagccactcgtgggacaagtgccggagtggatggtg
A0A7T8CLX7_BCL2L2-      tcaataaggagatggagccactcgtgggacaagtgccggagtggatggtg
A0A8D0TJQ9_BCL2L2-      tcaataaggagatggagccactcgtgggacaagtgcaggagtggatggtg
A0A4X1SF60_BCL2L2-      tcaataaggagatggagccactcgtgggacaagtgcaggagtggatggtg
A0A4X1SF63_BCL2L2-      tcaataaggagatggagccactcgtgggacaagtgcaggagtggatggtg
A0A8D0TJQ9_BCL2L2-      tcaataaggagatggagccactcgtgggacaagtgcaggagtggatggtg
A0A4X1SF63_BCL2L2-      tcaataaggagatggagccactcgtgggacaagtgcaggagtggatggtg
A0A4D6NWN1_BCL2L2-      tcaataaggagatggagccactcgtgggacaagtgcaggagtggatggtg
A0A4X1SF60_BCL2L2-      tcaataaggagatggagccactcgtgggacaagtgcaggagtggatggtg
A0A4X1SF63_BCL2L2-      tcaataaggagatggagccactcgtgggacaagtgcaggagtggatggtg
A0A8D0TJQ9_BCL2L2-      tcaataaggagatggagccactcgtgggacaagtgcaggagtggatggtg
A0A4X1SF60_BCL2L2-      tcaataaggagatggagccactcgtgggacaagtgcaggagtggatggtg
A0A8D0TJQ9_BCL2L2-      tcaataaggagatggagccactcgtgggacaagtgcaggagtggatggtg
A0A8D0QLD9_BCL2-03      acctgtggtccacctgaccctgcgccaggccggcgatgacttctctcgtc
A0A4X1TRR9_BCL2-01      acctgtggtccacctgaccctgcgccaggccggcgatgacttctctcgtc
A0A8D0QLD9_BCL2-01      acctgtggtccacctgaccctgcgccaggccggcgatgacttctctcgtc
A0A4X1TRR9_BCL2-03      acctgtggtccacctgaccctgcgccaggccggcgatgacttctctcgtc
A0A8D1BRF8_BCL2A1-      --------------------------------------------------
A0A8D0Z1Y4_BCL2A1-      --------------------------------------------------
A0A8D1SK15_BCL2A1-      --------------------------------------------------
A0A4X1UP21_BCL2A1-      --------------------------------------------------
A0A8D1BRF8_BCL2A1-      --------------------------------------------------
A0A8D1YBS8_BCL2A1-      --------------------------------------------------
A0A4X1UP21_BCL2A1-      ggacacgtacaaggagatttcttactttgtcgccgagttcatcaccaaaa
A0A4X1UQW5_BCL2A1-      ggacacgtacaaggagatttcttactttgtcgccgagttcatcaccaaaa
A0A8D0Z1Y4_BCL2A1-      ggacacgtacaaggagatttcttactttgtcgccgagttcatcaccaaaa
A0A8D1BRF8_BCL2A1-      ggacacgtacaaggagatttcttactttgtcgccgagttcatcaccaaaa
A0A8D1SK15_BCL2A1-      ggacacgtacaaggagatttcttactttgtcgccgagttcatcaccaaaa
A0A8D1YBS8_BCL2A1-      ggacacgtacaaggagatttcttactttgtcgccgagttcatcaccaaaa
C7F841_BCL2A1-01        ggacacgtacaaggagatttcttactttgtcgccgagttcatcaccaaaa
A0A8D1KPD1_BCL2A1-      ggacacgtacaaggagatttcttactttgtcgccgagttcatcaccaaaa
A0A8D1BRF8_BCL2A1-      ggacacgtacaaggagatttcttactttgtcgccgagttcatcaccaaaa
A0A4X1UP21_BCL2A1-      ggacacgtacaaggagatttcttactttgtcgccgagttcatcaccaaaa
A0A8D1SK15_BCL2A1-      ggacacgtacaaggagatttcttactttgtcgccgagttcatcaccaaaa
A0A8D0Z1Y4_BCL2A1-      ggacacgtacaaggagatttcttactttgtcgccgagttcatcaccaaaa
A0A8D1YBS8_BCL2A1-      ggacacgtacaaggagatttcttactttgtcgccgagttcatcaccaaaa
Q95KR3_MCL1-01          --------------------------------------------------
A0A8D1FTD4_MCL1-03      ggccggccgtc--ctgcccttgctggggttagtcgaggaggccagtagtg
A0A8D1G1G8_MCL1-04      ggccggccgtc--ctgcccttgctggggttagtcgaggaggccagtagtg
A0A4X1SEZ6_MCL1-01      ggccggccgtc--ctgcccttgctggggttagtcgaggaggccagtagtg
A0A4X1SFB1_MCL1-01      ggccggccgtc--ctgcccttgctggggttagtcgaggaggccagtagtg
A0A8D1FTD4_MCL1-01      ggccggccgtc--ctgcccttgctggggttagtcgaggaggccagtagtg
A0A8D1G1G8_MCL1-02      ggccggccgtc--ctgcccttgctggggttagtcgaggaggccagtagtg
A0A8D1RYD1_MCL1-01      ggccggccgtc--ctgcccttgctggggttagtcgaggaggccagtagtg
A0A4X1SEU3_MCL1-02      --------------------------------------------------
A0A4X1SEZ6_MCL1-03      --------------------------------------------------
A0A4X1SFB1_MCL1-02      --------------------------------------------------
A0A8D1FTD4_MCL1-05      --------------------------------------------------
A0A8D1G1G8_MCL1-01      --------------------------------------------------
A0A8D1RYD1_MCL1-03      --------------------------------------------------
A0A4X1SEU3_MCL1-01      ggccggccgtc--ctgcccttgctggggttagtcgaggaggccagtagtg
A0A8D1G1G8_MCL1-03      --------------------------------------------------
A0A8D1FTD4_MCL1-02      ggccggccgtc--ctgcccttgctggggttagtcgaggaggccagtagtg
A0A8D1RYD1_MCL1-02      ggccggccgtc--ctgcccttgctggggttagtcgaggaggccagtagtg
A0A4X1SEZ6_MCL1-02      ggccggccgtc--ctgcccttgctggggttagtcgaggaggccagtagtg
A0A8D1FTD4_MCL1-04      ggccggccgtc--ctgcccttgctggggttagtcgaggaggccagtagtg
A0A8D0QLD9_BCL2-07      tcatgagtgtcaactacctgggcagcgtgtacccgagccgagcggtgatc
A0A4X1TRR9_BCL2-06      tcatgagtgtcaactacctgggcagcgtgtacccgagccgagcggtgatc
A0A8D0QLD9_BCL2-05      tcatgagtgtcaactacctgggcagcgtgtacccgagccgagcggtgatc
A0A4X1TRR9_BCL2-05      tcatgagtgtcaactacctgggcagcgtgtacccgagccgagcggtgatc
A0A8D0QLD9_BCL2-04      tcatgagtgtcaactacctgggcagcgtgtacccgagccgagcggtgatc
A0A4X1TRR9_BCL2-07      --------------------------------------------------
A0A8D0QLD9_BCL2-06      --------------------------------------------------
A0A4X1TRR9_BCL2-04      tcatgagtgtcaactacctgggcagcgtgtacccgagccgagcggtgatc
A0A4X1TRR9_BCL2-02      tcatgagtgtcaactacctgggcagcgtgtacccgagccgagcggtgatc
A0A8D0QLD9_BCL2-02      tcatgagtgtcaactacctgggcagcgtgtacccgagccgagcggtgatc
                                                                          

A0A8D1N411_BCL2L10      agggc---------------------------------------------
A0A8D1ITC0_BCL2L10      agggc---------------------------------------------
A0A4X1T1Z2_BCL2L10      --------------------------------------------------
A0A8D1QEZ6_BCL2L10      agggc---------------------------------------------
A0A8D1ALD6_BCL2L1-      actta---------------------------------------------
A0A4X1SQU7_BCL2L1-      actta---------------------------------------------
A0A8D0XF62_BCL2L1-      actta---------------------------------------------
O77737_BCL2L1-01        actta---------------------------------------------
A0A8D0J6V8_BCL2L1-      actta---------------------------------------------
A0A8D0J6V8_BCL2L1-      actta---------------------------------------------
A0A8D0J6V8_BCL2L1-      actta---------------------------------------------
A0A8D0J6V8_BCL2L1-      actta---------------------------------------------
A0A8D0J6V8_BCL2L1-      actta---------------------------------------------
A0A4X1SQU7_BCL2L1-      actta---------------------------------------------
A0A4X1SQU7_BCL2L1-      actta---------------------------------------------
A0A4X1SQU7_BCL2L1-      actta---------------------------------------------
A0A4X1SRM7_BCL2L1-      actta---------------------------------------------
A0A8D0XF62_BCL2L1-      actta---------------------------------------------
A0A8D1ALD6_BCL2L1-      actta---------------------------------------------
A0A4X1SQU7_BCL2L1-      --------------------------------------------------
A0A4X1SF63_BCL2L2-      ac------------------------------------------------
A0A4X1SF63_BCL2L2-      ac------------------------------------------------
A0A8D0TJQ9_BCL2L2-      ac------------------------------------------------
A0A482LX62_BCL2L2-      accta---------------------------------------------
A0A3Q9B4M8_BCL2L2-      accta---------------------------------------------
A0A7T8CLX7_BCL2L2-      accta---------------------------------------------
A0A8D0TJQ9_BCL2L2-      accta---------------------------------------------
A0A4X1SF60_BCL2L2-      accta---------------------------------------------
A0A4X1SF63_BCL2L2-      accta---------------------------------------------
A0A8D0TJQ9_BCL2L2-      accta---------------------------------------------
A0A4X1SF63_BCL2L2-      accta---------------------------------------------
A0A4D6NWN1_BCL2L2-      accta---------------------------------------------
A0A4X1SF60_BCL2L2-      accta---------------------------------------------
A0A4X1SF63_BCL2L2-      accta---------------------------------------------
A0A8D0TJQ9_BCL2L2-      accta---------------------------------------------
A0A4X1SF60_BCL2L2-      accta---------------------------------------------
A0A8D0TJQ9_BCL2L2-      accta---------------------------------------------
A0A8D0QLD9_BCL2-03      gctac---------------------------------------------
A0A4X1TRR9_BCL2-01      gctac---------------------------------------------
A0A8D0QLD9_BCL2-01      gctac---------------------------------------------
A0A4X1TRR9_BCL2-03      gctac---------------------------------------------
A0A8D1BRF8_BCL2A1-      --------------------------------------------------
A0A8D0Z1Y4_BCL2A1-      --------------------------------------------------
A0A8D1SK15_BCL2A1-      --------------------------------------------------
A0A4X1UP21_BCL2A1-      --------------------------------------------------
A0A8D1BRF8_BCL2A1-      --------------------------------------------------
A0A8D1YBS8_BCL2A1-      --------------------------------------------------
A0A4X1UP21_BCL2A1-      acaca-----------------------------------ggacagtgga
A0A4X1UQW5_BCL2A1-      acaca-----------------------------------ggacagtgga
A0A8D0Z1Y4_BCL2A1-      acaca-----------------------------------ggacagtgga
A0A8D1BRF8_BCL2A1-      acaca-----------------------------------ggacagtgga
A0A8D1SK15_BCL2A1-      acaca-----------------------------------ggacagtgga
A0A8D1YBS8_BCL2A1-      acaca-----------------------------------ggacagtgga
C7F841_BCL2A1-01        acaca-----------------------------------ggacagtgga
A0A8D1KPD1_BCL2A1-      acaca-----------------------------------ggagagtgga
A0A8D1BRF8_BCL2A1-      acaca-----------------------------------ggacagtgga
A0A4X1UP21_BCL2A1-      acaca-----------------------------------ggacagtgga
A0A8D1SK15_BCL2A1-      acaca-----------------------------------ggacagtgga
A0A8D0Z1Y4_BCL2A1-      acaca-----------------------------------ggacagtgga
A0A8D1YBS8_BCL2A1-      acaca-----------------------------------ggacagtgga
Q95KR3_MCL1-01          --------------------------------------------------
A0A8D1FTD4_MCL1-03      gccccggcacggacggctcgctcccctcgacgccgcccccggcagaggag
A0A8D1G1G8_MCL1-04      gccccggcacggacggctcgctcccctcgacgccgcccccggcagaggag
A0A4X1SEZ6_MCL1-01      gccccggcacggacggctcgctcccctcgacgccgcccccggcagaggag
A0A4X1SFB1_MCL1-01      gccccggcacggacggctcgctcccctcgacgccgcccccggcagaggag
A0A8D1FTD4_MCL1-01      gccccggcacggacggctcgctcccctcgacgccgcccccggcagaggag
A0A8D1G1G8_MCL1-02      gccccggcacggacggctcgctcccctcgacgccgcccccggcagaggag
A0A8D1RYD1_MCL1-01      gccccggcacggacggctcgctcccctcgacgccgcccccggcagaggag
A0A4X1SEU3_MCL1-02      --------------------------------------------------
A0A4X1SEZ6_MCL1-03      --------------------------------------------------
A0A4X1SFB1_MCL1-02      --------------------------------------------------
A0A8D1FTD4_MCL1-05      --------------------------------------------------
A0A8D1G1G8_MCL1-01      --------------------------------------------------
A0A8D1RYD1_MCL1-03      --------------------------------------------------
A0A4X1SEU3_MCL1-01      gccccggcacggacggctcgctcccctcgacgccgcccccggcagaggag
A0A8D1G1G8_MCL1-03      --------------------------------------------------
A0A8D1FTD4_MCL1-02      gccccggcacggacggctcgctcccctcgacgccgcccccggcagaggag
A0A8D1RYD1_MCL1-02      gccccggcacggacggctcgctcccctcgacgccgcccccggcagaggag
A0A4X1SEZ6_MCL1-02      gccccggcacggacggctcgctcccctcgacgccgcccccggcagaggag
A0A8D1FTD4_MCL1-04      gccccggcacggacggctcgctcccctcgacgccgcccccggcagaggag
A0A8D0QLD9_BCL2-07      accac---------------------------------------------
A0A4X1TRR9_BCL2-06      accac---------------------------------------------
A0A8D0QLD9_BCL2-05      accac---------------------------------------------
A0A4X1TRR9_BCL2-05      accac---------------------------------------------
A0A8D0QLD9_BCL2-04      accac---------------------------------------------
A0A4X1TRR9_BCL2-07      --------------------------------------------------
A0A8D0QLD9_BCL2-06      --------------------------------------------------
A0A4X1TRR9_BCL2-04      accac---------------------------------------------
A0A4X1TRR9_BCL2-02      accac---------------------------------------------
A0A8D0QLD9_BCL2-02      accac---------------------------------------------
                                                                          

A0A8D1N411_BCL2L10      -------------------------------------------aacgtta
A0A8D1ITC0_BCL2L10      -------------------------------------------aacgtta
A0A4X1T1Z2_BCL2L10      -------------------------------------------------a
A0A8D1QEZ6_BCL2L10      -------------------------------------------aacgtta
A0A8D1ALD6_BCL2L1-      -----------------------------------------------cct
A0A4X1SQU7_BCL2L1-      -----------------------------------------------cct
A0A8D0XF62_BCL2L1-      -----------------------------------------------cct
O77737_BCL2L1-01        -----------------------------------------------cct
A0A8D0J6V8_BCL2L1-      -----------------------------------------------cct
A0A8D0J6V8_BCL2L1-      -----------------------------------------------cct
A0A8D0J6V8_BCL2L1-      -----------------------------------------------cct
A0A8D0J6V8_BCL2L1-      -----------------------------------------------cct
A0A8D0J6V8_BCL2L1-      -----------------------------------------------cct
A0A4X1SQU7_BCL2L1-      -----------------------------------------------cct
A0A4X1SQU7_BCL2L1-      -----------------------------------------------cct
A0A4X1SQU7_BCL2L1-      -----------------------------------------------cct
A0A4X1SRM7_BCL2L1-      -----------------------------------------------cct
A0A8D0XF62_BCL2L1-      -----------------------------------------------cct
A0A8D1ALD6_BCL2L1-      -----------------------------------------------cct
A0A4X1SQU7_BCL2L1-      --------------------------------------------------
A0A4X1SF63_BCL2L2-      -----------------------------------------------ccg
A0A4X1SF63_BCL2L2-      -----------------------------------------------ccg
A0A8D0TJQ9_BCL2L2-      -----------------------------------------------ccg
A0A482LX62_BCL2L2-      -----------------------------------------------cct
A0A3Q9B4M8_BCL2L2-      -----------------------------------------------cct
A0A7T8CLX7_BCL2L2-      -----------------------------------------------cct
A0A8D0TJQ9_BCL2L2-      -----------------------------------------------cct
A0A4X1SF60_BCL2L2-      -----------------------------------------------cct
A0A4X1SF63_BCL2L2-      -----------------------------------------------cct
A0A8D0TJQ9_BCL2L2-      -----------------------------------------------cct
A0A4X1SF63_BCL2L2-      -----------------------------------------------cct
A0A4D6NWN1_BCL2L2-      -----------------------------------------------cct
A0A4X1SF60_BCL2L2-      -----------------------------------------------cct
A0A4X1SF63_BCL2L2-      -----------------------------------------------cct
A0A8D0TJQ9_BCL2L2-      -----------------------------------------------cct
A0A4X1SF60_BCL2L2-      -----------------------------------------------cct
A0A8D0TJQ9_BCL2L2-      -----------------------------------------------cct
A0A8D0QLD9_BCL2-03      --------------------------------------cgccgcgacttt
A0A4X1TRR9_BCL2-01      --------------------------------------cgccgcgacttt
A0A8D0QLD9_BCL2-01      --------------------------------------cgccgcgacttt
A0A4X1TRR9_BCL2-03      --------------------------------------cgccgcgacttt
A0A8D1BRF8_BCL2A1-      ------------------aggtgattgcccacagtcagtatctaaagtcc
A0A8D0Z1Y4_BCL2A1-      ------------------aggtgattgcccacagtcagtatctaaaatcc
A0A8D1SK15_BCL2A1-      ------------------aggtgattgcccacagtcagtatctaaaatcc
A0A4X1UP21_BCL2A1-      ------------------aggtgattgcccacagtcagtatctaaaatcc
A0A8D1BRF8_BCL2A1-      ------------------aggtgattgcccacagtcagtatctaaagtcc
A0A8D1YBS8_BCL2A1-      ------------------aggtgattgcccacagtcagtatctaaagtcc
A0A4X1UP21_BCL2A1-      taaggcaaaacggaggctggg----------------------aaaat--
A0A4X1UQW5_BCL2A1-      taaggcaaaacggaggctggg----------------------aaaat--
A0A8D0Z1Y4_BCL2A1-      taaggcaaaacggaggctggg----------------------aaaat--
A0A8D1BRF8_BCL2A1-      taaggcaaaacggaggctggg----------------------aaaat--
A0A8D1SK15_BCL2A1-      taaggcaaaacggaggctggg----------------------aaaat--
A0A8D1YBS8_BCL2A1-      taaggcaaaacggaggctggg----------------------aaaat--
C7F841_BCL2A1-01        taaggcaaaacggaggctggg----------------------aaaat--
A0A8D1KPD1_BCL2A1-      taaggcaaaacggaggctggg----------------------aaaat--
A0A8D1BRF8_BCL2A1-      taaggcaaaacggaggctgggtgattgcccacagtcagtatctaaagtcc
A0A4X1UP21_BCL2A1-      taaggcaaaacggaggctgggtgattgcccacagtcagtatctaaaatcc
A0A8D1SK15_BCL2A1-      taaggcaaaacggaggctgggtgattgcccacagtcagtatctaaaatcc
A0A8D0Z1Y4_BCL2A1-      taaggcaaaacggaggctgggtgattgcccacagtcagtatctaaaatcc
A0A8D1YBS8_BCL2A1-      taaggcaaaacggaggctgggtgattgcccacagtcagtatctaaagtcc
Q95KR3_MCL1-01          --------------------------------------------------
A0A8D1FTD4_MCL1-03      gaggaggacgagttataccggcagtccctggagattatctctcggtacct
A0A8D1G1G8_MCL1-04      gaggaggacgagttataccggcagtccctggagattatctctcggtacct
A0A4X1SEZ6_MCL1-01      gaggaggacgagttataccggcagtccctggagattatctctcggtacct
A0A4X1SFB1_MCL1-01      gaggaggacgagttataccggcagtccctggagattatctctcggtacct
A0A8D1FTD4_MCL1-01      gaggaggacgagttataccggcagtccctggagattatctctcggtacct
A0A8D1G1G8_MCL1-02      gaggaggacgagttataccggcagtccctggagattatctctcggtacct
A0A8D1RYD1_MCL1-01      gaggaggacgagttataccggcagtccctggagattatctctcggtacct
A0A4X1SEU3_MCL1-02      --------------------------------------------------
A0A4X1SEZ6_MCL1-03      --------------------------------------------------
A0A4X1SFB1_MCL1-02      --------------------------------------------------
A0A8D1FTD4_MCL1-05      --------------------------------------------------
A0A8D1G1G8_MCL1-01      --------------------------------------------------
A0A8D1RYD1_MCL1-03      --------------------------------------------------
A0A4X1SEU3_MCL1-01      gaggaggacgagttataccggcagtccctggagattatctctcggtacct
A0A8D1G1G8_MCL1-03      --------------------------------------------------
A0A8D1FTD4_MCL1-02      gaggaggacgagttataccggcagtccctggagattatctctcggtacct
A0A8D1RYD1_MCL1-02      gaggaggacgagttataccggcagtccctggagattatctctcggtacct
A0A4X1SEZ6_MCL1-02      gaggaggacgagttataccggcagtccctggagattatctctcggtacct
A0A8D1FTD4_MCL1-04      gaggaggacgagttataccggcagtccctggagattatctctcggtacct
A0A8D0QLD9_BCL2-07      catgaaggagcgccgcgtgggcag--------gatcgtcttcgtgtcctc
A0A4X1TRR9_BCL2-06      catgaaggagcgccgcgtgggcag--------gatcgtcttcgtgtcctc
A0A8D0QLD9_BCL2-05      catgaaggagcgccgcgtgggcag--------gatcgtcttcgtgtcctc
A0A4X1TRR9_BCL2-05      catgaaggagcgccgcgtgggcag--------gatcgtcttcgtgtcctc
A0A8D0QLD9_BCL2-04      catgaaggagcgccgcgtgggcag--------gatcgtcttcgtgtcctc
A0A4X1TRR9_BCL2-07      --------------------------------------------------
A0A8D0QLD9_BCL2-06      --------------------------------------------------
A0A4X1TRR9_BCL2-04      catgaaggagcgccgcgtgggcag--------gatcgtcttcgtgtcctc
A0A4X1TRR9_BCL2-02      catgaaggagcgccgcgtgggcag--------gatcgtcttcgtgtcctc
A0A8D0QLD9_BCL2-02      catgaaggagcgccgcgtgggcag--------gatcgtcttcgtgtcctc
                                                                          

A0A8D1N411_BCL2L10      gcagggactgccgactcctg-----------------gtggctttgctgt
A0A8D1ITC0_BCL2L10      gcagggactgccgactcctg-----------------gtggctttgctgt
A0A4X1T1Z2_BCL2L10      gcagggactgccgactcctg-----------------gtggctttgctgt
A0A8D1QEZ6_BCL2L10      gcagggactgccgactcctg-----------------gtggctttgctgt
A0A8D1ALD6_BCL2L1-      gaatgaccacctag------------------------------------
A0A4X1SQU7_BCL2L1-      gaatgaccacctag------------------------------------
A0A8D0XF62_BCL2L1-      gaatgaccacctag------------------------------------
O77737_BCL2L1-01        gaatgaccacctag------------------------------------
A0A8D0J6V8_BCL2L1-      gaatgaccacctag------------------------------------
A0A8D0J6V8_BCL2L1-      gaatgaccacctag------------------------------------
A0A8D0J6V8_BCL2L1-      gaatgaccacctag------------------------------------
A0A8D0J6V8_BCL2L1-      gaatgaccacctag------------------------------------
A0A8D0J6V8_BCL2L1-      gaatgaccacctag------------------------------------
A0A4X1SQU7_BCL2L1-      gaatgaccacctag------------------------------------
A0A4X1SQU7_BCL2L1-      gaatgaccacctag------------------------------------
A0A4X1SQU7_BCL2L1-      gaatgaccacctag------------------------------------
A0A4X1SRM7_BCL2L1-      gaatgaccacctag------------------------------------
A0A8D0XF62_BCL2L1-      gaatgaccacctag------------------------------------
A0A8D1ALD6_BCL2L1-      gaatgaccacctag------------------------------------
A0A4X1SQU7_BCL2L1-      --------------------------------------------------
A0A4X1SF63_BCL2L2-      ggggacggcgc-------------------cattg--aggacccggagct
A0A4X1SF63_BCL2L2-      ggggacggcgc-------------------cattg--aggacccggagct
A0A8D0TJQ9_BCL2L2-      ggggacggcgc-------------------cattg--aggacccggagct
A0A482LX62_BCL2L2-      ggagacacggctggccgactggatccacagcagcgcttcacccaggtctc
A0A3Q9B4M8_BCL2L2-      ggagacacggctggccgactggatccacagcagtg--ggggctgggcg--
A0A7T8CLX7_BCL2L2-      ggagacacggctggccgactggatccacagcagtg--ggggctgggcg--
A0A8D0TJQ9_BCL2L2-      ggagacacggctggccgactggatccacagcagtg--ggggctgggcg--
A0A4X1SF60_BCL2L2-      ggagacacggctggccgactggatccacagcagtg--ggggctgggcg--
A0A4X1SF63_BCL2L2-      ggagacacggctggccgactggatccacagcagtg--ggggctgggcg--
A0A8D0TJQ9_BCL2L2-      ggagacacggctggccgactggatccacagcagtg--ggggctgggtac-
A0A4X1SF63_BCL2L2-      ggagacacggctggccgactggatccacagcagtg--ggggctgggagct
A0A4D6NWN1_BCL2L2-      ggagtcacggctggccgactggatccacagcagtg--ggggctgggagct
A0A4X1SF60_BCL2L2-      ggagacacggctggccgactggatccacagcagtg--ggggctgggagct
A0A4X1SF63_BCL2L2-      ggagacacggctggccgactggatccacagcagtg--ggggctgggagct
A0A8D0TJQ9_BCL2L2-      ggagacacggctggccgactggatccacagcagtg--ggggctgggagct
A0A4X1SF60_BCL2L2-      ggagacacggctggccgactggatccacagcagtg--ggggctgggagct
A0A8D0TJQ9_BCL2L2-      ggagacacggctggccgactggatccacagcagtg--ggggctgggagct
A0A8D0QLD9_BCL2-03      gccgagatgtccagcca---------------------------------
A0A4X1TRR9_BCL2-01      gccgagatgtccagcca---------------------------------
A0A8D0QLD9_BCL2-01      gccgagatgtccagcca---------------------------------
A0A4X1TRR9_BCL2-03      gccgagatgtccagcca---------------------------------
A0A8D1BRF8_BCL2A1-      aaaagaatttccatctttctgagcatgccag------atgaaatcgagac
A0A8D0Z1Y4_BCL2A1-      aaaagaatttccatctttctgagcatgccag------atgaaatcgagac
A0A8D1SK15_BCL2A1-      aaaagaatttccatctttctgagcatgccag------atgaaatcgagac
A0A4X1UP21_BCL2A1-      aaaagaatttccatctttctgagcatgccag------atgaaatcgagac
A0A8D1BRF8_BCL2A1-      aaaagaatttccatctttctgagcatgccag------atgaaatcgagac
A0A8D1YBS8_BCL2A1-      aaaagaatttccatctttctgagcatgccag------atgaaatcgagac
A0A4X1UP21_BCL2A1-      --------------------------------------------------
A0A4X1UQW5_BCL2A1-      --------------------------------------------------
A0A8D0Z1Y4_BCL2A1-      --------------------------------------------------
A0A8D1BRF8_BCL2A1-      --------------------------------------------------
A0A8D1SK15_BCL2A1-      --------------------------------------------------
A0A8D1YBS8_BCL2A1-      --------------------------------------------------
C7F841_BCL2A1-01        --------------------------------------------------
A0A8D1KPD1_BCL2A1-      --------------------------------------------------
A0A8D1BRF8_BCL2A1-      aaaagaatttccatctttctgagcatgccag------atgaaatcgagac
A0A4X1UP21_BCL2A1-      aaaagaatttccatctttctgagcatgccag------atgaaatcgagac
A0A8D1SK15_BCL2A1-      aaaagaatttccatctttctgagcatgccag------atgaaatcgagac
A0A8D0Z1Y4_BCL2A1-      aaaagaatttccatctttctgagcatgccag------atgaaatcgagac
A0A8D1YBS8_BCL2A1-      aaaagaatttccatctttctgagcatgccag------atgaaatcgagac
Q95KR3_MCL1-01          --------------------------------------------------
A0A8D1FTD4_MCL1-03      tcgggagcaggcaaccg-------gcgcca--------aggacgcgaagc
A0A8D1G1G8_MCL1-04      tcgggagcaggcaaccg-------gcgcca--------aggacgcgaagc
A0A4X1SEZ6_MCL1-01      tcgggagcaggcaaccg-------gcgcca--------aggacgcgaagc
A0A4X1SFB1_MCL1-01      tcgggagcaggcaaccg-------gcgcca--------aggacgcgaagc
A0A8D1FTD4_MCL1-01      tcgggagcaggcaaccg-------gcgcca--------aggacgcgaagc
A0A8D1G1G8_MCL1-02      tcgggagcaggcaaccg-------gcgcca--------aggacgcgaagc
A0A8D1RYD1_MCL1-01      tcgggagcaggcaaccg-------gcgcca--------aggacgcgaagc
A0A4X1SEU3_MCL1-02      ---------ggcaaccg-------gcgcca--------aggacgcgaagc
A0A4X1SEZ6_MCL1-03      ---------ggcaaccg-------gcgcca--------aggacgcgaagc
A0A4X1SFB1_MCL1-02      ---------ggcaaccg-------gcgcca--------aggacgcgaagc
A0A8D1FTD4_MCL1-05      ---------ggcaaccg-------gcgcca--------aggacgcgaagc
A0A8D1G1G8_MCL1-01      ---------ggcaaccg-------gcgcca--------aggacgcgaagc
A0A8D1RYD1_MCL1-03      ---------ggcaaccg-------gcgcca--------aggacgcgaagc
A0A4X1SEU3_MCL1-01      tcgggagcaggcaaccg-------gcgcca--------aggacgcgaagc
A0A8D1G1G8_MCL1-03      --------------------------------------------------
A0A8D1FTD4_MCL1-02      tcgggagcaggcaaccg-------gcgcca--------aggacgcgaagc
A0A8D1RYD1_MCL1-02      tcgggagcaggcaaccg-------gcgcca--------aggacgcgaagc
A0A4X1SEZ6_MCL1-02      tcgggagcaggcaaccg-------gcgcca--------aggacgcgaagc
A0A8D1FTD4_MCL1-04      tcgggagcaggcaaccg-------gcgcca--------aggacgcgaagc
A0A8D0QLD9_BCL2-07      tcaggc-cgggcagctg-------ggcctgt------tcggcttcacagc
A0A4X1TRR9_BCL2-06      tcaggc-cgggcagctg-------ggcctgt------ttggcttcacagc
A0A8D0QLD9_BCL2-05      tcaggc-cgggcagctg-------ggcctgt------tcggcttcacagc
A0A4X1TRR9_BCL2-05      tcaggc-cgggcagctg-------ggcctgt------ttggcttcacagc
A0A8D0QLD9_BCL2-04      tcaggc-cgggcagctg-------ggcctgt------tcggcttcacagc
A0A4X1TRR9_BCL2-07      --------------------------------------------------
A0A8D0QLD9_BCL2-06      --------------------------------------------------
A0A4X1TRR9_BCL2-04      tcaggc-cgggcagctg-------ggcctgt------ttggcttcacagc
A0A4X1TRR9_BCL2-02      tcaggc-cgggcagctg-------ggcctgt------ttggcttcacagc
A0A8D0QLD9_BCL2-02      tcaggc-cgggcagctg-------ggcctgt------tcggcttcacagc
                                                                          

A0A8D1N411_BCL2L10      gcgctcagctctcagggcagcatcgcacctggctattgg-----------
A0A8D1ITC0_BCL2L10      gcgctcagctctcagggcagcatcgcacctggctattgg-----------
A0A4X1T1Z2_BCL2L10      gcgctcagctctcagggcagcatcgcacctggctattgg-----------
A0A8D1QEZ6_BCL2L10      gcgctcagctctcagggcagcatcgcacctggctattgg-----------
A0A8D1ALD6_BCL2L1-      -----------------agccttggatccagg------------------
A0A4X1SQU7_BCL2L1-      -----------------agccttggatccagg------------------
A0A8D0XF62_BCL2L1-      -----------------agccttggatccagg------------------
O77737_BCL2L1-01        -----------------agccttggatccagg------------------
A0A8D0J6V8_BCL2L1-      -----------------agccttggatccagg------------------
A0A8D0J6V8_BCL2L1-      -----------------agccttggatccagg------------------
A0A8D0J6V8_BCL2L1-      -----------------agccttggatccagg------------------
A0A8D0J6V8_BCL2L1-      -----------------agccttggatccagg------------------
A0A8D0J6V8_BCL2L1-      -----------------agccttggatccagg------------------
A0A4X1SQU7_BCL2L1-      -----------------agccttggatccagg------------------
A0A4X1SQU7_BCL2L1-      -----------------agccttggatccagg------------------
A0A4X1SQU7_BCL2L1-      -----------------agccttggatccagg------------------
A0A4X1SRM7_BCL2L1-      -----------------agccttggatccagg------------------
A0A8D0XF62_BCL2L1-      -----------------agccttggatccagg------------------
A0A8D1ALD6_BCL2L1-      -----------------agccttggatccagg------------------
A0A4X1SQU7_BCL2L1-      ----------------------------cagg------------------
A0A4X1SF63_BCL2L2-      ggaagcgatc-------aaagctcgagtcagggagatggaggaaga----
A0A4X1SF63_BCL2L2-      ggaagcgatc-------aaagctcgagtcagggagatggaggaaga----
A0A8D0TJQ9_BCL2L2-      ggaagcgatc-------aaagctcgagtcagggagatggaggaaga----
A0A482LX62_BCL2L2-      tgatgaactcttccaaggaggccccaactggggccgccttgtggccttct
A0A3Q9B4M8_BCL2L2-      ----gagttc-------acagctctatacggg------gacggggc----
A0A7T8CLX7_BCL2L2-      ----gagttc-------acagctctatacggg------gacggggc----
A0A8D0TJQ9_BCL2L2-      ----gagttc-------acagctctatacggg------gacggggc----
A0A4X1SF60_BCL2L2-      ----gagttc-------acagctctatacggg------gacggggc----
A0A4X1SF63_BCL2L2-      ----gagttc-------acagctctatacggg------gacggggc----
A0A8D0TJQ9_BCL2L2-      -aaagtgttc-------taaaagtgaaccaag------------------
A0A4X1SF63_BCL2L2-      ggaagcgatc-------aaagctcgagtcagggagatggaggaaga----
A0A4D6NWN1_BCL2L2-      ggaagcgatc-------aaagctcgagtcagggagatggaggaaga----
A0A4X1SF60_BCL2L2-      ggaagcgatc-------aaagctcgagtcagggagatggaggaaga----
A0A4X1SF63_BCL2L2-      ggaagcgatc-------aaagctcgagtcagggagatggaggaaga----
A0A8D0TJQ9_BCL2L2-      ggaagcgatc-------aaagctcgagtcagggagatggaggaaga----
A0A4X1SF60_BCL2L2-      ggaagcgatc-------aaagctcgagtcagggagatggaggaaga----
A0A8D0TJQ9_BCL2L2-      ggaagcgatc-------aaagctcgagtcagggagatggaggaaga----
A0A8D0QLD9_BCL2-03      -----gctgcacctgactcccttcaccgcgaggggacg------------
A0A4X1TRR9_BCL2-01      -----gctgcacctgactcccttcaccgcgaggggacg------------
A0A8D0QLD9_BCL2-01      -----gctgcacctgactcccttcaccgcgaggggacg------------
A0A4X1TRR9_BCL2-03      -----gctgcacctgactcccttcaccgcgaggggacg------------
A0A8D1BRF8_BCL2A1-      ggaagagatcatcagggacattttccaacaaggcaagacctgtttt----
A0A8D0Z1Y4_BCL2A1-      ggaagagatcatcagggacattttccaacaaggcaagacctgtttt----
A0A8D1SK15_BCL2A1-      ggaagagatcatcagggacattttccaacaaggcaagacctgtttt----
A0A4X1UP21_BCL2A1-      ggaagagatcatcagggacattttccaacaaggcaagacctgtttt----
A0A8D1BRF8_BCL2A1-      ggaagagatcatcagggacattttccaacaaggcaagacctgtttt----
A0A8D1YBS8_BCL2A1-      ggaagagatcatcagggacattttccaacaaggcaagacctgtttt----
A0A4X1UP21_BCL2A1-      --------------------------------------------------
A0A4X1UQW5_BCL2A1-      --------------------------------------------------
A0A8D0Z1Y4_BCL2A1-      --------------------------------------------------
A0A8D1BRF8_BCL2A1-      --------------------------------------------------
A0A8D1SK15_BCL2A1-      --------------------------------------------------
A0A8D1YBS8_BCL2A1-      --------------------------------------------------
C7F841_BCL2A1-01        --------------------------------------------------
A0A8D1KPD1_BCL2A1-      --------------------------------------------------
A0A8D1BRF8_BCL2A1-      ggaagagatcatcagggacattttccaacaaggcaagacctgtttt----
A0A4X1UP21_BCL2A1-      ggaagagatcatcagggacattttccaacaaggcaagacctgtttt----
A0A8D1SK15_BCL2A1-      ggaagagatcatcagggacattttccaacaaggcaagacctgtttt----
A0A8D0Z1Y4_BCL2A1-      ggaagagatcatcagggacattttccaacaaggcaagacctgtttt----
A0A8D1YBS8_BCL2A1-      ggaagagatcatcagggacattttccaacaaggcaagacctgtttt----
Q95KR3_MCL1-01          --------------------------------------------------
A0A8D1FTD4_MCL1-03      caatgggcgggtctggg---gccgccagccggaaggcgttagagac----
A0A8D1G1G8_MCL1-04      caatgggcgggtctggg---gccgccagccggaaggcgttagagac----
A0A4X1SEZ6_MCL1-01      caatgggcgggtctggg---gccgccagccggaaggcgttagagac----
A0A4X1SFB1_MCL1-01      caatgggcgggtctggg---gccgccagccggaaggcgttagagac----
A0A8D1FTD4_MCL1-01      caatgggcgggtctggg---gccgccagccggaaggcgttagagac----
A0A8D1G1G8_MCL1-02      caatgggcgggtctggg---gccgccagccggaaggcgttagagac----
A0A8D1RYD1_MCL1-01      caatgggcgggtctggg---gccgccagccggaaggcgttagagac----
A0A4X1SEU3_MCL1-02      caatgggcgggtctggg---gccgccagccggaaggcgttagagac----
A0A4X1SEZ6_MCL1-03      caatgggcgggtctggg---gccgccagccggaaggcgttagagac----
A0A4X1SFB1_MCL1-02      caatgggcgggtctggg---gccgccagccggaaggcgttagagac----
A0A8D1FTD4_MCL1-05      caatgggcgggtctggg---gccgccagccggaaggcgttagagac----
A0A8D1G1G8_MCL1-01      caatgggcgggtctggg---gccgccagccggaaggcgttagagac----
A0A8D1RYD1_MCL1-03      caatgggcgggtctggg---gccgccagccggaaggcgttagagac----
A0A4X1SEU3_MCL1-01      caatgggcgggtctggg---gccgccagccggaaggcgttagagac----
A0A8D1G1G8_MCL1-03      --------------------------------------------------
A0A8D1FTD4_MCL1-02      caatgggcgggtctggg---gccgccagccggaaggcgttagagac----
A0A8D1RYD1_MCL1-02      caatgggcgggtctggg---gccgccagccggaaggcgttagagac----
A0A4X1SEZ6_MCL1-02      caatgggcgggtctggg---gccgccagccggaaggcgttagagac----
A0A8D1FTD4_MCL1-04      caatgggcgggtctggg---gccgccagccggaaggcgttagagac----
A0A8D0QLD9_BCL2-07      ctac-tcttcctcaaag---tttgccatcaggggattggcagaagc----
A0A4X1TRR9_BCL2-06      ctac-tcttcctcgaag---tttgccatcaggggattggcagaagc----
A0A8D0QLD9_BCL2-05      ctac-tcttcctcaaag---tttgccatcaggggattggcagaagc----
A0A4X1TRR9_BCL2-05      ctac-tcttcctcgaag---tttgccatcaggggattggcagaagc----
A0A8D0QLD9_BCL2-04      ctac-tcttcctcaaag---tttgccatcaggggattggcagaagc----
A0A4X1TRR9_BCL2-07      --------------------------------------------------
A0A8D0QLD9_BCL2-06      --------------------------------------------------
A0A4X1TRR9_BCL2-04      ctac-tcttcctcgaag---tttgccatcaggggattggcagaagc----
A0A4X1TRR9_BCL2-02      ctac-tcttcctcgaag---tttgccatcaggggattggcagaagc----
A0A8D0QLD9_BCL2-02      ctac-tcttcctcaaag---tttgccatcaggggattggcagaagc----
                                                                          

A0A8D1N411_BCL2L10      --------------------------------------------------
A0A8D1ITC0_BCL2L10      --------------------------------------------------
A0A4X1T1Z2_BCL2L10      --------------------------------------------------
A0A8D1QEZ6_BCL2L10      --------------------------------------------------
A0A8D1ALD6_BCL2L1-      --------------------------------------------------
A0A4X1SQU7_BCL2L1-      --------------------------------------------------
A0A8D0XF62_BCL2L1-      --------------------------------------------------
O77737_BCL2L1-01        --------------------------------------------------
A0A8D0J6V8_BCL2L1-      --------------------------------------------------
A0A8D0J6V8_BCL2L1-      --------------------------------------------------
A0A8D0J6V8_BCL2L1-      --------------------------------------------------
A0A8D0J6V8_BCL2L1-      --------------------------------------------------
A0A8D0J6V8_BCL2L1-      --------------------------------------------------
A0A4X1SQU7_BCL2L1-      --------------------------------------------------
A0A4X1SQU7_BCL2L1-      --------------------------------------------------
A0A4X1SQU7_BCL2L1-      --------------------------------------------------
A0A4X1SRM7_BCL2L1-      --------------------------------------------------
A0A8D0XF62_BCL2L1-      --------------------------------------------------
A0A8D1ALD6_BCL2L1-      --------------------------------------------------
A0A4X1SQU7_BCL2L1-      --------------------------------------------------
A0A4X1SF63_BCL2L2-      --agctgagaagctaaaggagctacagaacgaagtagagaagcagatgaa
A0A4X1SF63_BCL2L2-      --agctgagaagctaaaggagctacagaacgaagtagagaagcagatgaa
A0A8D0TJQ9_BCL2L2-      --agctgagaagctaaaggagctacagaacgaagtagagaagcagatgaa
A0A482LX62_BCL2L2-      ttgtcttcggagctgcactgtgtgctgagagtg-----------------
A0A3Q9B4M8_BCL2L2-      --cctggaggaggcgcggcgtctgcgggagggga----------------
A0A7T8CLX7_BCL2L2-      --cctggaggaggcgcggcgtctgcgggagggga----------------
A0A8D0TJQ9_BCL2L2-      --cctggaggaggcgcggcgtctgcgggagggga----------------
A0A4X1SF60_BCL2L2-      --cctggaggaggcgcggcgtctgcgggagggga----------------
A0A4X1SF63_BCL2L2-      --cctggaggaggcgcggcgtctgcgggagggga----------------
A0A8D0TJQ9_BCL2L2-      ------------------------cagaatggaa----------------
A0A4X1SF63_BCL2L2-      --agctgagaagctaaaggagctacagaacgaagtagagaagcagatgaa
A0A4D6NWN1_BCL2L2-      --agctgagaagctaaaggagctacagaacgaagtagagaagcagatgaa
A0A4X1SF60_BCL2L2-      --agctgagaagctaaaggagctacagaacgaagtagagaagcagatgaa
A0A4X1SF63_BCL2L2-      --agctgagaagctaaaggagctacagaacgaagtagagaagcagatgaa
A0A8D0TJQ9_BCL2L2-      --agctgagaagctaaaggagctacagaacgaagtagagaagcagatgaa
A0A4X1SF60_BCL2L2-      --agctgagaagctaaaggagctacagaacgaagtagagaagcagatgaa
A0A8D0TJQ9_BCL2L2-      --agctgagaagctaaaggagctacagaacgaagtagagaagcagatgaa
A0A8D0QLD9_BCL2-03      -------ctttgccacggtggtggaggagc--------------------
A0A4X1TRR9_BCL2-01      -------ctttgccacggtggtggaggagc--------------------
A0A8D0QLD9_BCL2-01      -------ctttgccacggtggtggaggagc--------------------
A0A4X1TRR9_BCL2-03      -------ctttgccacggtggtggaggagc--------------------
A0A8D1BRF8_BCL2A1-      ------atcccacggtatcagttccagagcaatcacatggatatggtgaa
A0A8D0Z1Y4_BCL2A1-      ------atcccacggtatcagttccagagcaatcacatggatatggtgaa
A0A8D1SK15_BCL2A1-      ------atcccacggtatcagttccagagcaatcacatggatatggtgaa
A0A4X1UP21_BCL2A1-      ------atcccacggtatcagttccagagcaatcacatggatatggtgaa
A0A8D1BRF8_BCL2A1-      ------atcccacggtatcagttccagagcaatcacatggatatggtgaa
A0A8D1YBS8_BCL2A1-      ------atcccacggtatcagttccagagcaatcacatggatatggtgaa
A0A4X1UP21_BCL2A1-      --------------------------------------------------
A0A4X1UQW5_BCL2A1-      --------------------------------------------------
A0A8D0Z1Y4_BCL2A1-      --------------------------------------------------
A0A8D1BRF8_BCL2A1-      --------------------------------------------------
A0A8D1SK15_BCL2A1-      --------------------------------------------------
A0A8D1YBS8_BCL2A1-      --------------------------------------------------
C7F841_BCL2A1-01        --------------------------------------------------
A0A8D1KPD1_BCL2A1-      --------------------------------------------------
A0A8D1BRF8_BCL2A1-      ------atcccacggtatcagttccagagcaatcacatggatatggtgaa
A0A4X1UP21_BCL2A1-      ------atcccacggtatcagttccagagcaatcacatggatatggtgaa
A0A8D1SK15_BCL2A1-      ------atcccacggtatcagttccagagcaatcacatggatatggtgaa
A0A8D0Z1Y4_BCL2A1-      ------atcccacggtatcagttccagagcaatcacatggatatggtgaa
A0A8D1YBS8_BCL2A1-      ------atcccacggtatcagttccagagcaatcacatggatatggtgaa
Q95KR3_MCL1-01          --------------------------------------------------
A0A8D1FTD4_MCL1-03      ------cctgcgacgggtcggggacggggt--------------------
A0A8D1G1G8_MCL1-04      ------cctgcgacgggtcggggacggggt--------------------
A0A4X1SEZ6_MCL1-01      ------cctgcgacgggtcggggacggggt--------------------
A0A4X1SFB1_MCL1-01      ------cctgcgacgggtcggggacggggt--------------------
A0A8D1FTD4_MCL1-01      ------cctgcgacgggtcggggacggggt--------------------
A0A8D1G1G8_MCL1-02      ------cctgcgacgggtcggggacggggt--------------------
A0A8D1RYD1_MCL1-01      ------cctgcgacgggtcggggacggggt--------------------
A0A4X1SEU3_MCL1-02      ------cctgcgacgggtcggggacggggt--------------------
A0A4X1SEZ6_MCL1-03      ------cctgcgacgggtcggggacggggt--------------------
A0A4X1SFB1_MCL1-02      ------cctgcgacgggtcggggacggggt--------------------
A0A8D1FTD4_MCL1-05      ------cctgcgacgggtcggggacggggt--------------------
A0A8D1G1G8_MCL1-01      ------cctgcgacgggtcggggacggggt--------------------
A0A8D1RYD1_MCL1-03      ------cctgcgacgggtcggggacggggt--------------------
A0A4X1SEU3_MCL1-01      ------cctgcgacgggtcggggacggggt--------------------
A0A8D1G1G8_MCL1-03      --------------------------------------------------
A0A8D1FTD4_MCL1-02      ------cctgcgacgggtcggggacggggt--------------------
A0A8D1RYD1_MCL1-02      ------cctgcgacgggtcggggacggggt--------------------
A0A4X1SEZ6_MCL1-02      ------cctgcgacgggtcggggacggggt--------------------
A0A8D1FTD4_MCL1-04      ------cctgcgacgggtcggggacggggt--------------------
A0A8D0QLD9_BCL2-07      ------tctgc----agatggaggtgaagccatataatgtttatgtcaca
A0A4X1TRR9_BCL2-06      ------tctgc----agatggaggtgaagccatataatgtttatgtcaca
A0A8D0QLD9_BCL2-05      ------tctgc----agatgg-----------------------------
A0A4X1TRR9_BCL2-05      ------tctgc----agatgg-----------------------------
A0A8D0QLD9_BCL2-04      ------tctgc----agatggaggtgaagccatataatgtttatgtcaca
A0A4X1TRR9_BCL2-07      --------------------gaggtgaagccatataatgtttatgtcaca
A0A8D0QLD9_BCL2-06      --------------------gaggtgaagccatataatgtttatgtcaca
A0A4X1TRR9_BCL2-04      ------tctgc----agatggaggtgaagccatataatgtttatgtcaca
A0A4X1TRR9_BCL2-02      ------tctgc----agatggaggtgaagccatataatgtttatgtcaca
A0A8D0QLD9_BCL2-02      ------tctgc----agatggaggtgaagccatataatgtttatgtcaca
                                                                          

A0A8D1N411_BCL2L10      --------------------------------------------------
A0A8D1ITC0_BCL2L10      --------------------------------------------------
A0A4X1T1Z2_BCL2L10      --------------------------------------------------
A0A8D1QEZ6_BCL2L10      --------------------------------------------------
A0A8D1ALD6_BCL2L1-      --------------------------------------------------
A0A4X1SQU7_BCL2L1-      --------------------------------------------------
A0A8D0XF62_BCL2L1-      --------------------------------------------------
O77737_BCL2L1-01        --------------------------------------------------
A0A8D0J6V8_BCL2L1-      --------------------------------------------------
A0A8D0J6V8_BCL2L1-      --------------------------------------------------
A0A8D0J6V8_BCL2L1-      --------------------------------------------------
A0A8D0J6V8_BCL2L1-      --------------------------------------------------
A0A8D0J6V8_BCL2L1-      --------------------------------------------------
A0A4X1SQU7_BCL2L1-      --------------------------------------------------
A0A4X1SQU7_BCL2L1-      --------------------------------------------------
A0A4X1SQU7_BCL2L1-      --------------------------------------------------
A0A4X1SRM7_BCL2L1-      --------------------------------------------------
A0A8D0XF62_BCL2L1-      --------------------------------------------------
A0A8D1ALD6_BCL2L1-      --------------------------------------------------
A0A4X1SQU7_BCL2L1-      --------------------------------------------------
A0A4X1SF63_BCL2L2-      tatgagtccaccaccag---------------gcaatgctggcccagtta
A0A4X1SF63_BCL2L2-      tatgagtccaccaccag---------------gcaatgctggcccagtta
A0A8D0TJQ9_BCL2L2-      tatgagtccaccaccag---------------gcaatgctggcccagtta
A0A482LX62_BCL2L2-      --------------------------------------------------
A0A3Q9B4M8_BCL2L2-      -------------------------------------actgggcc-----
A0A7T8CLX7_BCL2L2-      -------------------------------------actgggcc-----
A0A8D0TJQ9_BCL2L2-      -------------------------------------actgggcc-----
A0A4X1SF60_BCL2L2-      -------------------------------------actgggcc-----
A0A4X1SF63_BCL2L2-      -------------------------------------actgggcc-----
A0A8D0TJQ9_BCL2L2-      --------------------------------------------------
A0A4X1SF63_BCL2L2-      tatgagtccaccaccag---------------gcaatgctggcccagtta
A0A4D6NWN1_BCL2L2-      tatgagtccaccaccag---------------gcaatgctggcccagtta
A0A4X1SF60_BCL2L2-      tatgagtccaccaccag---------------gcaatgctggcccagtta
A0A4X1SF63_BCL2L2-      tatgagtccaccaccag---------------gcaatgctggcccagtta
A0A8D0TJQ9_BCL2L2-      tatgagtccaccaccag---------------gcaatgctggcccagtta
A0A4X1SF60_BCL2L2-      tatgagtccaccaccag---------------gcaatgctggcccagtta
A0A8D0TJQ9_BCL2L2-      tatgagtccaccaccag---------------gcaatgctggcccagtta
A0A8D0QLD9_BCL2-03      ----------------------------------------tcttcaggga
A0A4X1TRR9_BCL2-01      ----------------------------------------tcttcaggga
A0A8D0QLD9_BCL2-01      ----------------------------------------tcttcaggga
A0A4X1TRR9_BCL2-03      ----------------------------------------tcttcaggga
A0A8D1BRF8_BCL2A1-      attagcatcgcccgaggaaatttcttcccttcccaaaacatcctgggata
A0A8D0Z1Y4_BCL2A1-      attagcatcgcccgaggaaatttcttcccttcccaaaacatcctggaata
A0A8D1SK15_BCL2A1-      attagcatcgcccgaggaaatttcttcccttcccaaaacatcctggaata
A0A4X1UP21_BCL2A1-      attagcatcgcccgaggaaatttcttcccttcccaaaacatcctggaata
A0A8D1BRF8_BCL2A1-      attagcatcgcccgaggaaatttcttcccttcccaaaacatcctgggata
A0A8D1YBS8_BCL2A1-      attagcatcgcccgaggaaatttcttcccttcccaaaacatcctggaata
A0A4X1UP21_BCL2A1-      --------------------------------------------------
A0A4X1UQW5_BCL2A1-      --------------------------------------------------
A0A8D0Z1Y4_BCL2A1-      --------------------------------------------------
A0A8D1BRF8_BCL2A1-      --------------------------------------------------
A0A8D1SK15_BCL2A1-      --------------------------------------------------
A0A8D1YBS8_BCL2A1-      --------------------------------------------------
C7F841_BCL2A1-01        --------------------------------------------------
A0A8D1KPD1_BCL2A1-      --------------------------------------------------
A0A8D1BRF8_BCL2A1-      attagcatcgcccgaggaaatttcttcccttcccaaaacatcctgggata
A0A4X1UP21_BCL2A1-      attagcatcgcccgaggaaatttcttcccttcccaaaacatcctggaata
A0A8D1SK15_BCL2A1-      attagcatcgcccgaggaaatttcttcccttcccaaaacatcctggaata
A0A8D0Z1Y4_BCL2A1-      attagcatcgcccgaggaaatttcttcccttcccaaaacatcctggaata
A0A8D1YBS8_BCL2A1-      attagcatcgcccgaggaaatttcttcccttcccaaaacatcctggaata
Q95KR3_MCL1-01          -----------------------------------------tccaaggca
A0A8D1FTD4_MCL1-03      gcagcgcaaccacgaga---------------c---ggccttccaaggca
A0A8D1G1G8_MCL1-04      gcagcgcaaccacgaga---------------c---ggccttccaaggca
A0A4X1SEZ6_MCL1-01      gcagcgcaaccacgaga---------------c---ggccttccaaggca
A0A4X1SFB1_MCL1-01      gcagcgcaaccacgaga---------------c---ggccttccaaggca
A0A8D1FTD4_MCL1-01      gcagcgcaaccacgaga---------------c---ggccttccaaggca
A0A8D1G1G8_MCL1-02      gcagcgcaaccacgaga---------------c---ggccttccaaggca
A0A8D1RYD1_MCL1-01      gcagcgcaaccacgaga---------------c---ggccttccaaggca
A0A4X1SEU3_MCL1-02      gcagcgcaaccacgaga---------------c---ggccttccaaggca
A0A4X1SEZ6_MCL1-03      gcagcgcaaccacgaga---------------c---ggccttccaaggca
A0A4X1SFB1_MCL1-02      gcagcgcaaccacgaga---------------c---ggccttccaaggca
A0A8D1FTD4_MCL1-05      gcagcgcaaccacgaga---------------c---ggccttccaaggca
A0A8D1G1G8_MCL1-01      gcagcgcaaccacgaga---------------c---ggccttccaaggca
A0A8D1RYD1_MCL1-03      gcagcgcaaccacgaga---------------c---ggccttccaaggca
A0A4X1SEU3_MCL1-01      gcagcgcaaccacgaga---------------c---ggccttccaaggca
A0A8D1G1G8_MCL1-03      ---------------------------------------------aggca
A0A8D1FTD4_MCL1-02      gcagcgcaaccacgaga---------------c---ggccttccaaggca
A0A8D1RYD1_MCL1-02      gcagcgcaaccacgaga---------------c---ggccttccaaggca
A0A4X1SEZ6_MCL1-02      gcagcgcaaccacgaga---------------c---ggccttccaaggca
A0A8D1FTD4_MCL1-04      gcagcgcaaccacgaga---------------c---ggccttccaaggca
A0A8D0QLD9_BCL2-07      gtggcctaccctccaga---------------cacagacacccctgggtt
A0A4X1TRR9_BCL2-06      gtggcctaccctccaga---------------cacagacacccctgggtt
A0A8D0QLD9_BCL2-05      --------------------------------------------------
A0A4X1TRR9_BCL2-05      --------------------------------------------------
A0A8D0QLD9_BCL2-04      gtggcctaccctccaga---------------cacagacacccctgggtt
A0A4X1TRR9_BCL2-07      gtggcctaccctccaga---------------cacagacacccctgggtt
A0A8D0QLD9_BCL2-06      gtggcctaccctccaga---------------cacagacacccctgggtt
A0A4X1TRR9_BCL2-04      gtggcctaccctccaga---------------cacagacacccctgggtt
A0A4X1TRR9_BCL2-02      gtggcctaccctccaga---------------cacagacacccctgggtt
A0A8D0QLD9_BCL2-02      gtggcctaccctccaga---------------cacagacacccctgggtt
                                                                          

A0A8D1N411_BCL2L10      --------------------------------------------------
A0A8D1ITC0_BCL2L10      --------------------------------------------------
A0A4X1T1Z2_BCL2L10      --------------------------------------------------
A0A8D1QEZ6_BCL2L10      --------------------------------------------------
A0A8D1ALD6_BCL2L1-      --------------------------------------------------
A0A4X1SQU7_BCL2L1-      --------------------------------------------------
A0A8D0XF62_BCL2L1-      --------------------------------------------------
O77737_BCL2L1-01        --------------------------------------------------
A0A8D0J6V8_BCL2L1-      --------------------------------------------------
A0A8D0J6V8_BCL2L1-      --------------------------------------------------
A0A8D0J6V8_BCL2L1-      --------------------------------------------------
A0A8D0J6V8_BCL2L1-      --------------------------------------------------
A0A8D0J6V8_BCL2L1-      --------------------------------------------------
A0A4X1SQU7_BCL2L1-      --------------------------------------------------
A0A4X1SQU7_BCL2L1-      --------------------------------------------------
A0A4X1SQU7_BCL2L1-      --------------------------------------------------
A0A4X1SRM7_BCL2L1-      --------------------------------------------------
A0A8D0XF62_BCL2L1-      --------------------------------------------------
A0A8D1ALD6_BCL2L1-      --------------------------------------------------
A0A4X1SQU7_BCL2L1-      --------------------------------------------------
A0A4X1SF63_BCL2L2-      tcatgtccattgaggagaagatggaggcagatgcccgatctatctatgtt
A0A4X1SF63_BCL2L2-      tcatgtccattgaggagaagatggaggcagatgcccgatctatctatgtt
A0A8D0TJQ9_BCL2L2-      tcatgtccattgaggagaagatggaggcagatgcccgatctatctatgtt
A0A482LX62_BCL2L2-      ------tcaataaggaga--------------------------------
A0A3Q9B4M8_BCL2L2-      ------tcagtgaggacag------------------------------t
A0A7T8CLX7_BCL2L2-      ------tcagtgaggacag------------------------------t
A0A8D0TJQ9_BCL2L2-      ------tcagtgaggacag------------------------------t
A0A4X1SF60_BCL2L2-      ------tcagtgaggactg------------------------------t
A0A4X1SF63_BCL2L2-      ------tcagtgaggacag------------------------------t
A0A8D0TJQ9_BCL2L2-      --------attaag------------------------------------
A0A4X1SF63_BCL2L2-      tcatgtccattgaggagaagatggaggcagatgcccgatctatctatgtt
A0A4D6NWN1_BCL2L2-      tcatgtccattgaggagaagatggaggcagatgcccgatctatctatgtt
A0A4X1SF60_BCL2L2-      tcatgtccattgaggagaagatggaggcagatgcccgatctatctatgtt
A0A4X1SF63_BCL2L2-      tcatgtccattgaggagaagatggaggcagatgcccgatctatctatgtt
A0A8D0TJQ9_BCL2L2-      tcatgtccattgaggagaagatggaggcagatgcccgatctatctatgtt
A0A4X1SF60_BCL2L2-      tcatgtccattgaggagaagatggaggcagatgcccgatctatctatgtt
A0A8D0TJQ9_BCL2L2-      tcatgtccattgaggagaagatggaggcagatgcccgatctatctatgtt
A0A8D0QLD9_BCL2-03      tggggtgaactggggg----------------------------------
A0A4X1TRR9_BCL2-01      tggggtgaactggggg----------------------------------
A0A8D0QLD9_BCL2-01      tggggtgaactggggg----------------------------------
A0A4X1TRR9_BCL2-03      tggggtgaactggggg----------------------------------
A0A8D1BRF8_BCL2A1-      ttcatcagcccggggagaa-----------------------tgagattc
A0A8D0Z1Y4_BCL2A1-      ttcatcagcccggggagaa-----------------------tgagattc
A0A8D1SK15_BCL2A1-      ttcatcagcccggggagaa-----------------------tgagattc
A0A4X1UP21_BCL2A1-      ttcatcagcccggggagaa-----------------------tgagattc
A0A8D1BRF8_BCL2A1-      ttcatcagcccggggagaa-----------------------tgagattc
A0A8D1YBS8_BCL2A1-      ttcatcagcccggggagaa-----------------------tgagattc
A0A4X1UP21_BCL2A1-      --------------------------------------------------
A0A4X1UQW5_BCL2A1-      --------------------------------------------------
A0A8D0Z1Y4_BCL2A1-      --------------------------------------------------
A0A8D1BRF8_BCL2A1-      --------------------------------------------------
A0A8D1SK15_BCL2A1-      --------------------------------------------------
A0A8D1YBS8_BCL2A1-      --------------------------------------------------
C7F841_BCL2A1-01        --------------------------------------------------
A0A8D1KPD1_BCL2A1-      --------------------------------------------------
A0A8D1BRF8_BCL2A1-      ttcatcagcccggggagaa-----------------------tgagattc
A0A4X1UP21_BCL2A1-      ttcatcagcccggggagaa-----------------------tgagattc
A0A8D1SK15_BCL2A1-      ttcatcagcccggggagaa-----------------------tgagattc
A0A8D0Z1Y4_BCL2A1-      ttcatcagcccggggagaa-----------------------tgagattc
A0A8D1YBS8_BCL2A1-      ttcatcagcccggggagaa-----------------------tgagattc
Q95KR3_MCL1-01          tg-------cttcggaaac-----------------------tggacatc
A0A8D1FTD4_MCL1-03      tg-------cttcggaaac-----------------------tggacatc
A0A8D1G1G8_MCL1-04      tg-------cttcggaaac-----------------------tggacatc
A0A4X1SEZ6_MCL1-01      tg-------cttcggaaac-----------------------tggacatc
A0A4X1SFB1_MCL1-01      tg-------cttcggaaac-----------------------tggacatc
A0A8D1FTD4_MCL1-01      tg-------cttcggaaac-----------------------tggacatc
A0A8D1G1G8_MCL1-02      tg-------cttcggaaac-----------------------tggacatc
A0A8D1RYD1_MCL1-01      tg-------cttcggaaac-----------------------tggacatc
A0A4X1SEU3_MCL1-02      tg-------cttcggaaac-----------------------tggacatc
A0A4X1SEZ6_MCL1-03      tg-------cttcggaaac-----------------------tggacatc
A0A4X1SFB1_MCL1-02      tg-------cttcggaaac-----------------------tggacatc
A0A8D1FTD4_MCL1-05      tg-------cttcggaaac-----------------------tggacatc
A0A8D1G1G8_MCL1-01      tg-------cttcggaaac-----------------------tggacatc
A0A8D1RYD1_MCL1-03      tg-------cttcggaaac-----------------------tggacatc
A0A4X1SEU3_MCL1-01      tg-------cttcggaaac-----------------------tggacatc
A0A8D1G1G8_MCL1-03      tg-------cttcggaaac-----------------------tggacatc
A0A8D1FTD4_MCL1-02      tg-------cttcggaaac-----------------------tggacatc
A0A8D1RYD1_MCL1-02      tg-------cttcggaaac-----------------------tggacatc
A0A4X1SEZ6_MCL1-02      tg-------cttcggaaac-----------------------tggacatc
A0A8D1FTD4_MCL1-04      tg-------cttcggaaac-----------------------tggacatc
A0A8D0QLD9_BCL2-07      tg-------ccgaagaaaa-----------------------c-------
A0A4X1TRR9_BCL2-06      tg-------ccgaagaaaa-----------------------c-------
A0A8D0QLD9_BCL2-05      --------------------------------------------------
A0A4X1TRR9_BCL2-05      --------------------------------------------------
A0A8D0QLD9_BCL2-04      tg-------ccgaagaaaa-----------------------c-------
A0A4X1TRR9_BCL2-07      tg-------ccgaagaaaa-----------------------c-------
A0A8D0QLD9_BCL2-06      tg-------ccgaagaaaa-----------------------c-------
A0A4X1TRR9_BCL2-04      tg-------ccgaagaaaa-----------------------c-------
A0A4X1TRR9_BCL2-02      tg-------ccgaagaaaa-----------------------c-------
A0A8D0QLD9_BCL2-02      tg-------ccgaagaaaa-----------------------c-------
                                                                          

A0A8D1N411_BCL2L10      -cgaacggcggctggg-tggat------tctttcttcaatgctattaggt
A0A8D1ITC0_BCL2L10      -cgaacggcggctgggatggattttgtctcttcttccaaggctcattgca
A0A4X1T1Z2_BCL2L10      -cgaacggcggctgggatggattttgtctcttcttccaaggctcattgca
A0A8D1QEZ6_BCL2L10      -cgaacggcggctgggatggattttgtctcttcttccaaggctcattgca
A0A8D1ALD6_BCL2L1-      -agaacggcggctggg-aca---------cttttgtggaactctacggaa
A0A4X1SQU7_BCL2L1-      -agaacggcggctggg-aca---------cttttgtggaactctacggaa
A0A8D0XF62_BCL2L1-      -agaacggcggctggg-aca---------cttttgtggaactctacggaa
O77737_BCL2L1-01        -agaacggcggctggg-aca---------cttttgtggaactctacggaa
A0A8D0J6V8_BCL2L1-      -agaacggcggctggg-aca---------cttttgtggaactctacggaa
A0A8D0J6V8_BCL2L1-      -agaacggcggctggg-aca---------cttttgtggaactctacggaa
A0A8D0J6V8_BCL2L1-      -agaacggcggctggg-aca---------cttttgtggaactctacggaa
A0A8D0J6V8_BCL2L1-      -agaacggcggctggg-aca---------cttttgtggaactctacggaa
A0A8D0J6V8_BCL2L1-      -agaacggcggctggg-aca---------cttttgtggaactctacggaa
A0A4X1SQU7_BCL2L1-      -agaacggcggctggg-aca---------cttttgtggaactctacggaa
A0A4X1SQU7_BCL2L1-      -agaacggcggctggg-aca---------cttttgtggaactctacggaa
A0A4X1SQU7_BCL2L1-      -agaacggcggctggg-aca---------cttttgtggaactctacggaa
A0A4X1SRM7_BCL2L1-      -agaacggcggctggg-aca---------cttttgtggaactctacggaa
A0A8D0XF62_BCL2L1-      -agaacggcggctggg-aca---------cttttgtggaactctacggaa
A0A8D1ALD6_BCL2L1-      -agaacggcggctggg-aca---------cttttgtggaactctacggaa
A0A4X1SQU7_BCL2L1-      -agaacggcggctggg-aca---------cttttgtggaactctacggaa
A0A4X1SF63_BCL2L2-      ggcaatgtggactatg-gtgcaacagcagaagagctggaagcacactttc
A0A4X1SF63_BCL2L2-      ggcaatgtggactatg-gtgcaacagcagaagagctggaagcacactttc
A0A8D0TJQ9_BCL2L2-      ggcaatgtggactatg-gtgcaacagcagaagagctggaagcacactttc
A0A482LX62_BCL2L2-      -----------------------------------tggagccac------
A0A3Q9B4M8_BCL2L2-      gctgacgggggccgtg-gcac--------------tgggggccc------
A0A7T8CLX7_BCL2L2-      gctgacgggggccgtg-gcac--------------tgggggccc------
A0A8D0TJQ9_BCL2L2-      gctgacgggggccgtg-gcac--------------tgggggccc------
A0A4X1SF60_BCL2L2-      gctgacgggggccgtg-gcac--------------tgggggccc------
A0A4X1SF63_BCL2L2-      gctgacgggggccgtg-gcac--------------tgggggccc------
A0A8D0TJQ9_BCL2L2-      --------------ta-gtccaaca------------gaggctccttctc
A0A4X1SF63_BCL2L2-      ggcaatgtggactatg-gtgcaacagcagaagagctggaagcacactttc
A0A4D6NWN1_BCL2L2-      ggcaatgtggactatg-gtgcaacagcagaagagctggaagcacactttc
A0A4X1SF60_BCL2L2-      ggcaatgtggactatg-gtgcaacagcagaagagctggaagcacactttc
A0A4X1SF63_BCL2L2-      ggcaatgtggactatg-gtgcaacagcagaagagctggaagcacactttc
A0A8D0TJQ9_BCL2L2-      ggcaatgtggactatg-gtgcaacagcagaagagctggaagcacactttc
A0A4X1SF60_BCL2L2-      ggcaatgtggactatg-gtgcaacagcagaagagctggaagcacactttc
A0A8D0TJQ9_BCL2L2-      ggcaatgtggactatg-gtgcaacagcagaagagctggaagcacactttc
A0A8D0QLD9_BCL2-03      -aggattgtggcctt-------------ctttgagttc--ggtggggtca
A0A4X1TRR9_BCL2-01      -aggattgtggcctt-------------ctttgagttc--ggtggggtca
A0A8D0QLD9_BCL2-01      -aggattgtggcctt-------------ctttgagttc--ggtggggtca
A0A4X1TRR9_BCL2-03      -aggattgtggcctt-------------ctttgagttc--ggtggggtca
A0A8D1BRF8_BCL2A1-      gaga--ggaggccttg-tcaacagggggacttgatctc--atcttcatgc
A0A8D0Z1Y4_BCL2A1-      gaga--ggaggccttg-tcaacagggggacttgatctc--atcttcatgc
A0A8D1SK15_BCL2A1-      gaga--ggaggccttg-tcaacagggggacttgatctc--atcttcatgc
A0A4X1UP21_BCL2A1-      gaga--ggaggccttg-tcaacagggggacttgatctc--atcttcatgc
A0A8D1BRF8_BCL2A1-      gaga--ggaggccttg-tcaacagggggacttgatctc--atcttcatgc
A0A8D1YBS8_BCL2A1-      gaga--ggaggccttg-tcaacagggggacttgatctc--atcttcatgc
A0A4X1UP21_BCL2A1-      ---------ggctttg-taaagaag----tttgaacccaaatctggctgg
A0A4X1UQW5_BCL2A1-      ---------ggctttg-taaagaag----tttgaacccaaatctggctgg
A0A8D0Z1Y4_BCL2A1-      ---------ggctttg-taaagaag----tttgaacccaaatctggctgg
A0A8D1BRF8_BCL2A1-      ---------ggctttg-taaagaag----tttgaacccaaatctggctgg
A0A8D1SK15_BCL2A1-      ---------ggctttg-taaagaag----tttgaacccaaatctggctgg
A0A8D1YBS8_BCL2A1-      ---------ggctttg-taaagaag----tttgaacccaaatctggctgg
C7F841_BCL2A1-01        ---------ggctttg-taaagaag----tttgaacccaaatctggctgg
A0A8D1KPD1_BCL2A1-      ---------ggctttg-taaagaag----tttgaacccaaatctggctgg
A0A8D1BRF8_BCL2A1-      gaga--ggaggccttg-tcaacagggggacttgatctc--atcttcatgc
A0A4X1UP21_BCL2A1-      gaga--ggaggccttg-tcaacagggggacttgatctc--atcttcatgc
A0A8D1SK15_BCL2A1-      gaga--ggaggccttg-tcaacagggggacttgatctc--atcttcatgc
A0A8D0Z1Y4_BCL2A1-      gaga--ggaggccttg-tcaacagggggacttgatctc--atcttcatgc
A0A8D1YBS8_BCL2A1-      gaga--ggaggccttg-tcaacagggggacttgatctc--atcttcatgc
Q95KR3_MCL1-01          aaaaacgaagacgatg-tcaaatctttgtctcgagtgatggtccacgttt
A0A8D1FTD4_MCL1-03      aaaaacgaagacgatg-tcaaatctttgtctcgagtgatggtccacgttt
A0A8D1G1G8_MCL1-04      aaaaacgaagacgatg-tcaaatctttgtctcgagtgatggtccacgttt
A0A4X1SEZ6_MCL1-01      aaaaacgaagacgatg-tcaaatctttgtctcgagtgatggtccacgttt
A0A4X1SFB1_MCL1-01      aaaaacgaagacgatg-tcaaatctttgtctcgagtgatggtccacgttt
A0A8D1FTD4_MCL1-01      aaaaacgaagacgatg-tcaaatctttgtctcgagtgatggtccacgttt
A0A8D1G1G8_MCL1-02      aaaaacgaagacgatg-tcaaatctttgtctcgagtgatggtccacgttt
A0A8D1RYD1_MCL1-01      aaaaacgaagacgatg-tcaaatctttgtctcgagtgatggtccacgttt
A0A4X1SEU3_MCL1-02      aaaaacgaagacgatg-tcaaatctttgtctcgagtgatggtccacgttt
A0A4X1SEZ6_MCL1-03      aaaaacgaagacgatg-tcaaatctttgtctcgagtgatggtccacgttt
A0A4X1SFB1_MCL1-02      aaaaacgaagacgatg-tcaaatctttgtctcgagtgatggtccacgttt
A0A8D1FTD4_MCL1-05      aaaaacgaagacgatg-tcaaatctttgtctcgagtgatggtccacgttt
A0A8D1G1G8_MCL1-01      aaaaacgaagacgatg-tcaaatctttgtctcgagtgatggtccacgttt
A0A8D1RYD1_MCL1-03      aaaaacgaagacgatg-tcaaatctttgtctcgagtgatggtccacgttt
A0A4X1SEU3_MCL1-01      aaaaacgaagacgatg-tcaaatctttgtctcgagtgatggtccacgttt
A0A8D1G1G8_MCL1-03      aaaaacgaagacgatg-tcaaatctttgtctcgagtgatggtccacgttt
A0A8D1FTD4_MCL1-02      aaaaacgaagacgatg-tcaaatctttgtctcgagtgatggtccacgttt
A0A8D1RYD1_MCL1-02      aaaaacgaagacgatg-tcaaatctttgtctcgagtgatggtccacgttt
A0A4X1SEZ6_MCL1-02      aaaaacgaagacgatg-tcaaatctttgtctcgagtgatggtccacgttt
A0A8D1FTD4_MCL1-04      aaaaacgaagacgatg-tcaaatctttgtctcgagtgatggtccacgttt
A0A8D0QLD9_BCL2-07      -aaaaccaagcctttg-gagactc---gtcttatttcagagaccacatct
A0A4X1TRR9_BCL2-06      -aaaaccaagcctttg-gagactc---gtcttatttcagagaccacatct
A0A8D0QLD9_BCL2-05      --------agcctttg-gagactc---gtcttatttcagagaccacatct
A0A4X1TRR9_BCL2-05      --------agcctttg-gagactc---gtcttatttcagagaccacatct
A0A8D0QLD9_BCL2-04      -aaaaccaagcctttg-gagactc---gtcttatttcagagaccacatct
A0A4X1TRR9_BCL2-07      -aaaaccaagcctttg-gagactc---gtcttatttcagagaccacatct
A0A8D0QLD9_BCL2-06      -aaaaccaagcctttg-gagactc---gtcttatttcagagaccacatct
A0A4X1TRR9_BCL2-04      -aaaaccaagcctttg-gagactc---gtcttatttcagagaccacatct
A0A4X1TRR9_BCL2-02      -aaaaccaagcctttg-gagactc---gtcttatttcagagaccacatct
A0A8D0QLD9_BCL2-02      -aaaaccaagcctttg-gagactc---gtcttatttcagagaccacatct
                                                                          

A0A8D1N411_BCL2L10      acacctttccacttgactccgcagctct----------------------
A0A8D1ITC0_BCL2L10      acaaacttggacaagacacat--ggtct----------------------
A0A4X1T1Z2_BCL2L10      acaaacttggacaagacacat--ggtct----------------------
A0A8D1QEZ6_BCL2L10      acaaacttggacaagacacat--ggtct----------------------
A0A8D1ALD6_BCL2L1-      acaatgcagcagctgagagccggaaggg----------------------
A0A4X1SQU7_BCL2L1-      acaatgcagcagctgagagccggaaggg----------------------
A0A8D0XF62_BCL2L1-      acaatgcagcagctgagagccggaaggg----------------------
O77737_BCL2L1-01        acaatgcagcagctgagagccggaaggg----------------------
A0A8D0J6V8_BCL2L1-      acaatgcagcagctgagagccggaaggg----------------------
A0A8D0J6V8_BCL2L1-      acaatgcagcagctgagagccggaaggg----------------------
A0A8D0J6V8_BCL2L1-      acaatgcagcagctgagagccggaaggg----------------------
A0A8D0J6V8_BCL2L1-      acaatgcagcagctgagagccggaaggg----------------------
A0A8D0J6V8_BCL2L1-      acaatgcagcagctgagagccggaaggg----------------------
A0A4X1SQU7_BCL2L1-      acaatgcagcagctgagagccggaaggg----------------------
A0A4X1SQU7_BCL2L1-      acaatgcagcagctgagagccggaaggg----------------------
A0A4X1SQU7_BCL2L1-      acaatgcagcagctgagagccggaaggg----------------------
A0A4X1SRM7_BCL2L1-      acaatgcagcagctgagagccggaaggg----------------------
A0A8D0XF62_BCL2L1-      acaatgcagcagctgagagccggaaggg----------------------
A0A8D1ALD6_BCL2L1-      acaatgcagcagctgagagccggaaggg----------------------
A0A4X1SQU7_BCL2L1-      acaatgcagcagctgagagccggaaggg----------------------
A0A4X1SF63_BCL2L2-      atggctgtggttcagtcaaccgcgttac----------------------
A0A4X1SF63_BCL2L2-      atggctgtggttcagtcaaccgcgttac----------------------
A0A8D0TJQ9_BCL2L2-      atggctgtggttcagtcaaccgcgttac----------------------
A0A482LX62_BCL2L2-      --------------------------------------------------
A0A3Q9B4M8_BCL2L2-      --------------------------------------------------
A0A7T8CLX7_BCL2L2-      --------------------------------------------------
A0A8D0TJQ9_BCL2L2-      --------------------------------------------------
A0A4X1SF60_BCL2L2-      --------------------------------------------------
A0A4X1SF63_BCL2L2-      --------------------------------------------------
A0A8D0TJQ9_BCL2L2-      at------------------------------------------------
A0A4X1SF63_BCL2L2-      atggctgtggttcagtcaaccgcgttac----------------------
A0A4D6NWN1_BCL2L2-      atggctgtggttcagtcaaccgcgttac----------------------
A0A4X1SF60_BCL2L2-      atggctgtggttcagtcaaccgcgttac----------------------
A0A4X1SF63_BCL2L2-      atggctgtggttcagtcaaccgcgttac----------------------
A0A8D0TJQ9_BCL2L2-      atggctgtggttcagtcaaccgcgttac----------------------
A0A4X1SF60_BCL2L2-      atggctgtggttcagtcaaccgcgttac----------------------
A0A8D0TJQ9_BCL2L2-      atggctgtggttcagtcaaccgcgttac----------------------
A0A8D0QLD9_BCL2-03      tgtgtgtggagagcgtcaaccgggagat----------------------
A0A4X1TRR9_BCL2-01      tgtgtgtggagagcgtcaaccgggagat----------------------
A0A8D0QLD9_BCL2-01      tgtgtgtggagagcgtcaaccgggagat----------------------
A0A4X1TRR9_BCL2-03      tgtgtgtggagagcgtcaaccgggagat----------------------
A0A8D1BRF8_BCL2A1-      ctggtcttgggtttgacaactgtggcaa----------------------
A0A8D0Z1Y4_BCL2A1-      ctggtcttgggtttgacaactgtggcaa----------------------
A0A8D1SK15_BCL2A1-      ctggtcttgggtttgacaactgtggcaa----------------------
A0A4X1UP21_BCL2A1-      ctggtcttgggtttgacaactgtggcaa----------------------
A0A8D1BRF8_BCL2A1-      ctggtcttgggtttgacaactgtggcaa----------------------
A0A8D1YBS8_BCL2A1-      ctggtcttgggtttgacaactgtggcaa----------------------
A0A4X1UP21_BCL2A1-      ctgacctttg---tggaagttacaggaa----------------------
A0A4X1UQW5_BCL2A1-      ctgacctttg---tggaagttacaggaa----------------------
A0A8D0Z1Y4_BCL2A1-      ctgacctttg---tggaagttacaggaa----------------------
A0A8D1BRF8_BCL2A1-      ctgacctttg---tggaagttacaggaa----------------------
A0A8D1SK15_BCL2A1-      ctgacctttg---tggaagttacaggaa----------------------
A0A8D1YBS8_BCL2A1-      ctgacctttg---tggaagttacaggaa----------------------
C7F841_BCL2A1-01        ctgacctttg---tggaagttacaggaa----------------------
A0A8D1KPD1_BCL2A1-      ctgacctttg---tggaagttacaggaa----------------------
A0A8D1BRF8_BCL2A1-      ctggtcttgggtttgacaactgtggcaa----------------------
A0A4X1UP21_BCL2A1-      ctggtcttgggtttgacaactgtggcaa----------------------
A0A8D1SK15_BCL2A1-      ctggtcttgggtttgacaactgtggcaa----------------------
A0A8D0Z1Y4_BCL2A1-      ctggtcttgggtttgacaactgtggcaa----------------------
A0A8D1YBS8_BCL2A1-      ctggtcttgggtttgacaactgtggcaa----------------------
Q95KR3_MCL1-01          taagtgacggagtaacaaactggggcaggattgtgactcttatttctttt
A0A8D1FTD4_MCL1-03      tcagtgacggagtaacaaactggggcaggattgtgactcttatttctttt
A0A8D1G1G8_MCL1-04      tcagtgacggagtaacaaactggggcaggattgtgactcttatttctttt
A0A4X1SEZ6_MCL1-01      tcagtgacggagtaacaaactggggcaggattgtgactcttatttctttt
A0A4X1SFB1_MCL1-01      tcagtgacggagtaacaaactggggcaggattgtgactcttatttctttt
A0A8D1FTD4_MCL1-01      tcagtgacggagtaacaaactggggcaggattgtgactcttatttctttt
A0A8D1G1G8_MCL1-02      tcagtgacggagtaacaaactggggcaggattgtgactcttatttctttt
A0A8D1RYD1_MCL1-01      tcagtgacggagtaacaaactggggcaggattgtgactcttatttctttt
A0A4X1SEU3_MCL1-02      tcagtgacggagtaacaaactggggcaggattgtgactcttatttctttt
A0A4X1SEZ6_MCL1-03      tcagtgacggagtaacaaactggggcaggattgtgactcttatttctttt
A0A4X1SFB1_MCL1-02      tcagtgacggagtaacaaactggggcaggattgtgactcttatttctttt
A0A8D1FTD4_MCL1-05      tcagtgacggagtaacaaactggggcaggattgtgactcttatttctttt
A0A8D1G1G8_MCL1-01      tcagtgacggagtaacaaactggggcaggattgtgactcttatttctttt
A0A8D1RYD1_MCL1-03      tcagtgacggagtaacaaactggggcaggattgtgactcttatttctttt
A0A4X1SEU3_MCL1-01      tcagtgacggagtaacaaactggggcaggattgtgactcttatttctttt
A0A8D1G1G8_MCL1-03      tcagtgacggagtaacaaactggggcaggattgtgactcttatttctttt
A0A8D1FTD4_MCL1-02      tcagtgacggagtaacaaactggggcaggattgtgactcttatttctttt
A0A8D1RYD1_MCL1-02      tcagtgacggagtaacaaactggggcaggattgtgactcttatttctttt
A0A4X1SEZ6_MCL1-02      tcagtgacggagtaacaaactggggcaggattgtgactcttatttctttt
A0A8D1FTD4_MCL1-04      tcagtgacggagtaacaaactggggcaggattgtgactcttatttctttt
A0A8D0QLD9_BCL2-07      ----------gtttgcaaaccagagcaa----------------------
A0A4X1TRR9_BCL2-06      ----------gtttgcaaaccagagcaa----------------------
A0A8D0QLD9_BCL2-05      ----------gtttgcaaaccagagcaa----------------------
A0A4X1TRR9_BCL2-05      ----------gtttgcaaaccagagcaa----------------------
A0A8D0QLD9_BCL2-04      ----------gtttgcaaaccagagcaa----------------------
A0A4X1TRR9_BCL2-07      ----------gtttgcaaaccagagcaa----------------------
A0A8D0QLD9_BCL2-06      ----------gtttgcaaaccagagcaa----------------------
A0A4X1TRR9_BCL2-04      ----------gtttgcaaaccagagcaa----------------------
A0A4X1TRR9_BCL2-02      ----------gtttgcaaaccagagcaa----------------------
A0A8D0QLD9_BCL2-02      ----------gtttgcaaaccagagcaa----------------------
                                                                          

A0A8D1N411_BCL2L10      ---gcaggttggagcacaccagcctaaaaactttaggatgaaaaggcagc
A0A8D1ITC0_BCL2L10      ---gggtttttgtgt-----------catactgta-----------cagc
A0A4X1T1Z2_BCL2L10      ---gggtttttgtgt-----------catactgta-----------cagc
A0A8D1QEZ6_BCL2L10      ---gggtttttgtgt-----------catactgta-----------cagc
A0A8D1ALD6_BCL2L1-      ------------------------------------------ccaggagc
A0A4X1SQU7_BCL2L1-      ------------------------------------------ccaggagc
A0A8D0XF62_BCL2L1-      ------------------------------------------ccaggagc
O77737_BCL2L1-01        ------------------------------------------ccaggaac
A0A8D0J6V8_BCL2L1-      ------------------------------------------ccaggagc
A0A8D0J6V8_BCL2L1-      ------------------------------------------ccaggagc
A0A8D0J6V8_BCL2L1-      ------------------------------------------ccaggagc
A0A8D0J6V8_BCL2L1-      ------------------------------------------ccaggagc
A0A8D0J6V8_BCL2L1-      ------------------------------------------ccaggagc
A0A4X1SQU7_BCL2L1-      ------------------------------------------ccaggagc
A0A4X1SQU7_BCL2L1-      ------------------------------------------ccaggagc
A0A4X1SQU7_BCL2L1-      ------------------------------------------ccaggagc
A0A4X1SRM7_BCL2L1-      ------------------------------------------ccaggagc
A0A8D0XF62_BCL2L1-      ------------------------------------------ccaggagc
A0A8D1ALD6_BCL2L1-      ------------------------------------------ccaggagc
A0A4X1SQU7_BCL2L1-      ------------------------------------------ccaggagc
A0A4X1SF63_BCL2L2-      -tatactctgtgacaaa---------tttagtggcc---atcccaaaggg
A0A4X1SF63_BCL2L2-      -tatactctgtgacaaa---------tttagtggcc---atcccaaaggg
A0A8D0TJQ9_BCL2L2-      -tatactctgtgacaaa---------tttagtggcc---atcccaaaggg
A0A482LX62_BCL2L2-      -----tcgtgggacaag---------tgcaggag----------------
A0A3Q9B4M8_BCL2L2-      ----------tggtaac---------tgtaggggcc--------------
A0A7T8CLX7_BCL2L2-      ----------tggtaac---------tgtaggggcc--------------
A0A8D0TJQ9_BCL2L2-      ----------tggtaac---------tgtaggggcc--------------
A0A4X1SF60_BCL2L2-      ----------tggtaac---------tgtaggggcc--------------
A0A4X1SF63_BCL2L2-      ----------tggtaac---------tgtaggggcc--------------
A0A8D0TJQ9_BCL2L2-      --------------------------ttaaatggcc---acctca-----
A0A4X1SF63_BCL2L2-      -tatactctgtgacaaa---------tttagtggcc---atcccaaaggg
A0A4D6NWN1_BCL2L2-      -tatactctgtgacaaa---------tttagtggcc---atcccaaaggg
A0A4X1SF60_BCL2L2-      -tatactctgtgacaaa---------tttagtggcc---atcccaaaggg
A0A4X1SF63_BCL2L2-      -tatactctgtgacaaa---------tttagtggcc---atcccaaaggg
A0A8D0TJQ9_BCL2L2-      -tatactctgtgacaaa---------tttagtggcc---atcccaaaggg
A0A4X1SF60_BCL2L2-      -tatactctgtgacaaa---------tttagtggcc---atcccaaaggg
A0A8D0TJQ9_BCL2L2-      -tatactctgtgacaaa---------tttagtggcc---atcccaaaggg
A0A8D0QLD9_BCL2-03      gtcgcccctggtggacaacatcgccctgtggatgactgagtacctgaacc
A0A4X1TRR9_BCL2-01      gtcgcccctggtggacaacatcgccctgtggatgactgagtacctgaacc
A0A8D0QLD9_BCL2-01      gtcgcccctggtggacaacatcgccctgtggatgactgagtacctgaacc
A0A4X1TRR9_BCL2-03      gtcgcccctggtggacaacatcgccctgtggatgactgagtacctgaacc
A0A8D1BRF8_BCL2A1-      ---ccgtctggggcggggcaagggctactacgacgc---ctacctgaagc
A0A8D0Z1Y4_BCL2A1-      ---ccgtctggggcggggcaagggctactacgacac---ctacctgaagc
A0A8D1SK15_BCL2A1-      ---ccgtctggggcggggcaagggctactacgacac---ctacctgaagc
A0A4X1UP21_BCL2A1-      ---ccgtctggggcggggcaagggctactacgacgc---ctacctgaagc
A0A8D1BRF8_BCL2A1-      ---ccgtctggggcggggcaagggctactacgacgc---ctacctgaagc
A0A8D1YBS8_BCL2A1-      ---ccgtctggggcggggcaagggctactacgacgc---ctacctgaagc
A0A4X1UP21_BCL2A1-      ---agatctg----------------------------------tgaaat
A0A4X1UQW5_BCL2A1-      ---agatctg----------------------------------tgaaat
A0A8D0Z1Y4_BCL2A1-      ---agatctg----------------------------------tgaaat
A0A8D1BRF8_BCL2A1-      ---agatctg----------------------------------tgaaat
A0A8D1SK15_BCL2A1-      ---agatctg----------------------------------tgaaat
A0A8D1YBS8_BCL2A1-      ---agatctg----------------------------------tgaaat
C7F841_BCL2A1-01        ---agatctg----------------------------------tgaaat
A0A8D1KPD1_BCL2A1-      ---agatctg----------------------------------tgaaat
A0A8D1BRF8_BCL2A1-      ---ccgtctggggcggggcaagggctactacgacgc---ctacctgaagc
A0A4X1UP21_BCL2A1-      ---ccgtctggggcggggcaagggctactacgacgc---ctacctgaagc
A0A8D1SK15_BCL2A1-      ---ccgtctggggcggggcaagggctactacgacac---ctacctgaagc
A0A8D0Z1Y4_BCL2A1-      ---ccgtctggggcggggcaagggctactacgacac---ctacctgaagc
A0A8D1YBS8_BCL2A1-      ---ccgtctggggcggggcaagggctactacgacgc---ctacctgaagc
Q95KR3_MCL1-01          ggtgcctttgtggccaaacac----ttgaagagtat---aaatcaagaaa
A0A8D1FTD4_MCL1-03      ggtgcctttgtggccaaacac----ttgaagagtat---aaatcaagaaa
A0A8D1G1G8_MCL1-04      ggtgcctttgtggccaaacac----ttgaagagtat---aaatcaagaaa
A0A4X1SEZ6_MCL1-01      ggtgcctttgtggccaaacac----ttgaagagtat---aaatcaagaaa
A0A4X1SFB1_MCL1-01      ggtgcctttgtggccaaacac----ttgaagagtat---aaatcaagaaa
A0A8D1FTD4_MCL1-01      ggtgcctttgtggccaaacac----ttgaagagtat---aaatcaagaaa
A0A8D1G1G8_MCL1-02      ggtgcctttgtggccaaacac----ttgaagagtat---aaatcaagaaa
A0A8D1RYD1_MCL1-01      ggtgcctttgtggccaaacac----ttgaagagtat---aaatcaagaaa
A0A4X1SEU3_MCL1-02      ggtgcctttgtggccaaacac----ttgaagagtat---aaatcaagaaa
A0A4X1SEZ6_MCL1-03      ggtgcctttgtggccaaacac----ttgaagagtat---aaatcaagaaa
A0A4X1SFB1_MCL1-02      ggtgcctttgtggccaaacac----ttgaagagtat---aaatcaagaaa
A0A8D1FTD4_MCL1-05      ggtgcctttgtggccaaacac----ttgaagagtat---aaatcaagaaa
A0A8D1G1G8_MCL1-01      ggtgcctttgtggccaaacac----ttgaagagtat---aaatcaagaaa
A0A8D1RYD1_MCL1-03      ggtgcctttgtggccaaacac----ttgaagagtat---aaatcaagaaa
A0A4X1SEU3_MCL1-01      ggtgcctttgtggccaaacac----ttgaagagtat---aaatcaagaaa
A0A8D1G1G8_MCL1-03      ggtgcctttgtggccaaacac----ttgaagagtat---aaatcaagaaa
A0A8D1FTD4_MCL1-02      ggtgcctttgtggccaaacac----ttgaagagtat---aaatcaagaaa
A0A8D1RYD1_MCL1-02      ggtgcctttgtggccaaacac----ttgaagagtat---aaatcaagaaa
A0A4X1SEZ6_MCL1-02      ggtgcctttgtggccaaacac----ttgaagagtat---aaatcaagaaa
A0A8D1FTD4_MCL1-04      ggtgcctttgtggccaaacac----ttgaagagtat---aaatcaagaaa
A0A8D0QLD9_BCL2-07      ---------gtggccaaacaaattgttaaagatgcc---ata--------
A0A4X1TRR9_BCL2-06      ---------gtggccaaacaaattgttaaagatgcc---ata--------
A0A8D0QLD9_BCL2-05      ---------gtggccaaacaaattgttaaagatgcc---atacaaggaaa
A0A4X1TRR9_BCL2-05      ---------gtggccaaacaaattgttaaagatgcc---atacaaggaaa
A0A8D0QLD9_BCL2-04      ---------gtggccaaacaaattgttaaagatgcc---atacaaggaaa
A0A4X1TRR9_BCL2-07      ---------gtggccaaacaaattgttaaagatgcc---atacaaggaaa
A0A8D0QLD9_BCL2-06      ---------gtggccaaacaaattgttaaagatgcc---atacaaggaaa
A0A4X1TRR9_BCL2-04      ---------gtggccaaacaaattgttaaagatgcc---atacaaggaaa
A0A4X1TRR9_BCL2-02      ---------gtggccaaacaaattgttaaagatgcc---atacaaggaaa
A0A8D0QLD9_BCL2-02      ---------gtggccaaacaaattgttaaagatgcc---atacaaggaaa
                                                                          

A0A8D1N411_BCL2L10      ccttgtcctgctccacatctctaagaaagggc--tga-------------
A0A8D1ITC0_BCL2L10      agtggtcttactctacttgtggagaaaattattgtga-------------
A0A4X1T1Z2_BCL2L10      agtggtcttactctacttgtggagaaaattattgtga-------------
A0A8D1QEZ6_BCL2L10      agtggtcttactctacttgtggagaaaattattgtga-------------
A0A8D1ALD6_BCL2L1-      gcttcaacc-----------------------------------------
A0A4X1SQU7_BCL2L1-      gcttcaacc-----------------------------------------
A0A8D0XF62_BCL2L1-      gcttcaacc-----------------------------------------
O77737_BCL2L1-01        gcttcaacc-----------------------------------------
A0A8D0J6V8_BCL2L1-      gcttcaacc-----------------------------------------
A0A8D0J6V8_BCL2L1-      gcttcaacc-----------------------------------------
A0A8D0J6V8_BCL2L1-      gcttcaacc-----------------------------------------
A0A8D0J6V8_BCL2L1-      gcttcaacc-----------------------------------------
A0A8D0J6V8_BCL2L1-      gcttcaacc-----------------------------------------
A0A4X1SQU7_BCL2L1-      gcttcaacc-----------------------------------------
A0A4X1SQU7_BCL2L1-      gcttcaacc-----------------------------------------
A0A4X1SQU7_BCL2L1-      gcttcaacc-----------------------------------------
A0A4X1SRM7_BCL2L1-      gcttcaacc-----------------------------------------
A0A8D0XF62_BCL2L1-      gcttcaacc-----------------------------------------
A0A8D1ALD6_BCL2L1-      gcttcaacc-----------------------------------------
A0A4X1SQU7_BCL2L1-      gcttcaacc-----------------------------------------
A0A4X1SF63_BCL2L2-      tttgcatatatagagttctcagacaaagagtcagtgaggacttccttggc
A0A4X1SF63_BCL2L2-      tttgcatatatagagttctcagacaaagagtcagtgaggacttccttggc
A0A8D0TJQ9_BCL2L2-      tttgcatatatagagttctcagacaaagagtcagtgaggacttccttggc
A0A482LX62_BCL2L2-      -----------------------tggatggtga-----------------
A0A3Q9B4M8_BCL2L2-      ---------------ttttttgctagcaagtga-----------------
A0A7T8CLX7_BCL2L2-      ---------------ttttttgctagcaagtga-----------------
A0A8D0TJQ9_BCL2L2-      ---------------ttttttgctagcaagtga-----------------
A0A4X1SF60_BCL2L2-      ---------------ttttttgctagcaagtga-----------------
A0A4X1SF63_BCL2L2-      ---------------ttttttgctagcaagtga-----------------
A0A8D0TJQ9_BCL2L2-      ---------------cttctgtgcaaag-----------------ttgga
A0A4X1SF63_BCL2L2-      tttgcatatatagagttctcagacaaagagtcagtgaggacttccttggc
A0A4D6NWN1_BCL2L2-      tttgcatatatagagttctcagacaaagagtcagtgaggacttccttggc
A0A4X1SF60_BCL2L2-      tttgcatatatagagttctcagacaaagagtcagtgaggacttccttggc
A0A4X1SF63_BCL2L2-      tttgcatatatagagttctcagacaaagagtcagtgaggacttccttggc
A0A8D0TJQ9_BCL2L2-      tttgcatatatagagttctcagacaaagagtcagtgaggacttccttggc
A0A4X1SF60_BCL2L2-      tttgcatatatagagttctcagacaaagagtcagtgaggacttccttggc
A0A8D0TJQ9_BCL2L2-      tttgcatatatagagttctcagacaaagagtcagtgaggacttccttggc
A0A8D0QLD9_BCL2-03      ggcacctgcacacctggatccaggataac---------------------
A0A4X1TRR9_BCL2-01      ggcacctgcacacctggatccaggataac---------------------
A0A8D0QLD9_BCL2-01      ggcacctgcacacctggatccaggataac---------------------
A0A4X1TRR9_BCL2-03      ggcacctgcacacctggatccaggataac---------------------
A0A8D1BRF8_BCL2A1-      gctgtctgcagtcccaggatgtgaagccctacaccctggccttggctttc
A0A8D0Z1Y4_BCL2A1-      gctgtctgcagtcccaggatgtgaagccctacaccctggccttggctttc
A0A8D1SK15_BCL2A1-      gctgtctgcagtcccaggatgtgaagccctacaccctggccttggctttc
A0A4X1UP21_BCL2A1-      gctgtctgcagtcccaggatgtgaagccctacaccctggccttggctttc
A0A8D1BRF8_BCL2A1-      gctgtctgcagtcccaggatgtgaagccctacaccctggccttggctttc
A0A8D1YBS8_BCL2A1-      gctgtctgcagtcccaggatgtgaagccctacaccctggccttggctttc
A0A4X1UP21_BCL2A1-      gttat---------------------------------------------
A0A4X1UQW5_BCL2A1-      gttat---------------------------------------------
A0A8D0Z1Y4_BCL2A1-      gttat---------------------------------------------
A0A8D1BRF8_BCL2A1-      gttat---------------------------------------------
A0A8D1SK15_BCL2A1-      gttat---------------------------------------------
A0A8D1YBS8_BCL2A1-      gttat---------------------------------------------
C7F841_BCL2A1-01        gttat---------------------------------------------
A0A8D1KPD1_BCL2A1-      gttat---------------------------------------------
A0A8D1BRF8_BCL2A1-      gctgtctgcagtcccaggatgtgaagccctacaccctggccttggctttc
A0A4X1UP21_BCL2A1-      gctgtctgcagtcccaggatgtgaagccctacaccctggccttggctttc
A0A8D1SK15_BCL2A1-      gctgtctgcagtcccaggatgtgaagccctacaccctggccttggctttc
A0A8D0Z1Y4_BCL2A1-      gctgtctgcagtcccaggatgtgaagccctacaccctggccttggctttc
A0A8D1YBS8_BCL2A1-      gctgtctgcagtcccaggatgtgaagccctacaccctggccttggctttc
Q95KR3_MCL1-01          gctgcat-cgaaccgttagcagaaagcatcaca-gatgttctcgtaagga
A0A8D1FTD4_MCL1-03      gctgcat-cgaaccgttagcagaaagcatcaca-gatgttctcgtaagga
A0A8D1G1G8_MCL1-04      gctgcat-cgaaccgttagcagaaagcatcaca-gatgttctcgtaagga
A0A4X1SEZ6_MCL1-01      gctgcat-cgaaccgttagcagaaagcatcaca-gatgttctcgtaagga
A0A4X1SFB1_MCL1-01      gctgcat-cgaaccgttagcagaaagcatcaca-gatgttctcgtaagga
A0A8D1FTD4_MCL1-01      gctgcat-cgaaccgttagcagaaagcatcaca-gatgttctcgtaagga
A0A8D1G1G8_MCL1-02      gctgcat-cgaaccgttagcagaaagcatcaca-gatgttctcgtaagga
A0A8D1RYD1_MCL1-01      gctgcat-cgaaccgttagcagaaagcatcaca-gatgttctcgtaagga
A0A4X1SEU3_MCL1-02      gctgcat-cgaaccgttagcagaaagcatcaca-gatgttctcgtaagga
A0A4X1SEZ6_MCL1-03      gctgcat-cgaaccgttagcagaaagcatcaca-gatgttctcgtaagga
A0A4X1SFB1_MCL1-02      gctgcat-cgaaccgttagcagaaagcatcaca-gatgttctcgtaagga
A0A8D1FTD4_MCL1-05      gctgcat-cgaaccgttagcagaaagcatcaca-gatgttctcgtaagga
A0A8D1G1G8_MCL1-01      gctgcat-cgaaccgttagcagaaagcatcaca-gatgttctcgtaagga
A0A8D1RYD1_MCL1-03      gctgcat-cgaaccgttagcagaaagcatcaca-gatgttctcgtaagga
A0A4X1SEU3_MCL1-01      gctgcat-cgaaccgttagcagaaagcatcaca-gatgttctcgtaagga
A0A8D1G1G8_MCL1-03      gctgcat-cgaaccgttagcagaaagcatcaca-gatgttctcgtaagga
A0A8D1FTD4_MCL1-02      gctgcat-cgaaccgttagcagaaagcatcaca-gatgttctcgtaagga
A0A8D1RYD1_MCL1-02      gctgcat-cgaaccgttagcagaaagcatcaca-gatgttctcgtaagga
A0A4X1SEZ6_MCL1-02      gctgcat-cgaaccgttagcagaaagcatcaca-gatgttctcgtaagga
A0A8D1FTD4_MCL1-04      gctgcat-cgaaccgttagcagaaagcatcaca-gatgttctcgtaagga
A0A8D0QLD9_BCL2-07      --------------------------------------------------
A0A4X1TRR9_BCL2-06      --------------------------------------------------
A0A8D0QLD9_BCL2-05      tttcaat-agttccatcggctcagatgggtacatgctgtcctc-------
A0A4X1TRR9_BCL2-05      tttcaat-agttccatcggctcagatgggtacatgctgtcctc-------
A0A8D0QLD9_BCL2-04      tttcaat-agttccatcggctcagatgggtacatgctgtcctc-------
A0A4X1TRR9_BCL2-07      tttcaat-agttccatcggctcagatgggtacatgctgtcctc-------
A0A8D0QLD9_BCL2-06      tttcaat-agttccatcggctcagatgggtacatgctgtcctc-------
A0A4X1TRR9_BCL2-04      tttcaat-agttccatcggctcagatgggtacatgctgtcctc-------
A0A4X1TRR9_BCL2-02      tttcaat-agttccatcggctcagatgggtacatgctgtcctc-------
A0A8D0QLD9_BCL2-02      tttcaat-agttccatcggctcagatgggtacatgctgtcctc-------
                                                                          

A0A8D1N411_BCL2L10      --------------------------------------------------
A0A8D1ITC0_BCL2L10      --------------------------------------------------
A0A4X1T1Z2_BCL2L10      --------------------------------------------------
A0A8D1QEZ6_BCL2L10      --------------------------------------------------
A0A8D1ALD6_BCL2L1-      --------------------------gatgg-ccctgtggctccaaccct
A0A4X1SQU7_BCL2L1-      --------------------------gatgg-ccctgtggctccaaccct
A0A8D0XF62_BCL2L1-      --------------------------gatgg-ccctgtggctccaaccct
O77737_BCL2L1-01        --------------------------gatggttcctg-------------
A0A8D0J6V8_BCL2L1-      --------------------------gatggttcctg-------------
A0A8D0J6V8_BCL2L1-      --------------------------gatggttcctg-------------
A0A8D0J6V8_BCL2L1-      --------------------------gatggttcctg-------------
A0A8D0J6V8_BCL2L1-      --------------------------gatggttcctg-------------
A0A8D0J6V8_BCL2L1-      --------------------------gatggttcctg-------------
A0A4X1SQU7_BCL2L1-      --------------------------gatggttcctg-------------
A0A4X1SQU7_BCL2L1-      --------------------------gatggttcctg-------------
A0A4X1SQU7_BCL2L1-      --------------------------gatggttcctg-------------
A0A4X1SRM7_BCL2L1-      --------------------------gatggttcctg-------------
A0A8D0XF62_BCL2L1-      --------------------------gatggttcctg-------------
A0A8D1ALD6_BCL2L1-      --------------------------gatggttcctg-------------
A0A4X1SQU7_BCL2L1-      --------------------------gatggttcctg-------------
A0A4X1SF63_BCL2L2-      cttagatgagtccctatttagaggaagacaaatcaaggtgatcccaaaac
A0A4X1SF63_BCL2L2-      cttagatgagtccctatttagaggaagacaaatcaaggtgatcccaaaac
A0A8D0TJQ9_BCL2L2-      cttagatgagtccctatttagaggaagacaaatcaaggtgatcccaaaac
A0A482LX62_BCL2L2-      --------------------------------------------------
A0A3Q9B4M8_BCL2L2-      --------------------------------------------------
A0A7T8CLX7_BCL2L2-      --------------------------------------------------
A0A8D0TJQ9_BCL2L2-      --------------------------------------------------
A0A4X1SF60_BCL2L2-      --------------------------------------------------
A0A4X1SF63_BCL2L2-      --------------------------------------------------
A0A8D0TJQ9_BCL2L2-      cctag---------------------------------------------
A0A4X1SF63_BCL2L2-      cttagatgagtccctatttagaggaagacaaatcaaggtgatcccaaaac
A0A4D6NWN1_BCL2L2-      cttagatgagtccctatttagaggaagacaaatcaaggtgatcccaaaac
A0A4X1SF60_BCL2L2-      cttagatgagtccctatttagaggaagacaaatcaaggtgatcccaaaac
A0A4X1SF63_BCL2L2-      cttagatgagtccctatttagaggaagacaaatcaaggtgatcccaaaac
A0A8D0TJQ9_BCL2L2-      cttagatgagtccctatttagaggaagacaaatcaaggtgatcccaaaac
A0A4X1SF60_BCL2L2-      cttagatgagtccctatttagaggaagacaaatcaaggtgatcccaaaac
A0A8D0TJQ9_BCL2L2-      cttagatgagtccctatttagaggaagacaaatcaaggtgatcccaaaac
A0A8D0QLD9_BCL2-03      --------------------------ggaggctgggctgactcaagcaa-
A0A4X1TRR9_BCL2-01      --------------------------ggaggctgggatgcctttgtgga-
A0A8D0QLD9_BCL2-01      --------------------------ggaggctgggatgcctttgtgga-
A0A4X1TRR9_BCL2-03      --------------------------ggaggctgga--------------
A0A8D1BRF8_BCL2A1-      aaagaacagatttgcctc-----------------caggtccccatggat
A0A8D0Z1Y4_BCL2A1-      aaagaacagatttgcctt-----------------caggtccccatggat
A0A8D1SK15_BCL2A1-      aaagaacagatttgcctt-----------------caggtccccatggat
A0A4X1UP21_BCL2A1-      aaagaacagatttgcctt-----------------caggtccccatggat
A0A8D1BRF8_BCL2A1-      aaagaacagatttgcctc-----------------caggtccccatggat
A0A8D1YBS8_BCL2A1-      aaagaacagatttgcctc-----------------caggtccccatggat
A0A4X1UP21_BCL2A1-      --------------------------------------gtctcc------
A0A4X1UQW5_BCL2A1-      --------------------------------------gtctcc------
A0A8D0Z1Y4_BCL2A1-      --------------------------------------gtctcc------
A0A8D1BRF8_BCL2A1-      --------------------------------------gtctcc------
A0A8D1SK15_BCL2A1-      --------------------------------------gtctcc------
A0A8D1YBS8_BCL2A1-      --------------------------------------gtctcc------
C7F841_BCL2A1-01        --------------------------------------gtctcc------
A0A8D1KPD1_BCL2A1-      --------------------------------------gtctcc------
A0A8D1BRF8_BCL2A1-      aaagaacagatttgcctc-----------------caggtccccatggat
A0A4X1UP21_BCL2A1-      aaagaacagatttgcctt-----------------caggtccccatggat
A0A8D1SK15_BCL2A1-      aaagaacagatttgcctt-----------------caggtccccatggat
A0A8D0Z1Y4_BCL2A1-      aaagaacagatttgcctt-----------------caggtccccatggat
A0A8D1YBS8_BCL2A1-      aaagaacagatttgcctc-----------------caggtccccatggat
Q95KR3_MCL1-01          caaaacgagactggctagtcaaacaaagaggctgggatgggtttgtggag
A0A8D1FTD4_MCL1-03      caaaacgagactggctagtcaaacaaagaggctgggatgggtttgtggag
A0A8D1G1G8_MCL1-04      caaaacgagactggctagtcaaacaaagaggctgggatgggtttgtggag
A0A4X1SEZ6_MCL1-01      caaaacgagactggctagtcaaacaaagaggctgggatgggtttgtggag
A0A4X1SFB1_MCL1-01      caaaacgagactggctagtcaaacaaagaggctgggatgggtttgtggag
A0A8D1FTD4_MCL1-01      caaaacgagactggctagtcaaacaaagaggctgggatgggtttgtggag
A0A8D1G1G8_MCL1-02      caaaacgagactggctagtcaaacaaagaggctgggatgggtttgtggag
A0A8D1RYD1_MCL1-01      caaaacgagactggctagtcaaacaaagaggctgggatgggtttgtggag
A0A4X1SEU3_MCL1-02      caaaacgagactggctagtcaaacaaagaggctgggatgggtttgtggag
A0A4X1SEZ6_MCL1-03      caaaacgagactggctagtcaaacaaagaggctgggatgggtttgtggag
A0A4X1SFB1_MCL1-02      caaaacgagactggctagtcaaacaaagaggctgggatgggtttgtggag
A0A8D1FTD4_MCL1-05      caaaacgagactggctagtcaaacaaagaggctgggatgggtttgtggag
A0A8D1G1G8_MCL1-01      caaaacgagactggctagtcaaacaaagaggctgggatgggtttgtggag
A0A8D1RYD1_MCL1-03      caaaacgagactggctagtcaaacaaagaggctgggatgggtttgtggag
A0A4X1SEU3_MCL1-01      caaaacgagactggctagtcaaacaaagaggctgggatgggtttgtggag
A0A8D1G1G8_MCL1-03      caaaacgagactggctagtcaaacaaagaggctgggatgggtttgtggag
A0A8D1FTD4_MCL1-02      caaaacgagactggctagtcaaacaaagaggctgggatgggtttgtggag
A0A8D1RYD1_MCL1-02      caaaacgagactggctagtcaaacaaagaggctgggatgggtttgtggag
A0A4X1SEZ6_MCL1-02      caaaacgagactggctagtcaaacaaagaggctgggatgggtttgtggag
A0A8D1FTD4_MCL1-04      caaaacgagactggctagtcaaacaaagaggctggg-taagttt------
A0A8D0QLD9_BCL2-07      --------------------------------------------------
A0A4X1TRR9_BCL2-06      --------------------------------------------------
A0A8D0QLD9_BCL2-05      ---------cctgacctg--------------tggaatggctccagtaac
A0A4X1TRR9_BCL2-05      ---------cctgacctg--------------tggaatggctccagtaac
A0A8D0QLD9_BCL2-04      ---------cctgacctg--------------tggaatggctccagtaac
A0A4X1TRR9_BCL2-07      ---------cctgacctg--------------tggaatggctccagtaac
A0A8D0QLD9_BCL2-06      ---------cctgacctg--------------tggaatggctccagtaac
A0A4X1TRR9_BCL2-04      ---------cctgacctg--------------tggaatggctccagtaac
A0A4X1TRR9_BCL2-02      ---------cctgacctg--------------tggaatggctccagtaac
A0A8D0QLD9_BCL2-02      ---------cctgacctg--------------tggaatggctccagtaac
                                                                          

A0A8D1N411_BCL2L10      --------------------------------------------------
A0A8D1ITC0_BCL2L10      --------------------------------------------------
A0A4X1T1Z2_BCL2L10      --------------------------------------------------
A0A8D1QEZ6_BCL2L10      --------------------------------------------------
A0A8D1ALD6_BCL2L1-      ccagtagaaacccaaacagaaagaggcagctctcactcagttgatctgat
A0A4X1SQU7_BCL2L1-      ccagtagaaacccaaacagaaacaggcagctctcactcagttgatctgat
A0A8D0XF62_BCL2L1-      ccagtagaaacccaaacagaaagaggcagctctcactcagttgatctgat
O77737_BCL2L1-01        ---------------------acgggca-------------tgactctag
A0A8D0J6V8_BCL2L1-      ---------------------acgggca-------------tgactctag
A0A8D0J6V8_BCL2L1-      ---------------------acgggca-------------tgactctag
A0A8D0J6V8_BCL2L1-      ---------------------acgggca-------------tgactctag
A0A8D0J6V8_BCL2L1-      ---------------------acgggca-------------tgactctag
A0A8D0J6V8_BCL2L1-      ---------------------acgggca-------------tgactctag
A0A4X1SQU7_BCL2L1-      ---------------------acgggca-------------tgactctag
A0A4X1SQU7_BCL2L1-      ---------------------acgggca-------------tgactctag
A0A4X1SQU7_BCL2L1-      ---------------------acgggca-------------tgactctag
A0A4X1SRM7_BCL2L1-      ---------------------acgggca-------------tgactctag
A0A8D0XF62_BCL2L1-      ---------------------acgggca-------------tgactctag
A0A8D1ALD6_BCL2L1-      ---------------------acgggca-------------tgactctag
A0A4X1SQU7_BCL2L1-      ---------------------acgggca-------------tgactctag
A0A4X1SF63_BCL2L2-      gaaccaacagaccaggcatcagcacaacagaccggggttttccacgagct
A0A4X1SF63_BCL2L2-      gaaccaacagaccaggcatcagcacaacagaccggggttttccacgagct
A0A8D0TJQ9_BCL2L2-      gaaccaacagaccaggcatcagcacaacagaccggggttttccacgagct
A0A482LX62_BCL2L2-      --------------------------------------------------
A0A3Q9B4M8_BCL2L2-      --------------------------------------------------
A0A7T8CLX7_BCL2L2-      --------------------------------------------------
A0A8D0TJQ9_BCL2L2-      --------------------------------------------------
A0A4X1SF60_BCL2L2-      --------------------------------------------------
A0A4X1SF63_BCL2L2-      --------------------------------------------------
A0A8D0TJQ9_BCL2L2-      --------------------------------------------------
A0A4X1SF63_BCL2L2-      gaaccaacagaccaggcatcagcacaacagaccggggttttccacgagct
A0A4D6NWN1_BCL2L2-      gaaccaacagaccaggcatcagcacaacagaccggggttttccacgagct
A0A4X1SF60_BCL2L2-      gaaccaacagaccaggcatcagcacaacagaccggggttttccacgagct
A0A4X1SF63_BCL2L2-      gaaccaacagaccaggcatcagcacaacagaccggggttttccacgagct
A0A8D0TJQ9_BCL2L2-      gaaccaacagaccaggcatcagcacaacagaccggggttttccacgagct
A0A4X1SF60_BCL2L2-      gaaccaacagaccaggcatcagcacaacagaccggggttttccacgagct
A0A8D0TJQ9_BCL2L2-      gaaccaacagaccaggcatcagcacaacagaccggggttttccacgagct
A0A8D0QLD9_BCL2-03      -------------------------agtggggaaaaaatcgcatctggac
A0A4X1TRR9_BCL2-01      -------------------------gctg--------------tatgggc
A0A8D0QLD9_BCL2-01      -------------------------gctg--------------tatgggc
A0A4X1TRR9_BCL2-03      --------------------------------------------------
A0A8D1BRF8_BCL2A1-      gaacatgacatgaag---------gtgat-t------gcc----------
A0A8D0Z1Y4_BCL2A1-      gaacatgacatgaag---------gtcatct------gctttcca-----
A0A8D1SK15_BCL2A1-      gaacatgacatgaag---------gtcatct------gctttcca-----
A0A4X1UP21_BCL2A1-      gaacatgacatgaag---------gtcatct------gctttcca-----
A0A8D1BRF8_BCL2A1-      gaacatgacatgaag---------gtcatct------gctttcca-----
A0A8D1YBS8_BCL2A1-      gaacatgacatgaag---------gtcatct------gctttcca-----
A0A4X1UP21_BCL2A1-      ----------tgaag----------------------------ca-----
A0A4X1UQW5_BCL2A1-      ----------tgaag----------------------------ca-----
A0A8D0Z1Y4_BCL2A1-      ----------tgaag----------------------------ca-----
A0A8D1BRF8_BCL2A1-      ----------tgaag----------------------------ca-----
A0A8D1SK15_BCL2A1-      ----------tgaag----------------------------ca-----
A0A8D1YBS8_BCL2A1-      ----------tgaag----------------------------ca-----
C7F841_BCL2A1-01        ----------tgaag----------------------------ca-----
A0A8D1KPD1_BCL2A1-      ----------tgaag----------------------------ca-----
A0A8D1BRF8_BCL2A1-      gaacatgacatgaag---------gtcatct------gctttcca-----
A0A4X1UP21_BCL2A1-      gaacatgacatgaag---------gtcatct------gctttcca-----
A0A8D1SK15_BCL2A1-      gaacatgacatgaag---------gtcatct------gctttcca-----
A0A8D0Z1Y4_BCL2A1-      gaacatgacatgaaggtagatgaagtcctttatgaagactcccca-----
A0A8D1YBS8_BCL2A1-      gaacatgacatgaaggtagatgaagtcctttatgaagactcccca-----
Q95KR3_MCL1-01          ttcttccatgtagaggacctagaaggcggcatcagaaatgtgctgctggc
A0A8D1FTD4_MCL1-03      ttcttccatgtagaggacctagaaggcggcatcag---------------
A0A8D1G1G8_MCL1-04      ttcttccatgtagaggacctagaaggcggcatcag---------------
A0A4X1SEZ6_MCL1-01      ttcttccatgtagaggacctagaaggcggcatcagaaatgtgctgctggc
A0A4X1SFB1_MCL1-01      ttcttccatgtagaggacctagaaggcggcatcagaaatgtgctgctggc
A0A8D1FTD4_MCL1-01      ttcttccatgtagaggacctagaaggcggcatcagaaatgtgctgctggc
A0A8D1G1G8_MCL1-02      ttcttccatgtagaggacctagaaggcggcatcagaaatgtgctgctggc
A0A8D1RYD1_MCL1-01      ttcttccatgtagaggacctagaaggcggcatcagaaatgtgctgctggc
A0A4X1SEU3_MCL1-02      ttcttccatgtagaggacctagaaggcggcatcagaaatgtgctgctggc
A0A4X1SEZ6_MCL1-03      ttcttccatgtagaggacctagaaggcggcatcagaaatgtgctgctggc
A0A4X1SFB1_MCL1-02      ttcttccatgtagaggacctagaaggcggcatcagaaatgtgctgctggc
A0A8D1FTD4_MCL1-05      ttcttccatgtagaggacctagaaggcggcatcagaaatgtgctgctggc
A0A8D1G1G8_MCL1-01      ttcttccatgtagaggacctagaaggcggcatcagaaatgtgctgctggc
A0A8D1RYD1_MCL1-03      ttcttccatgtagaggacctagaaggcggcatcagaaatgtgctgctggc
A0A4X1SEU3_MCL1-01      ttcttccatgtagaggacctagaaggcggcatcagaaatgtgctgctggc
A0A8D1G1G8_MCL1-03      ttcttccatgtagaggacctagaaggcggcatcagaaatgtgctgctggc
A0A8D1FTD4_MCL1-02      ttcttccatgtagaggacctagaaggcggcatcagaaatgtgctgctggc
A0A8D1RYD1_MCL1-02      ttcttccatgtagaggacctagaaggcggcatcagaaatgtgctgctggc
A0A4X1SEZ6_MCL1-02      ttcttccatgtagaggacctagaaggcggcatcagaaatgtgctgctggc
A0A8D1FTD4_MCL1-04      ------catttaa-------------------------------------
A0A8D0QLD9_BCL2-07      -------------------------gtggtcac----------catgggc
A0A4X1TRR9_BCL2-06      -------------------------gtggtcac----------catgggc
A0A8D0QLD9_BCL2-05      ttccatcactgaagggctccagcaggtggtcac----------catgggc
A0A4X1TRR9_BCL2-05      ttccatcactgaagggctccagcaggtggtcac----------catgggc
A0A8D0QLD9_BCL2-04      ttccatcactgaagggctccagcaggtggtcac----------catgggc
A0A4X1TRR9_BCL2-07      ttccatcactgaagggctccagcaggtggtcac----------catgggc
A0A8D0QLD9_BCL2-06      ttccatcactgaagggctccagcaggtggtcac----------catgggc
A0A4X1TRR9_BCL2-04      ttccatcactgaagggctccagcaggtggtcac----------catgggc
A0A4X1TRR9_BCL2-02      ttccatcactgaagggctccagcaggatgcctttgtggagctgtatgggc
A0A8D0QLD9_BCL2-02      ttccatcactgaagggctccagcaggatgcctttgtggagctgtatgggc
                                                                          

A0A8D1N411_BCL2L10      --------------------------------------------------
A0A8D1ITC0_BCL2L10      --------------------------------------------------
A0A4X1T1Z2_BCL2L10      --------------------------------------------------
A0A8D1QEZ6_BCL2L10      --------------------------------------------------
A0A8D1ALD6_BCL2L1-      ccagggagcccctgagattctgcccagacacaaacacctgcaacaggatc
A0A4X1SQU7_BCL2L1-      ccagggagcccctgagattctgcccagacacaaacacctgcaacaggatc
A0A8D0XF62_BCL2L1-      ccagggagcccctgagattctgcccagacacaaacacctgcaacaggatc
O77737_BCL2L1-01        ctggggtg------------------------------------------
A0A8D0J6V8_BCL2L1-      ctggggtg------------------------------------------
A0A8D0J6V8_BCL2L1-      ctggggtg------------------------------------------
A0A8D0J6V8_BCL2L1-      ctggggtg------------------------------------------
A0A8D0J6V8_BCL2L1-      ctggggtg------------------------------------------
A0A8D0J6V8_BCL2L1-      ctggggtg------------------------------------------
A0A4X1SQU7_BCL2L1-      ctggggtg------------------------------------------
A0A4X1SQU7_BCL2L1-      ctggggtg------------------------------------------
A0A4X1SQU7_BCL2L1-      ctggggtg------------------------------------------
A0A4X1SRM7_BCL2L1-      ctggggtg------------------------------------------
A0A8D0XF62_BCL2L1-      ctggggtg------------------------------------------
A0A8D1ALD6_BCL2L1-      ctggggtg------------------------------------------
A0A4X1SQU7_BCL2L1-      ctggggtg------------------------------------------
A0A4X1SF63_BCL2L2-      cgataccgtgcccggaccaccaactacaacagttcccgctctcgattcta
A0A4X1SF63_BCL2L2-      cgataccgtgcccggaccaccaactacaacagttcccgctctcgattcta
A0A8D0TJQ9_BCL2L2-      cgataccgtgcccggaccaccaactacaacagttcccgctctcgattcta
A0A482LX62_BCL2L2-      --------------------------------------------------
A0A3Q9B4M8_BCL2L2-      --------------------------------------------------
A0A7T8CLX7_BCL2L2-      --------------------------------------------------
A0A8D0TJQ9_BCL2L2-      --------------------------------------------------
A0A4X1SF60_BCL2L2-      --------------------------------------------------
A0A4X1SF63_BCL2L2-      --------------------------------------------------
A0A8D0TJQ9_BCL2L2-      --------------------------------------------------
A0A4X1SF63_BCL2L2-      cgataccgtgcccggaccaccaactacaacagttcccgctctcgattcta
A0A4D6NWN1_BCL2L2-      cgataccgtgcccggaccaccaactacaacagttcccgctctcgattcta
A0A4X1SF60_BCL2L2-      cgataccgtgcccggaccaccaactacaacagttcccgctctcgattcta
A0A4X1SF63_BCL2L2-      cgataccgtgcccggaccaccaactacaacagttcccgctctcgattcta
A0A8D0TJQ9_BCL2L2-      cgataccgtgcccggaccaccaactacaacagttcccgctctcgattcta
A0A4X1SF60_BCL2L2-      cgataccgtgcccggaccaccaactacaacagttcccgctctcgattcta
A0A8D0TJQ9_BCL2L2-      cgataccgtgcccggaccaccaactacaacagttcccgctctcgattcta
A0A8D0QLD9_BCL2-03      aaaggaagc-ttatctccccgaatctcaaaacctatgtcaagagaacctt
A0A4X1TRR9_BCL2-01      ccagcatgcggcctctatttgatttctcctggctgtctctgaagg--cgc
A0A8D0QLD9_BCL2-01      ccagcatgcggcctctatttgatttctcctggctgtctctgaagg--cgc
A0A4X1TRR9_BCL2-03      --------------ttacttga----------------------------
A0A8D1BRF8_BCL2A1-      --------------------------------------------------
A0A8D0Z1Y4_BCL2A1-      --------------------------------------------------
A0A8D1SK15_BCL2A1-      --------------------------------------------------
A0A4X1UP21_BCL2A1-      --------------------------------------------------
A0A8D1BRF8_BCL2A1-      --------------------------------------------------
A0A8D1YBS8_BCL2A1-      --------------------------------------------------
A0A4X1UP21_BCL2A1-      --------------------------------------------------
A0A4X1UQW5_BCL2A1-      --------------------------------------------------
A0A8D0Z1Y4_BCL2A1-      --------------------------------------------------
A0A8D1BRF8_BCL2A1-      --------------------------------------------------
A0A8D1SK15_BCL2A1-      --------------------------------------------------
A0A8D1YBS8_BCL2A1-      --------------------------------------------------
C7F841_BCL2A1-01        --------------------------------------------------
A0A8D1KPD1_BCL2A1-      --------------------------------------------------
A0A8D1BRF8_BCL2A1-      --------------------------------------------------
A0A4X1UP21_BCL2A1-      --------------------------------------------------
A0A8D1SK15_BCL2A1-      --------------------------------------------------
A0A8D0Z1Y4_BCL2A1-      --------------------------------------------------
A0A8D1YBS8_BCL2A1-      --------------------------------------------------
Q95KR3_MCL1-01          ttttgcag------------gtgttgctggagtag---------------
A0A8D1FTD4_MCL1-03      --------------------------------------------------
A0A8D1G1G8_MCL1-04      --------------------------------------------------
A0A4X1SEZ6_MCL1-01      ttttgcag------------gtgttgctggagtag---------------
A0A4X1SFB1_MCL1-01      ttttgcag------------gtgttgctggagtag---------------
A0A8D1FTD4_MCL1-01      ttttgcag------------gtgttgctggagtag---------------
A0A8D1G1G8_MCL1-02      ttttgcag------------gtgttgctggagtag---------------
A0A8D1RYD1_MCL1-01      ttttgcag------------gtgttgctggagtag---------------
A0A4X1SEU3_MCL1-02      ttttgcag------------gtgttgctggagtag---------------
A0A4X1SEZ6_MCL1-03      ttttgcag------------gtgttgctggagtag---------------
A0A4X1SFB1_MCL1-02      ttttgcag------------gtgttgctggagtag---------------
A0A8D1FTD4_MCL1-05      ttttgcag------------gtgttgctggagtag---------------
A0A8D1G1G8_MCL1-01      ttttgcag------------gtgttgctggagtag---------------
A0A8D1RYD1_MCL1-03      ttttgcag------------gtgttgctggagtag---------------
A0A4X1SEU3_MCL1-01      ttttgcag------------gtgttgctggagtag---------------
A0A8D1G1G8_MCL1-03      ttttgcag------------gtgttgctggagtag---------------
A0A8D1FTD4_MCL1-02      ttttgcagccacaaaatcctacgtctgtgaaatca---------------
A0A8D1RYD1_MCL1-02      ttttgcagccacaaaatcctacgtctgtgaaatca---------------
A0A4X1SEZ6_MCL1-02      ttttgcag--agaaaagcaagtggcaagaggatta---------------
A0A8D1FTD4_MCL1-04      --------------------------------------------------
A0A8D0QLD9_BCL2-07      cttttccgcactatcgctttgttttacctgggaagtttcg--------ac
A0A4X1TRR9_BCL2-06      cttttccgcactatcgctttgttttacctgggaagtttcg--------ac
A0A8D0QLD9_BCL2-05      cttttccgcactatcgctttgttttacctgggaagtttcg--------ac
A0A4X1TRR9_BCL2-05      cttttccgcactatcgctttgttttacctgggaagtttcg--------ac
A0A8D0QLD9_BCL2-04      cttttccgcactatcgctttgttttacctgggaagtttcg--------ac
A0A4X1TRR9_BCL2-07      cttttccgcactatcgctttgttttacctgggaagtttcg--------ac
A0A8D0QLD9_BCL2-06      cttttccgcactatcgctttgttttacctgggaagtttcg--------ac
A0A4X1TRR9_BCL2-04      cttttccgcactatcgctttgttttacctgggaagtttcg--------ac
A0A4X1TRR9_BCL2-02      ccagcatgcggcctctatttgatttctcctggctgtctctgaagg--cgc
A0A8D0QLD9_BCL2-02      ccagcatgcggcctctatttgatttctcctggctgtctctgaagg--cgc
                                                                          

A0A8D1N411_BCL2L10      --------------------------------------------------
A0A8D1ITC0_BCL2L10      --------------------------------------------------
A0A4X1T1Z2_BCL2L10      --------------------------------------------------
A0A8D1QEZ6_BCL2L10      --------------------------------------------------
A0A8D1ALD6_BCL2L1-      tcagcatcctgccggtaagaccctttccccaccccacgccgttcaggttt
A0A4X1SQU7_BCL2L1-      tcagcatcctgccggtaagaccctttccccaccccacgccgttcaggttt
A0A8D0XF62_BCL2L1-      tcagcatcctgccggtaagaccctttccccaccccacgccgttcaggttt
O77737_BCL2L1-01        -----gttctgctgg-------------------------gttcg-----
A0A8D0J6V8_BCL2L1-      -----gttctgctgg-------------------------gttcg-----
A0A8D0J6V8_BCL2L1-      -----gttctgctgg-------------------------gttcg-----
A0A8D0J6V8_BCL2L1-      -----gttctgctgg-------------------------gttcg-----
A0A8D0J6V8_BCL2L1-      -----gttctgctgg-------------------------gttcg-----
A0A8D0J6V8_BCL2L1-      -----gttctgctgg-------------------------gttcg-----
A0A4X1SQU7_BCL2L1-      -----gttctgctgg-------------------------gttcg-----
A0A4X1SQU7_BCL2L1-      -----gttctgctgg-------------------------gttcg-----
A0A4X1SQU7_BCL2L1-      -----gttctgctgg-------------------------gttcg-----
A0A4X1SRM7_BCL2L1-      -----gttctgctgg-------------------------gttcg-----
A0A8D0XF62_BCL2L1-      -----gttctgctgg-------------------------gttcg-----
A0A8D1ALD6_BCL2L1-      -----gttctgctgg-------------------------gttcg-----
A0A4X1SQU7_BCL2L1-      -----gttctgctgg-------------------------gttcg-----
A0A4X1SF63_BCL2L2-      cagtggttttaacagcaggccccggggtcgtgtctacaggggccgggcta
A0A4X1SF63_BCL2L2-      cagtggttttaacagcaggccccggggtcgtgtctaca--ggtcaggata
A0A8D0TJQ9_BCL2L2-      cagtggttttaacagcaggccccggggtcgtgtctaca--ggtcaggata
A0A482LX62_BCL2L2-      --------------------------------------------------
A0A3Q9B4M8_BCL2L2-      --------------------------------------------------
A0A7T8CLX7_BCL2L2-      --------------------------------------------------
A0A8D0TJQ9_BCL2L2-      --------------------------------------------------
A0A4X1SF60_BCL2L2-      --------------------------------------------------
A0A4X1SF63_BCL2L2-      --------------------------------------------------
A0A8D0TJQ9_BCL2L2-      --------------------------------------------------
A0A4X1SF63_BCL2L2-      cagtggttttaacagcaggccccggggtcgtgtctacagatgc-------
A0A4D6NWN1_BCL2L2-      cagtggttttaacagcaggccccggggtcgtgtctacaggggccgggcta
A0A4X1SF60_BCL2L2-      cagtggttttaacagcaggccccggggtcgtgtctacaggggccgggcta
A0A4X1SF63_BCL2L2-      cagtggttttaacagcaggccccggggtcgtgtctacaggggccgggcta
A0A8D0TJQ9_BCL2L2-      cagtggttttaacagcaggccccggggtcgtgtctacaggggccgggcta
A0A4X1SF60_BCL2L2-      cagtggttttaacagcaggccccggggtcgtgtctaca--ggtcaggata
A0A8D0TJQ9_BCL2L2-      cagtggttttaacagcaggccccggggtcgtgtctaca--ggtcaggata
A0A8D0QLD9_BCL2-03      tactgaagagagccatagagttaa---acactgtacttaattccaaccaa
A0A4X1TRR9_BCL2-01      tgctcagtctggccctggtgggagcttgcatcaccctgggtgcc------
A0A8D0QLD9_BCL2-01      tgctcagtctggccctggtgggagcttgcatcaccctgggtgcc------
A0A4X1TRR9_BCL2-03      --------------------------------------------------
A0A8D1BRF8_BCL2A1-      --------------------------------------------------
A0A8D0Z1Y4_BCL2A1-      --------------------------------------------------
A0A8D1SK15_BCL2A1-      --------------------------------------------------
A0A4X1UP21_BCL2A1-      --------------------------------------------------
A0A8D1BRF8_BCL2A1-      --------------------------------------------------
A0A8D1YBS8_BCL2A1-      --------------------------------------------------
A0A4X1UP21_BCL2A1-      --------------------------------------------------
A0A4X1UQW5_BCL2A1-      --------------------------------------------------
A0A8D0Z1Y4_BCL2A1-      --------------------------------------------------
A0A8D1BRF8_BCL2A1-      --------------------------------------------------
A0A8D1SK15_BCL2A1-      --------------------------------------------------
A0A8D1YBS8_BCL2A1-      --------------------------------------------------
C7F841_BCL2A1-01        --------------------------------------------------
A0A8D1KPD1_BCL2A1-      --------------------------------------------------
A0A8D1BRF8_BCL2A1-      --------------------------------------------------
A0A4X1UP21_BCL2A1-      --------------------------------------------------
A0A8D1SK15_BCL2A1-      --------------------------------------------------
A0A8D0Z1Y4_BCL2A1-      --------------------------------------------------
A0A8D1YBS8_BCL2A1-      --------------------------------------------------
Q95KR3_MCL1-01          ---------------------------------------gagct------
A0A8D1FTD4_MCL1-03      --------------------------------------------------
A0A8D1G1G8_MCL1-04      --------------------------------------------------
A0A4X1SEZ6_MCL1-01      ---------------------------------------gagct------
A0A4X1SFB1_MCL1-01      ---------------------------------------gagct------
A0A8D1FTD4_MCL1-01      ---------------------------------------gagct------
A0A8D1G1G8_MCL1-02      ---------------------------------------gagct------
A0A8D1RYD1_MCL1-01      ---------------------------------------gagct------
A0A4X1SEU3_MCL1-02      ---------------------------------------gagct------
A0A4X1SEZ6_MCL1-03      ---------------------------------------gagct------
A0A4X1SFB1_MCL1-02      ---------------------------------------gagct------
A0A8D1FTD4_MCL1-05      ---------------------------------------gagct------
A0A8D1G1G8_MCL1-01      ---------------------------------------gagct------
A0A8D1RYD1_MCL1-03      ---------------------------------------gagct------
A0A4X1SEU3_MCL1-01      ---------------------------------------gagct------
A0A8D1G1G8_MCL1-03      ---------------------------------------gagct------
A0A8D1FTD4_MCL1-02      ---------------------------------------aatgt------
A0A8D1RYD1_MCL1-02      ---------------------------------------aatgt------
A0A4X1SEZ6_MCL1-02      --------------------------------------------------
A0A8D1FTD4_MCL1-04      --------------------------------------------------
A0A8D0QLD9_BCL2-07      agcatagttcgtcgc-----------tgcatgatgcagagagct------
A0A4X1TRR9_BCL2-06      agcatagttcgtcgc-----------tgcatgatgcagagagct------
A0A8D0QLD9_BCL2-05      agcatagttcgtcgc-----------tgcatgatgcagagagct------
A0A4X1TRR9_BCL2-05      agcatagttcgtcgc-----------tgcatgatgcagagagct------
A0A8D0QLD9_BCL2-04      agcatagttcgtcgc-----------tgcatgatgcagagagct------
A0A4X1TRR9_BCL2-07      agcatagttcgtcgc-----------tgcatgatgcagagagct------
A0A8D0QLD9_BCL2-06      agcatagttcgtcgc-----------tgcatgatgcagagagct------
A0A4X1TRR9_BCL2-04      agcatagttcgtcgc-----------tgcatgatgcagagagct------
A0A4X1TRR9_BCL2-02      tgctcagtctggccctggtgggagcttgcatcaccctgggtgcc------
A0A8D0QLD9_BCL2-02      tgctcagtctggccctggtgggagcttgcatcaccctgggtgcc------
                                                                          

A0A8D1N411_BCL2L10      --------------------------------------------------
A0A8D1ITC0_BCL2L10      --------------------------------------------------
A0A4X1T1Z2_BCL2L10      --------------------------------------------------
A0A8D1QEZ6_BCL2L10      --------------------------------------------------
A0A8D1ALD6_BCL2L1-      catgcagaacccacttccgtcccctcagaccagaggagacaactgaggaa
A0A4X1SQU7_BCL2L1-      catgcaggacccacttccgtcccctcagaccagaggagacaactgaggaa
A0A8D0XF62_BCL2L1-      catgcaggacccacttccgtcccctcagaccagaggagacaactgaggaa
O77737_BCL2L1-01        -----------ctcttcagtc-------------ggaaatga--------
A0A8D0J6V8_BCL2L1-      -----------ctcttcagtc-------------ggaaatga--------
A0A8D0J6V8_BCL2L1-      -----------ctcttcagtc-------------ggaaatga--------
A0A8D0J6V8_BCL2L1-      -----------ctcttcagtc-------------ggaaatga--------
A0A8D0J6V8_BCL2L1-      -----------ctcttcagtc-------------ggaaatga--------
A0A8D0J6V8_BCL2L1-      -----------ctcttcagtc-------------ggaaatga--------
A0A4X1SQU7_BCL2L1-      -----------ctcttcagtc-------------ggaaatga--------
A0A4X1SQU7_BCL2L1-      -----------ctcttcagtc-------------ggaaatga--------
A0A4X1SQU7_BCL2L1-      -----------ctcttcagtc-------------ggaaatga--------
A0A4X1SRM7_BCL2L1-      -----------ctcttcagtc-------------ggaaatga--------
A0A8D0XF62_BCL2L1-      -----------ctcttcagtc-------------ggaaatga--------
A0A8D1ALD6_BCL2L1-      -----------ctcttcagtc-------------ggaaatga--------
A0A4X1SQU7_BCL2L1-      -----------ctcttcagtc-------------ggaaatga--------
A0A4X1SF63_BCL2L2-      gagcgacatcatggtttctgtag---------------------------
A0A4X1SF63_BCL2L2-      g-------------------------------------------------
A0A8D0TJQ9_BCL2L2-      g-------------------------------------------------
A0A482LX62_BCL2L2-      --------------------------------------------------
A0A3Q9B4M8_BCL2L2-      --------------------------------------------------
A0A7T8CLX7_BCL2L2-      --------------------------------------------------
A0A8D0TJQ9_BCL2L2-      --------------------------------------------------
A0A4X1SF60_BCL2L2-      --------------------------------------------------
A0A4X1SF63_BCL2L2-      --------------------------------------------------
A0A8D0TJQ9_BCL2L2-      --------------------------------------------------
A0A4X1SF63_BCL2L2-      -----acttctttatttgccactgtttggcggaagtag------------
A0A4D6NWN1_BCL2L2-      gagcgacatcatggtattccccttactaa---------------------
A0A4X1SF60_BCL2L2-      gagcgacatcatggtattccccttactaa---------------------
A0A4X1SF63_BCL2L2-      gagcgacatcatggtattccccttactaa---------------------
A0A8D0TJQ9_BCL2L2-      gagcgacatcatggtattccccttactaa---------------------
A0A4X1SF60_BCL2L2-      g-------------------------------------------------
A0A8D0TJQ9_BCL2L2-      g-------------------------------------------------
A0A8D0QLD9_BCL2-03      aaactagataaagggttagaaatcagtgttattagtggcctctccttcct
A0A4X1TRR9_BCL2-01      --------------------tatctgggccataagtga------------
A0A8D0QLD9_BCL2-01      --------------------tatctgggccataagtga------------
A0A4X1TRR9_BCL2-03      --------------------------------------------------
A0A8D1BRF8_BCL2A1-      -------------------------cagttatatatttag----------
A0A8D0Z1Y4_BCL2A1-      -------------------acactgcaagtgaacctgtag----------
A0A8D1SK15_BCL2A1-      -------------------acactgcaagtgaacctgtag----------
A0A4X1UP21_BCL2A1-      -------------------acactgcaagtgaacctgtag----------
A0A8D1BRF8_BCL2A1-      -------------------acactgcaagtgaacctgtag----------
A0A8D1YBS8_BCL2A1-      -------------------acactgcaagtgaacctgtag----------
A0A4X1UP21_BCL2A1-      -------------------atactattga---------------------
A0A4X1UQW5_BCL2A1-      -------------------atactattga---------------------
A0A8D0Z1Y4_BCL2A1-      -------------------atactattga---------------------
A0A8D1BRF8_BCL2A1-      -------------------atactattga---------------------
A0A8D1SK15_BCL2A1-      -------------------atactattga---------------------
A0A8D1YBS8_BCL2A1-      -------------------atactattga---------------------
C7F841_BCL2A1-01        -------------------atactattga---------------------
A0A8D1KPD1_BCL2A1-      -------------------atactattga---------------------
A0A8D1BRF8_BCL2A1-      -------------------acactgcaagtgaacctgtag----------
A0A4X1UP21_BCL2A1-      -------------------acactgcaagtgaacctgtag----------
A0A8D1SK15_BCL2A1-      -------------------acactgcaagtgaacctgtag----------
A0A8D0Z1Y4_BCL2A1-      -------------------gcatcctaa----------------------
A0A8D1YBS8_BCL2A1-      -------------------gcgtcctaa----------------------
Q95KR3_MCL1-01          ------------ggtt------tggcatatctaataagatag--------
A0A8D1FTD4_MCL1-03      ----------------------------atctaataagatagccttttaa
A0A8D1G1G8_MCL1-04      ----------------------------atctaataagatagccttttaa
A0A4X1SEZ6_MCL1-01      ------------ggtt------tggcatatctaataagatag--------
A0A4X1SFB1_MCL1-01      ------------ggtt------tggcatatctaataagatag--------
A0A8D1FTD4_MCL1-01      ------------ggtt------tggcatatctaataagatag--------
A0A8D1G1G8_MCL1-02      ------------ggtt------tggcatatctaataagatag--------
A0A8D1RYD1_MCL1-01      ------------ggtt------tggcatatctaataagatag--------
A0A4X1SEU3_MCL1-02      ------------ggtt------tggcatatctaataagatag--------
A0A4X1SEZ6_MCL1-03      ------------ggtt------tggcatatctaataagatag--------
A0A4X1SFB1_MCL1-02      ------------ggtt------tggcatatctaataagatag--------
A0A8D1FTD4_MCL1-05      ------------ggtt------tggcatatctaataagatag--------
A0A8D1G1G8_MCL1-01      ------------ggtt------tggcatatctaataagatag--------
A0A8D1RYD1_MCL1-03      ------------ggtt------tggcatatctaataagatag--------
A0A4X1SEU3_MCL1-01      ------------ggtt------tggcatatctaataagatag--------
A0A8D1G1G8_MCL1-03      ------------ggtt------tggcatatctaataagatag--------
A0A8D1FTD4_MCL1-02      ------------atttatgaagttggacttcagactgtctag--------
A0A8D1RYD1_MCL1-02      ------------atttatgaagttggacttcagactgtctag--------
A0A4X1SEZ6_MCL1-02      -----------------------------------tgactga--------
A0A8D1FTD4_MCL1-04      --------------------------------------------------
A0A8D0QLD9_BCL2-07      ------------agatcggaaattgcagacaaaactgcctaa--------
A0A4X1TRR9_BCL2-06      ------------agatcggaaattgcagacaaaactgcctaa--------
A0A8D0QLD9_BCL2-05      ------------agatcggaaattgcagacaaaactgcctaa--------
A0A4X1TRR9_BCL2-05      ------------agatcggaaattgcagacaaaactgcctaa--------
A0A8D0QLD9_BCL2-04      ------------agatcggaaattgcagacaaaactgcctaa--------
A0A4X1TRR9_BCL2-07      ------------agatcggaaattgcagacaaaactgcctaa--------
A0A8D0QLD9_BCL2-06      ------------agatcggaaattgcagacaaaactgcctaa--------
A0A4X1TRR9_BCL2-04      ------------agatcggaaattgcagacaaaactgcctaa--------
A0A4X1TRR9_BCL2-02      ------------tatctgg--------gccataagtg----a--------
A0A8D0QLD9_BCL2-02      ------------tatctgg--------gccataagtg----a--------
                                                                          

A0A8D1N411_BCL2L10      -------
A0A8D1ITC0_BCL2L10      -------
A0A4X1T1Z2_BCL2L10      -------
A0A8D1QEZ6_BCL2L10      -------
A0A8D1ALD6_BCL2L1-      gacgtag
A0A4X1SQU7_BCL2L1-      gacgtag
A0A8D0XF62_BCL2L1-      gacgtag
O77737_BCL2L1-01        -------
A0A8D0J6V8_BCL2L1-      -------
A0A8D0J6V8_BCL2L1-      -------
A0A8D0J6V8_BCL2L1-      -------
A0A8D0J6V8_BCL2L1-      -------
A0A8D0J6V8_BCL2L1-      -------
A0A4X1SQU7_BCL2L1-      -------
A0A4X1SQU7_BCL2L1-      -------
A0A4X1SQU7_BCL2L1-      -------
A0A4X1SRM7_BCL2L1-      -------
A0A8D0XF62_BCL2L1-      -------
A0A8D1ALD6_BCL2L1-      -------
A0A4X1SQU7_BCL2L1-      -------
A0A4X1SF63_BCL2L2-      -------
A0A4X1SF63_BCL2L2-      -------
A0A8D0TJQ9_BCL2L2-      -------
A0A482LX62_BCL2L2-      -------
A0A3Q9B4M8_BCL2L2-      -------
A0A7T8CLX7_BCL2L2-      -------
A0A8D0TJQ9_BCL2L2-      -------
A0A4X1SF60_BCL2L2-      -------
A0A4X1SF63_BCL2L2-      -------
A0A8D0TJQ9_BCL2L2-      -------
A0A4X1SF63_BCL2L2-      -------
A0A4D6NWN1_BCL2L2-      -------
A0A4X1SF60_BCL2L2-      -------
A0A4X1SF63_BCL2L2-      -------
A0A8D0TJQ9_BCL2L2-      -------
A0A4X1SF60_BCL2L2-      -------
A0A8D0TJQ9_BCL2L2-      -------
A0A8D0QLD9_BCL2-03      tccttaa
A0A4X1TRR9_BCL2-01      -------
A0A8D0QLD9_BCL2-01      -------
A0A4X1TRR9_BCL2-03      -------
A0A8D1BRF8_BCL2A1-      -------
A0A8D0Z1Y4_BCL2A1-      -------
A0A8D1SK15_BCL2A1-      -------
A0A4X1UP21_BCL2A1-      -------
A0A8D1BRF8_BCL2A1-      -------
A0A8D1YBS8_BCL2A1-      -------
A0A4X1UP21_BCL2A1-      -------
A0A4X1UQW5_BCL2A1-      -------
A0A8D0Z1Y4_BCL2A1-      -------
A0A8D1BRF8_BCL2A1-      -------
A0A8D1SK15_BCL2A1-      -------
A0A8D1YBS8_BCL2A1-      -------
C7F841_BCL2A1-01        -------
A0A8D1KPD1_BCL2A1-      -------
A0A8D1BRF8_BCL2A1-      -------
A0A4X1UP21_BCL2A1-      -------
A0A8D1SK15_BCL2A1-      -------
A0A8D0Z1Y4_BCL2A1-      -------
A0A8D1YBS8_BCL2A1-      -------
Q95KR3_MCL1-01          -------
A0A8D1FTD4_MCL1-03      -------
A0A8D1G1G8_MCL1-04      -------
A0A4X1SEZ6_MCL1-01      -------
A0A4X1SFB1_MCL1-01      -------
A0A8D1FTD4_MCL1-01      -------
A0A8D1G1G8_MCL1-02      -------
A0A8D1RYD1_MCL1-01      -------
A0A4X1SEU3_MCL1-02      -------
A0A4X1SEZ6_MCL1-03      -------
A0A4X1SFB1_MCL1-02      -------
A0A8D1FTD4_MCL1-05      -------
A0A8D1G1G8_MCL1-01      -------
A0A8D1RYD1_MCL1-03      -------
A0A4X1SEU3_MCL1-01      -------
A0A8D1G1G8_MCL1-03      -------
A0A8D1FTD4_MCL1-02      -------
A0A8D1RYD1_MCL1-02      -------
A0A4X1SEZ6_MCL1-02      -------
A0A8D1FTD4_MCL1-04      -------
A0A8D0QLD9_BCL2-07      -------
A0A4X1TRR9_BCL2-06      -------
A0A8D0QLD9_BCL2-05      -------
A0A4X1TRR9_BCL2-05      -------
A0A8D0QLD9_BCL2-04      -------
A0A4X1TRR9_BCL2-07      -------
A0A8D0QLD9_BCL2-06      -------
A0A4X1TRR9_BCL2-04      -------
A0A4X1TRR9_BCL2-02      -------
A0A8D0QLD9_BCL2-02      -------
                               

© 1998-2023Legal notice