Dataset for CDS BCL-2 of organism Oncorhynchus tshawytscha

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C8GL24_BCL2-01      atgatggcaaacgagaatccttataacagtcgctttattgtcgaaaaata
A0A8C8JWJ1_BCL2-01      ---atggcaaacg---------acgacaaccgctgtatagtggaaaagta
A0A8C8JWJ1_BCL2-02      ---atggcaaacg---------acgacaaccgctgtatagtggaaaagta
                           **********         *  ***  **** *** ** ***** **

A0A8C8GL24_BCL2-01      catccatcacaaactgttgaaagtgggatttgtatggaaatttcaagga-
A0A8C8JWJ1_BCL2-01      catttgtcacaaactcttgaaaaggggatatgcgtgg-gatttcgagaat
A0A8C8JWJ1_BCL2-02      catttgtcacaaactcttgaaaaggggatatgcgtgg-gatttcgagaat
                        ***   ********* ******  ***** **  ***  ***** ** * 

A0A8C8GL24_BCL2-01      ---gaaaacgattctccaaataatggctttggggacccctctacacccaa
A0A8C8JWJ1_BCL2-01      gccgaggaagatgctgataataatgggtcgatgatttctcctccgcct--
A0A8C8JWJ1_BCL2-02      gccgaggaagatgctgataataatgggtcgatgatttctcctccgcct--
                           **  * *** **   ******** *    *    *  ** * **   

A0A8C8GL24_BCL2-01      ctcccccgaagtttttgcacggaggtccca---gcccactgccgcgggag
A0A8C8JWJ1_BCL2-01      ----------ggtttgncacggcggtgccacggggccaataacgccagac
A0A8C8JWJ1_BCL2-02      ----------ggtttgncacggcggtgccacggggccaataacgccagac
                                  * ***  ***** *** ***   * *** *  ***  ** 

A0A8C8GL24_BCL2-01      aggacaccgactctcct-taccaaaacagcagtccgcaacctgacccaca
A0A8C8JWJ1_BCL2-01      cgggcagcgtcccccatctttccaaacggctctcc-caaacggacccgca
A0A8C8JWJ1_BCL2-02      cgggcagcgtcccccatctttccaaacggctctcc-caaacggacccgca
                         ** ** ** * * * * *  * **** **  *** *** * ***** **

A0A8C8GL24_BCL2-01      tgccaggctccacagggtcctgcgcgaggctggtggcgagattgaaagaa
A0A8C8JWJ1_BCL2-01      tgcagctattcacagagttttgcgtgaggccggggacgaactcgaacgac
A0A8C8JWJ1_BCL2-02      tgcagctattcacagagttttgcgtgaggccggggacgaactcgaacgac
                        ***     * ***** **  **** ***** ** * ***  * *** ** 

A0A8C8GL24_BCL2-01      tgtatcagcgggactttgcagagatgtcggggcagttgcattttacaccc
A0A8C8JWJ1_BCL2-01      tgtaccagcccgactttgcggagatgtcacaccaattgtatctcacgtct
A0A8C8JWJ1_BCL2-02      tgtaccagcccgactttgcggagatgtcacaccaattgtatctcacgtct
                        **** ****  ******** ********    ** *** ** * **  * 

A0A8C8GL24_BCL2-01      agcacggcacagagaaggtttaccgctgtaatagatgagctcttcagcga
A0A8C8JWJ1_BCL2-01      tctatggcagaaaggagattcagagaggtgatagacgagctgttcaggga
A0A8C8JWJ1_BCL2-02      tctatggcagaaaggagattcagagaggtgatagacgagctgttcaggga
                           * **** * ** ** ** *  *  ** ***** ***** ***** **

A0A8C8GL24_BCL2-01      cggggtaaactggggtcggattgtggctttctttgagtttggagggacaa
A0A8C8JWJ1_BCL2-01      cggggttaactggggacgaattgtagccttcttcgagttcggtggcacaa
A0A8C8JWJ1_BCL2-02      cggggttaactggggacgaattgtagccttcttcgagttcggtggcacaa
                        ****** ******** ** ***** ** ***** ***** ** ** ****

A0A8C8GL24_BCL2-01      tgtgcgtggagagcgtcaaccgggagatgacgtcccaagtagacaacatc
A0A8C8JWJ1_BCL2-01      tatgtgtggaatgcgtgaacaaggaaatgacgtcgcaggttgaccacatc
A0A8C8JWJ1_BCL2-02      tatgtgtggaatgcgtgaacaaggaaatgacgtcgcaggttgaccacatc
                        * ** *****  **** ***  *** ******** ** ** *** *****

A0A8C8GL24_BCL2-01      gctcgttggatgacggagtacttgaacggacccctacagaactggatcca
A0A8C8JWJ1_BCL2-01      gccgggtggatggcggagtatctaaatggaccgctgcacaactggattca
A0A8C8JWJ1_BCL2-02      gccgggtggatggcggagtatctaaatggaccgctgcacaactggattca
                        **  * ****** *******  * ** ***** ** ** ******** **

A0A8C8GL24_BCL2-01      ggagaatggtggctggg-----acgcctttgtggag--------------
A0A8C8JWJ1_BCL2-01      agagaacgggggatggg-----aggcctttgttgag--------------
A0A8C8JWJ1_BCL2-02      agagaacgggggatggatctgcaggcacttccaaaggagactccccagag
                         ***** ** ** ***      * **  **    **              

A0A8C8GL24_BCL2-01      ------atctatgagcag-----cagaggatctct-----------cact
A0A8C8JWJ1_BCL2-01      ------ctctatgacaga-----cagagggactcc-----gtgttcggtt
A0A8C8JWJ1_BCL2-02      gagaccccccagaggagaccccccaaagggaccccccagaggagaccccc
                                * *            ** ***  * *                

A0A8C8GL24_BCL2-01      cctgg----------------tcgtacttaaagacagtgttcggcctggc
A0A8C8JWJ1_BCL2-01      catgg----------------ccgtccatcaagactgtctttggcctggc
A0A8C8JWJ1_BCL2-02      cagggagactcccaaagtagaccccccaaagggactccccagaggagacc
                        *  **                 *   *     ***        *     *

A0A8C8GL24_BCL2-01      cgccctgggagcc-------------------------------------
A0A8C8JWJ1_BCL2-01      tgcactgggggcc-------------------------------------
A0A8C8JWJ1_BCL2-02      cccacaggagaccccccagagggaccccccaaggagaccccccaaaggag
                          * * **   **                                     

A0A8C8GL24_BCL2-01      ---------gccggagtcaccatcggagccttgttcacccagaag-----
A0A8C8JWJ1_BCL2-01      ---------gcaagccttaccatcggagcttaccttacacagaag-----
A0A8C8JWJ1_BCL2-02      accccccgaggaggaccccccagaggag---accccccagaggagacacc
                                 *   *     ***  ****         *  ** **     

A0A8C8GL24_BCL2-01      ------------------------------------tga
A0A8C8JWJ1_BCL2-01      ------------------------------------tga
A0A8C8JWJ1_BCL2-02      ccagcaagctttgaacatgggaatacacacactgcttga
                                                            ***

© 1998-2023Legal notice