Dataset for CDS BCL-2 of organism Oncorhynchus tshawytscha

[Download (right click)] [Alignment] [Repertoires]

3 sequence(s)

>gnl|bcl2dbcds|A0A8C8GL24_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Oncorhynchus tshawytscha GN=BCL-2 (length=687 residues).
atgatggcaaacgagaatccttataacagtcgctttattgtcgaaaaatacatccatcacaaactgttgaaagtgggatt
tgtatggaaatttcaaggagaaaacgattctccaaataatggctttggggacccctctacacccaactcccccgaagttt
ttgcacggaggtcccagcccactgccgcgggagaggacaccgactctccttaccaaaacagcagtccgcaacctgaccca
catgccaggctccacagggtcctgcgcgaggctggtggcgagattgaaagaatgtatcagcgggactttgcagagatgtc
ggggcagttgcattttacacccagcacggcacagagaaggtttaccgctgtaatagatgagctcttcagcgacggggtaa
actggggtcggattgtggctttctttgagtttggagggacaatgtgcgtggagagcgtcaaccgggagatgacgtcccaa
gtagacaacatcgctcgttggatgacggagtacttgaacggacccctacagaactggatccaggagaatggtggctggga
cgcctttgtggagatctatgagcagcagaggatctctcactcctggtcgtacttaaagacagtgttcggcctggccgccc
tgggagccgccggagtcaccatcggagccttgttcacccagaagtga
>gnl|bcl2dbcds|A0A8C8JWJ1_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Oncorhynchus tshawytscha GN=BCL-2 (length=675 residues).
atggcaaacgacgacaaccgctgtatagtggaaaagtacatttgtcacaaactcttgaaaaggggatatgcgtgggattt
cgagaatgccgaggaagatgctgataataatgggtcgatgatttctcctccgcctggtttgncacggcggtgccacgggg
ccaataacgccagaccgggcagcgtcccccatctttccaaacggctctcccaaacggacccgcatgcagctattcacaga
gttttgcgtgaggccggggacgaactcgaacgactgtaccagcccgactttgcggagatgtcacaccaattgtatctcac
gtcttctatggcagaaaggagattcagagaggtgatagacgagctgttcagggacggggttaactggggacgaattgtag
ccttcttcgagttcggtggcacaatatgtgtggaatgcgtgaacaaggaaatgacgtcgcaggttgaccacatcgccggg
tggatggcggagtatctaaatggaccgctgcacaactggattcaagagaacgggggatgggaggcctttgttgagctcta
tgacagacagagggactccgtgttcggttcatggccgtccatcaagactgtctttggcctggctgcactgggggccgcaa
gccttaccatcggagcttaccttacacagaagtga
>gnl|bcl2dbcds|A0A8C8JWJ1_BCL2-02 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Oncorhynchus tshawytscha GN=BCL-2 (length=810 residues).
atggcaaacgacgacaaccgctgtatagtggaaaagtacatttgtcacaaactcttgaaaaggggatatgcgtgggattt
cgagaatgccgaggaagatgctgataataatgggtcgatgatttctcctccgcctggtttgncacggcggtgccacgggg
ccaataacgccagaccgggcagcgtcccccatctttccaaacggctctcccaaacggacccgcatgcagctattcacaga
gttttgcgtgaggccggggacgaactcgaacgactgtaccagcccgactttgcggagatgtcacaccaattgtatctcac
gtcttctatggcagaaaggagattcagagaggtgatagacgagctgttcagggacggggttaactggggacgaattgtag
ccttcttcgagttcggtggcacaatatgtgtggaatgcgtgaacaaggaaatgacgtcgcaggttgaccacatcgccggg
tggatggcggagtatctaaatggaccgctgcacaactggattcaagagaacgggggatggatctgcaggcacttccaaag
gagactccccagaggagaccccccagaggagaccccccaaagggaccccccagaggagaccccccagggagactcccaaa
gtagaccccccaaagggactccccagaggagacccccacaggagaccccccagagggaccccccaaggagaccccccaaa
ggagaccccccgaggaggaccccccagaggagaccccccagaggagacaccccagcaagctttgaacatgggaatacaca
cactgcttga
© 1998-2023Legal notice