Dataset for CDS BCL2L10 of organism Echeneis naucrates

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A665VTJ8_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Echeneis naucrates GN=BCL2L10 (length=579 residues).
atgtcatgtggggtgtggaaagagaccttggttgtggcagaggactacctatacctttgctgcacaaagccacagccagc
acccccacctcccagcgaatcagccgctgccatgaggaccgtggcccaggacatggaggcgcagcaccaggctcgcttcc
actcccttgttcagaccttcctgaagcagtctgggcaggacccctgtggcagcctcaggaaggtgatggaggagctggtg
ggagatggacacttgaactgggggagggtggtttccattttcacctttactggggtgctggccagacagctgctggagca
gagtggcatgaatccggggctggaccctgggaaaaaactgggacaggggcctggactctgcaggggactggcggagacca
tagctgattacctgggagaggagaagaaagactggctgctggagaatgatggatgggagggattctgtaagttctctcaa
agtgccagagaggtgagtcaggactcgtcaatgaagacggcgctgtttgctgctgctggcgtgggcctcgctggactcac
cttcctcctggtacgctag
© 1998-2020Legal notice